Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FAM173A Gene

Aliases for FAM173A Gene

  • Family With Sequence Similarity 173 Member A 2 3 5
  • C16orf24 3 4
  • Family With Sequence Similarity 173, Member A 2
  • Chromosome 16 Open Reading Frame 24 2
  • Protein FAM173A 3

External Ids for FAM173A Gene

Previous HGNC Symbols for FAM173A Gene

  • C16orf24

Previous GeneCards Identifiers for FAM173A Gene

  • GC16P000713
  • GC16P000771
  • GC16P000693
  • GC16P000770
  • GC16P000819
  • GC16P000863
  • GC16P000878

Summaries for FAM173A Gene

GeneCards Summary for FAM173A Gene

FAM173A (Family With Sequence Similarity 173 Member A) is a Protein Coding gene. An important paralog of this gene is FAM173B.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FAM173A Gene

Genomics for FAM173A Gene

Regulatory Elements for FAM173A Gene

Enhancers for FAM173A Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
- Elite enhancer/Elite enhancer-gene association

Enhancers around FAM173A on UCSC Golden Path with GeneCards custom track

Promoters for FAM173A Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

Genomic Location for FAM173A Gene

Chromosome:
16
Start:
720,581 bp from pter
End:
722,601 bp from pter
Size:
2,021 bases
Orientation:
Plus strand

Genomic View for FAM173A Gene

Genes around FAM173A on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FAM173A Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FAM173A Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FAM173A Gene

Proteins for FAM173A Gene

  • Protein details for FAM173A Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9BQD7-F173A_HUMAN
    Recommended name:
    Protein FAM173A
    Protein Accession:
    Q9BQD7
    Secondary Accessions:
    • A2IDD4

    Protein attributes for FAM173A Gene

    Size:
    235 amino acids
    Molecular mass:
    25130 Da
    Quaternary structure:
    No Data Available

neXtProt entry for FAM173A Gene

Post-translational modifications for FAM173A Gene

  • Glycosylation at Asn 144
  • Modification sites at PhosphoSitePlus

Other Protein References for FAM173A Gene

No data available for DME Specific Peptides for FAM173A Gene

Domains & Families for FAM173A Gene

Protein Domains for FAM173A Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for FAM173A Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q9BQD7

UniProtKB/Swiss-Prot:

F173A_HUMAN :
  • Belongs to the FAM173 family.
Family:
  • Belongs to the FAM173 family.
genes like me logo Genes that share domains with FAM173A: view

No data available for Gene Families for FAM173A Gene

Function for FAM173A Gene

genes like me logo Genes that share phenotypes with FAM173A: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for FAM173A Gene

Localization for FAM173A Gene

Subcellular locations from UniProtKB/Swiss-Prot for FAM173A Gene

Membrane; Single-pass membrane protein.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for FAM173A Gene COMPARTMENTS Subcellular localization image for FAM173A gene
Compartment Confidence
cytosol 3
extracellular 1
mitochondrion 1
nucleus 1
peroxisome 1

Gene Ontology (GO) - Cellular Components for FAM173A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with FAM173A: view

Pathways & Interactions for FAM173A Gene

SuperPathways for FAM173A Gene

No Data Available

Gene Ontology (GO) - Biological Process for FAM173A Gene

None

No data available for Pathways by source and SIGNOR curated interactions for FAM173A Gene

Drugs & Compounds for FAM173A Gene

No Compound Related Data Available

Transcripts for FAM173A Gene

Unigene Clusters for FAM173A Gene

Family with sequence similarity 173, member A:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for FAM173A Gene

ExUns: 1a · 1b · 1c · 1d ^ 2a · 2b ^ 3a · 3b · 3c · 3d ^ 4a · 4b · 4c
SP1: - - -
SP2: - - - -
SP3: - -
SP4: - - -
SP5: -
SP6: -
SP7: - -

Relevant External Links for FAM173A Gene

GeneLoc Exon Structure for
FAM173A
ECgene alternative splicing isoforms for
FAM173A

Expression for FAM173A Gene

mRNA expression in normal human tissues for FAM173A Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for FAM173A Gene



NURSA nuclear receptor signaling pathways regulating expression of FAM173A Gene:

FAM173A

SOURCE GeneReport for Unigene cluster for FAM173A Gene:

Hs.166244
genes like me logo Genes that share expression patterns with FAM173A: view

Primer Products

No data available for mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for FAM173A Gene

Orthologs for FAM173A Gene

This gene was present in the common ancestor of animals.

Orthologs for FAM173A Gene

Organism Taxonomy Gene Similarity Type Details
cow
(Bos Taurus)
Mammalia FAM173A 34
  • 86.61 (n)
  • 88.39 (a)
FAM173A 35
  • 88 (a)
OneToOne
chimpanzee
(Pan troglodytes)
Mammalia FAM173A 34
  • 98.87 (n)
  • 97.45 (a)
FAM173A 35
  • 97 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Fam173a 34
  • 79.73 (n)
  • 84.68 (a)
oppossum
(Monodelphis domestica)
Mammalia FAM173A 35
  • 70 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Fam173a 35
  • 79 (a)
OneToOne
Fam173a 16
Fam173a 34
  • 78.37 (n)
  • 81.33 (a)
platypus
(Ornithorhynchus anatinus)
Mammalia FAM173A 35
  • 67 (a)
OneToOne
chicken
(Gallus gallus)
Aves FAM173A 34
  • 66.67 (n)
  • 60.7 (a)
FAM173A 35
  • 57 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia FAM173A 35
  • 57 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia fam173a 34
  • 66.5 (n)
  • 66.33 (a)
zebrafish
(Danio rerio)
Actinopterygii fam173a 34
  • 55.56 (n)
  • 57.75 (a)
fam173a 35
  • 57 (a)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta CG3337 35
  • 35 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea Y39A1A.21 35
  • 33 (a)
OneToMany
Species where no ortholog for FAM173A was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for FAM173A Gene

ENSEMBL:
Gene Tree for FAM173A (if available)
TreeFam:
Gene Tree for FAM173A (if available)

Paralogs for FAM173A Gene

Paralogs for FAM173A Gene

(1) SIMAP similar genes for FAM173A Gene using alignment to 4 proteins:

genes like me logo Genes that share paralogs with FAM173A: view

Variants for FAM173A Gene

Sequence variations from dbSNP and Humsavar for FAM173A Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
rs3169403 -- 719,247(+) CATGA(A/G)ACACA upstream-variant-2KB
rs3752555 -- 721,750(+) CCTGC(C/T)GGCGG intron-variant
rs3809669 -- 720,148(+) GGCTC(C/T)AGACC upstream-variant-2KB
rs3809670 -- 720,347(+) TGTGT(G/T)GTTTT upstream-variant-2KB
rs3840855 -- 720,217(+) TTCAC(-/GGGTGTTCAGCCCTACCCTGGGTGTGGAGGTCGTGGCCC)AGCTG upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for FAM173A Gene

Variant ID Type Subtype PubMed ID
dgv4825n54 CNV loss 21841781
esv2422427 CNV duplication 17116639
nsv1160325 CNV duplication 26073780
nsv1160326 CNV duplication 26073780
nsv457311 CNV loss 19166990
nsv471063 CNV loss 18288195
nsv471065 CNV gain 18288195
nsv516590 CNV loss 19592680
nsv526903 CNV loss 19592680
nsv571012 CNV loss 21841781
nsv571021 CNV loss 21841781
nsv571022 CNV loss 21841781
nsv9321 CNV gain+loss 18304495
nsv952898 CNV deletion 24416366

Variation tolerance for FAM173A Gene

Gene Damage Index Score: 3.27; 52.94% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for FAM173A Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
FAM173A

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for FAM173A Gene

Disorders for FAM173A Gene

Relevant External Links for FAM173A

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
FAM173A

No disorders were found for FAM173A Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for FAM173A Gene

Publications for FAM173A Gene

  1. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 65
  2. Sequence, structure and pathology of the fully annotated terminal 2 Mb of the short arm of human chromosome 16. (PMID: 11157797) Daniels R.J. … Higgs D.R. (Hum. Mol. Genet. 2001) 3 4 65
  3. A germline-specific class of small RNAs binds mammalian Piwi proteins. (PMID: 16751776) Girard A. … Carmell M.A. (Nature 2006) 3 65
  4. A human protein-protein interaction network: a resource for annotating the proteome. (PMID: 16169070) Stelzl U. … Wanker E.E. (Cell 2005) 3 65
  5. The sequence and analysis of duplication-rich human chromosome 16. (PMID: 15616553) Martin J. … Pennacchio L.A. (Nature 2004) 4 65

Products for FAM173A Gene

Sources for FAM173A Gene

Content
Loading form....