Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FADS2 Gene

Aliases for FADS2 Gene

  • Fatty Acid Desaturase 2 2 3 5
  • Acyl-CoA 6-Desaturase 3 4
  • Delta-6-Desaturase 2 3
  • D6D 3 4
  • Linoleoyl-CoA Desaturase (Delta-6-Desaturase)-Like 2 3
  • Delta(6) Fatty Acid Desaturase 4
  • Delta-6 Fatty Acid Desaturase 3
  • Delta(6) Desaturase 4
  • Delta-6 Desaturase 4
  • EC 4
  • EC 1.14.19 61
  • SLL0262 3
  • FADSD6 3
  • LLCDL2 3
  • DES6 3
  • TU13 3

External Ids for FADS2 Gene

Previous HGNC Symbols for FADS2 Gene

  • LLCDL2

Previous GeneCards Identifiers for FADS2 Gene

  • GC11P064097
  • GC11P063159
  • GC11P061834
  • GC11P061359
  • GC11P061340
  • GC11P061352
  • GC11P061583
  • GC11P057923

Summaries for FADS2 Gene

Entrez Gene Summary for FADS2 Gene

  • The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]

GeneCards Summary for FADS2 Gene

FADS2 (Fatty Acid Desaturase 2) is a Protein Coding gene. Diseases associated with FADS2 include Best Vitelliform Macular Dystrophy. Among its related pathways are Fatty acid metabolism and Linoleic acid metabolism. GO annotations related to this gene include iron ion binding and oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water. An important paralog of this gene is FADS3.

UniProtKB/Swiss-Prot for FADS2 Gene

  • Component of a lipid metabolic pathway that catalyzes biosynthesis of highly unsaturated fatty acids (HUFA) from precursor essential polyunsaturated fatty acids (PUFA) linoleic acid (LA) (18:2n-6) and alpha-linolenic acid (ALA) (18:3n-3). Catalyzes the first and rate limiting step in this pathway which is the desaturation of LA (18:2n-6) and ALA (18:3n-3) into gamma-linoleic acid (GLA) (18:3n-6) and stearidonic acid (18:4n-3) respectively and other desaturation steps. Highly unsaturated fatty acids (HUFA) play pivotal roles in many biological functions. It catalizes as well the introduction of a cis double bond in palmitate to produce the mono-unsaturated fatty acid sapienate, the most abundant fatty acid in sebum.

Gene Wiki entry for FADS2 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FADS2 Gene

Genomics for FADS2 Gene

Regulatory Elements for FADS2 Gene

Enhancers for FADS2 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH11G061787 1.1 ENCODE dbSUPER 68.5 -4.6 -4584 0.9 CTCF KLF1 MXI1 ZSCAN4 ARID4B CHD7 RAD21 TEAD3 ZFHX2 POLR2A FADS2 MIR611 LOC100129473
GH11G061813 1.4 ENCODE dbSUPER 37.5 +23.2 23229 4.5 CREB3L1 AGO1 DMAP1 YY1 SLC30A9 ZNF143 SP3 NFYC TBX21 MEF2D FADS2 ROM1 BEST1 ENSG00000267811 EML3 MIR1908 PIR43939
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around FADS2 on UCSC Golden Path with GeneCards custom track

Promoters for FADS2 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

Genomic Location for FADS2 Gene

61,792,980 bp from pter
61,867,354 bp from pter
74,375 bases
Plus strand

Genomic View for FADS2 Gene

Genes around FADS2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FADS2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FADS2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FADS2 Gene

Proteins for FADS2 Gene

  • Protein details for FADS2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Fatty acid desaturase 2
    Protein Accession:
    Secondary Accessions:
    • A8K2M6
    • B7Z634
    • Q6MZQ7
    • Q96H07
    • Q96SV8
    • Q9H3G3
    • Q9Y3X4

    Protein attributes for FADS2 Gene

    444 amino acids
    Molecular mass:
    52259 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for FADS2 Gene


neXtProt entry for FADS2 Gene

Selected DME Specific Peptides for FADS2 Gene


Post-translational modifications for FADS2 Gene

  • Ubiquitination at Lys28, Lys42, isoforms=348, isoforms=2, 3, 484, Lys87, isoforms=2, 3, 4108, isoforms=2, 3, 4206, Lys398, Lys404, isoforms=2, 4417, and Lys435
  • Modification sites at PhosphoSitePlus

Domains & Families for FADS2 Gene

Gene Families for FADS2 Gene

Protein Domains for FADS2 Gene

Suggested Antigen Peptide Sequences for FADS2 Gene

Graphical View of Domain Structure for InterPro Entry



  • The histidine box domains may contain the active site and/or be involved in metal ion binding.
  • Belongs to the fatty acid desaturase type 1 family.
  • The histidine box domains may contain the active site and/or be involved in metal ion binding.
  • Belongs to the fatty acid desaturase type 1 family.
genes like me logo Genes that share domains with FADS2: view

Function for FADS2 Gene

Molecular function for FADS2 Gene

UniProtKB/Swiss-Prot CatalyticActivity:
Linoleoyl-CoA + 2 ferrocytochrome b5 + O(2) + 2 H(+) = gamma-linolenoyl-CoA + 2 ferricytochrome b5 + 2 H(2)O.
UniProtKB/Swiss-Prot CatalyticActivity:
Alpha-linolenoyl-CoA + 2 ferrocytochrome b5 + O(2) + 2 H(+) = stearidonoyl-CoA + 2 ferricytochrome b5 + 2 H(2)O.
UniProtKB/Swiss-Prot Function:
Component of a lipid metabolic pathway that catalyzes biosynthesis of highly unsaturated fatty acids (HUFA) from precursor essential polyunsaturated fatty acids (PUFA) linoleic acid (LA) (18:2n-6) and alpha-linolenic acid (ALA) (18:3n-3). Catalyzes the first and rate limiting step in this pathway which is the desaturation of LA (18:2n-6) and ALA (18:3n-3) into gamma-linoleic acid (GLA) (18:3n-6) and stearidonic acid (18:4n-3) respectively and other desaturation steps. Highly unsaturated fatty acids (HUFA) play pivotal roles in many biological functions. It catalizes as well the introduction of a cis double bond in palmitate to produce the mono-unsaturated fatty acid sapienate, the most abundant fatty acid in sebum.
UniProtKB/Swiss-Prot Induction:
Repressed by dietary highly unsaturated fatty acids.

Enzyme Numbers (IUBMB) for FADS2 Gene

Gene Ontology (GO) - Molecular Function for FADS2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004768 stearoyl-CoA 9-desaturase activity IEA --
GO:0016213 linoleoyl-CoA desaturase activity TAS --
GO:0016491 oxidoreductase activity IEA --
genes like me logo Genes that share ontologies with FADS2: view
genes like me logo Genes that share phenotypes with FADS2: view

Animal Models for FADS2 Gene

MGI Knock Outs for FADS2:

Animal Model Products

  • Taconic Biosciences Mouse Models for FADS2

CRISPR Products

Inhibitory RNA Products

Clone Products

No data available for Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for FADS2 Gene

Localization for FADS2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for FADS2 Gene

Endoplasmic reticulum membrane; Multi-pass membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for FADS2 gene
Compartment Confidence
plasma membrane 5
endoplasmic reticulum 5
peroxisome 3
extracellular 1
mitochondrion 1
nucleus 1
cytosol 1

Gene Ontology (GO) - Cellular Components for FADS2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005783 endoplasmic reticulum IEA --
GO:0005789 endoplasmic reticulum membrane TAS --
GO:0005887 integral component of plasma membrane TAS 9867867
GO:0016020 membrane IDA,IEA 19946888
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with FADS2: view

Pathways & Interactions for FADS2 Gene

genes like me logo Genes that share pathways with FADS2: view

UniProtKB/Swiss-Prot O95864-FADS2_HUMAN

  • Pathway: Lipid metabolism; polyunsaturated fatty acid biosynthesis.

Gene Ontology (GO) - Biological Process for FADS2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006629 lipid metabolic process IEA --
GO:0006631 fatty acid metabolic process IEA --
GO:0006633 fatty acid biosynthetic process IEA --
GO:0006636 unsaturated fatty acid biosynthetic process IEA,TAS --
GO:0036109 alpha-linolenic acid metabolic process TAS --
genes like me logo Genes that share ontologies with FADS2: view

No data available for SIGNOR curated interactions for FADS2 Gene

Drugs & Compounds for FADS2 Gene

(3) Drugs for FADS2 Gene - From: DrugBank, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
alpha-linolenic acid Approved Nutra Full agonist, Agonist, Target, ligand 0
heme Pharma Agonist 0

(4) Additional Compounds for FADS2 Gene - From: Novoseek and HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
Stearidonic acid
  • 6,9,12,15-Octadecatetraenoate
  • 6,9,12,15-Octadecatetraenoic acid
  • Stearidonic acid
  • Stearidonic acid C18:4
genes like me logo Genes that share compounds with FADS2: view

Transcripts for FADS2 Gene

Unigene Clusters for FADS2 Gene

Fatty acid desaturase 2:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for FADS2 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8
SP1: - -

Relevant External Links for FADS2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for FADS2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for FADS2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for FADS2 Gene

This gene is overexpressed in Adrenal Gland (x7.6).

Protein differential expression in normal tissues from HIPED for FADS2 Gene

This gene is overexpressed in Breast (37.0), Adrenal (9.0), Fetal testis (7.2), and Fetal ovary (6.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for FADS2 Gene

Protein tissue co-expression partners for FADS2 Gene

NURSA nuclear receptor signaling pathways regulating expression of FADS2 Gene:


SOURCE GeneReport for Unigene cluster for FADS2 Gene:


mRNA Expression by UniProt/SwissProt for FADS2 Gene:

Tissue specificity: Expressed in a wide array of tissues, highest expression is found in liver followed by brain, lung, heart, and retina. A lower level is found in breast tumor when compared with normal tissues; lowest levels were found in patients with poor prognostic index.

Evidence on tissue expression from TISSUES for FADS2 Gene

  • Nervous system(4.9)
  • Skin(4.6)
  • Liver(3.6)
  • Eye(2.4)
  • Kidney(2.4)
  • Lung(2.3)
  • Muscle(2.3)
  • Adrenal gland(2.2)
  • Blood(2)
  • Intestine(2)
genes like me logo Genes that share expression patterns with FADS2: view

Primer Products

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for FADS2 Gene

Orthologs for FADS2 Gene

This gene was present in the common ancestor of animals.

Orthologs for FADS2 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia FADS2 34 35
  • 99.77 (n)
(Canis familiaris)
Mammalia FADS2 34 35
  • 90.35 (n)
(Bos Taurus)
Mammalia FADS2 34 35
  • 89.64 (n)
(Ornithorhynchus anatinus)
Mammalia -- 35
  • 89 (a)
-- 35
  • 78 (a)
(Rattus norvegicus)
Mammalia Fads2 34
  • 87.31 (n)
(Mus musculus)
Mammalia Fads2 34 16 35
  • 87.24 (n)
(Monodelphis domestica)
Mammalia FADS2 35
  • 75 (a)
(Gallus gallus)
Aves FADS2 34 35
  • 74.92 (n)
(Anolis carolinensis)
Reptilia -- 35
  • 73 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia fads2 34
  • 70.86 (n)
African clawed frog
(Xenopus laevis)
Amphibia MGC68735 34
(Danio rerio)
Actinopterygii fads2 34 35
  • 67.19 (n)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.11040 34
(Caenorhabditis elegans)
Secernentea fat-3 36 34 35
  • 43.83 (n)
fat-4 35
  • 22 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 26 (a)
Species where no ortholog for FADS2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for FADS2 Gene

Gene Tree for FADS2 (if available)
Gene Tree for FADS2 (if available)

Paralogs for FADS2 Gene

Paralogs for FADS2 Gene

(3) SIMAP similar genes for FADS2 Gene using alignment to 9 proteins: Pseudogenes for FADS2 Gene

genes like me logo Genes that share paralogs with FADS2: view

Variants for FADS2 Gene

Sequence variations from dbSNP and Humsavar for FADS2 Gene

SNP ID Clin Chr 11 pos Sequence Context AA Info Type
rs66698963 untested 61,835,065(+) CAGGG(-/ACTTCTCCCTGCCTCCCCAGGG)CCCTG intron-variant
rs1000027467 -- 61,828,987(+) CTGCG(C/T)GCCGC intron-variant
rs1000068847 -- 61,847,594(+) CCACT(A/G)TGTGG intron-variant
rs1000085757 -- 61,850,818(+) TCCCT(C/T)ACTAA intron-variant
rs1000190245 -- 61,818,959(+) TCCAC(C/T)TCCCA intron-variant, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for FADS2 Gene

Variant ID Type Subtype PubMed ID
esv2670536 CNV deletion 23128226
nsv1122627 CNV deletion 24896259
nsv468585 CNV loss 19166990
nsv528697 CNV loss 19592680
nsv555171 CNV loss 21841781

Variation tolerance for FADS2 Gene

Residual Variation Intolerance Score: 11.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.22; 4.95% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for FADS2 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for FADS2 Gene

Disorders for FADS2 Gene

MalaCards: The human disease database

(1) MalaCards diseases for FADS2 Gene - From: GeneCards

Disorder Aliases PubMed IDs
best vitelliform macular dystrophy
  • vitelliform macular dystrophy
- elite association - COSMIC cancer census association via MalaCards
Search FADS2 in MalaCards View complete list of genes associated with diseases

Relevant External Links for FADS2

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with FADS2: view

No data available for UniProtKB/Swiss-Prot and Genatlas for FADS2 Gene

Publications for FADS2 Gene

  1. Identification of the delta-6 desaturase of human sebaceous glands: expression and enzyme activity. (PMID: 12713571) Ge L. … Prouty S.M. (J. Invest. Dermatol. 2003) 3 4 22 25 64
  2. Genetic variants of the FADS1 FADS2 gene cluster as related to essential fatty acid metabolism. (PMID: 19809313) Lattka E. … Heinrich J. (Curr. Opin. Lipidol. 2010) 3 22 46 64
  3. Role of FADS1 and FADS2 polymorphisms in polyunsaturated fatty acid metabolism. (PMID: 20045144) Glaser C. … Koletzko B. (Metab. Clin. Exp. 2010) 3 22 46 64
  4. Genome-wide association study of plasma polyunsaturated fatty acids in the InCHIANTI Study. (PMID: 19148276) Tanaka T. … Ferrucci L. (PLoS Genet. 2009) 3 22 46 64
  5. Genetic variants of the FADS1 FADS2 gene cluster are associated with altered (n-6) and (n-3) essential fatty acids in plasma and erythrocyte phospholipids in women during pregnancy and in breast milk during lactation. (PMID: 18936223) Xie L. … Innis S.M. (J. Nutr. 2008) 3 22 46 64

Products for FADS2 Gene

Sources for FADS2 Gene

Loading form....