Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

FADS2 Gene

protein-coding   GIFtS: 64
GCID: GC11P061583

fatty acid desaturase 2


(Previous symbol: LLCDL2)
 Explore 17 diseases affiliated with
FADS2 via
MalaCards
our new
 Human Malady Compendium 
Biological research products
for FADS2    

Aliases
for FADS2 gene

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section
Aliases
Fatty Acid Desaturase 21 2     Delta(6) Fatty Acid Desaturase2 3
D6D1 2 3     Delta-6 Desaturase2 3
DES61 2     Delta-6 Fatty Acid Desaturase2
FADSD61 2     Delta-6-Desaturase1
LLCDL21 2     Linoleoyl-CoA Desaturase (Delta-6-Desaturase)-Like 22
SLL02621 2     EC 1.14.19.-3
TU131 2     EC 1.14.198
Delta(6) Desaturase2 3     

External Ids:    HGNC: 35751   Entrez Gene: 94152   Ensembl: ENSG000001348247   OMIM: 6061495   UniProtKB: O958643   

Export aliases for FADS2 gene to outside databases

Previous GC identifers: GC11P064097 GC11P063159 GC11P061834 GC11P061359 GC11P061340 GC11P061352 GC11P057923


Summaries
for FADS2 gene

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section
Entrez Gene summary for FADS2:
The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes
regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty
acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and
a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine
motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have
arisen evolutionarily from gene duplication based on its similar exon/intron organization. (provided by RefSeq, Jul
2008)

UniProtKB/Swiss-Prot: FADS2_HUMAN, O95864
Function: Component of a lipid metabolic pathway that catalyzes biosynthesis of highly unsaturated fatty acids (HUFA)
from precursor essential polyunsaturated fatty acids (PUFA) linoleic acid (LA) (18:2n-6) and alpha-linolenic acid
(ALA) (18:3n-3). Catalyzes the first and rate limiting step in this pathway which is the desaturation of LA (18:2n-6)
and ALA (18:3n-3) into gamma-linoleic acid (GLA) (18:3n-6) and stearidonic acid (18:4n-3) respectively and other
desaturation steps. Highly unsaturated fatty acids (HUFA) play pivotal roles in many biological functions. It
catalizes as well the introduction of a cis double bond in palmitate to produce the mono-unsaturated fatty acid
sapienate, the most abundant fatty acid in sebum

Gene Wiki entry for FADS2


Genomic Views
for FADS2 gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000011.9  NC_018922.1  NT_167190.1  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the FADS2 gene promoter:
         CBF-C   E47   HEN1   Ik-2   CBF-A   CBF-B   CP1C   CP1A   ATF   CBF(2)   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 3): FADS2 promoter sequence
   Search SABiosciences Chromatin IP Primers for FADS2

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat FADS2


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 11q12.2   Ensembl cytogenetic band:  11q12.2   HGNC cytogenetic band: 11q12.2

FADS2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
FADS2 gene location

GeneLoc information about chromosome 11         GeneLoc Exon Structure

GeneLoc location for GC11P061583:  view genomic region     (about GC identifiers)

Start:
 61,560,452 bp from pter      End:
 61,634,826 bp from pter
Size:
 74,375 bases      Orientation:
 plus strand

Proteins
for FADS2 gene

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section
UniProtKB/Swiss-Prot: FADS2_HUMAN, O95864 (See protein sequence)
Recommended Name: Fatty acid desaturase 2  
Size: 444 amino acids; 52259 Da
Subcellular location: Endoplasmic reticulum membrane; Multi-pass membrane protein (Potential)
Developmental stage: Found in fetal heart
Secondary accessions: A8K2M6 Q6MZQ7 Q96H07 Q96SV8 Q9H3G3 Q9Y3X4
Alternative splicing: 3 isoforms:  O95864-1   O95864-2   O95864-3   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for FADS2: NX_O95864

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_O95864

    • 4/18 DME Specific Peptides for FADS2 (O95864) (see all 18)
     EDFRALR  KDPDVNM  LWLDAYL  EDATDAF 

    FADS2 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins: NP_004256.1  
    ENSEMBL proteins: 
     ENSP00000458917   ENSP00000257261   ENSP00000428522   ENSP00000429500   ENSP00000429693  
     ENSP00000430054   ENSP00000278840   ENSP00000430225   ENSP00000431091   ENSP00000443867  
     ENSP00000437965  
    Reactome Protein details: O95864
    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate: FADS2
    OriGene Custom Protein Services for FADS2 
    GenScript Custom Purified and Recombinant Proteins Services for FADS2
    Novus Biologicals FADS2 Proteins
    Novus Biologicals FADS2 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for FADS2

    Gene Ontology (GO): 4 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005624membrane fraction ----
    GO:0005789endoplasmic reticulum membrane TAS--
    GO:0005887integral to plasma membrane TAS9867867
    GO:0016020membrane TAS9867867


    FADS2 for ontologies           About GeneDecksing



    FADS2 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for FADS2 
    GenScript Custom Superior Antibodies Services for FADS2
    Novus Biologicals FADS2 Antibody
    Search for Antibodies for FADS2 at Abcam  
    Uscn Antibodies for FADS2
    ThermoFisher Antibody for FADS2

    Assay Products for FADS2: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for FADS2
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for FADS2

    Protein Domains /
    Families
    for FADS2 gene

    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    FADS2 for domains           About GeneDecksing

    3 InterPro domains/families:
     IPR001199 Cyt_B5-like_heme/steroid-bd
     IPR005804 Fatty_acid_desaturase-1
     IPR012171 Fatty_acid/sphinglp_desaturase

    Graphical View of Domain Structure for InterPro Entry O95864

    ProtoNet protein and cluster: O95864

    1 Blocks protein family: IPB001199 Cytochrome b5

    UniProtKB/Swiss-Prot: FADS2_HUMAN, O95864
    Domain: The histidine box domains may contain the active site and/or be involved in metal ion binding
    Similarity: Belongs to the fatty acid desaturase family
    Similarity: Contains 1 cytochrome b5 heme-binding domain


    Function
    for FADS2 gene

    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section
    Function Summary:

         UniProtKB/Swiss-Prot: FADS2_HUMAN, O95864
    Function: Component of a lipid metabolic pathway that catalyzes biosynthesis of highly unsaturated fatty acids (HUFA)
    from precursor essential polyunsaturated fatty acids (PUFA) linoleic acid (LA) (18:2n-6) and alpha-linolenic acid
    (ALA) (18:3n-3). Catalyzes the first and rate limiting step in this pathway which is the desaturation of LA (18:2n-6)
    and ALA (18:3n-3) into gamma-linoleic acid (GLA) (18:3n-6) and stearidonic acid (18:4n-3) respectively and other
    desaturation steps. Highly unsaturated fatty acids (HUFA) play pivotal roles in many biological functions. It
    catalizes as well the introduction of a cis double bond in palmitate to produce the mono-unsaturated fatty acid
    sapienate, the most abundant fatty acid in sebum
    Induction: Repressed by dietary highly unsaturated fatty acids

    Enzyme Numbers (IUBMB): EC 1.14.19.-1 EC 1.14.192

    miRNA
    Products:            		miRTarBase miRNAs that target FADS2:
    hsa-let-7b (MIRT001634)

    OriGene 3'-UTR Clone: FADS2
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat FADS2
    8 QIAGEN miScript miRNA Assays for microRNAs that regulate FADS2:
    hsa-miR-877* hsa-miR-3163 hsa-miR-4271 hsa-miR-491-5p hsa-miR-2110 hsa-miR-589* hsa-miR-219-5p hsa-miR-4282
    SwitchGear 3'UTR luciferase reporter plasmid: FADS2 3' UTR sequence
    Inhib. RNA
    Products:            		Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for FADS2 (see all 7)
    OriGene shRNA RFP: FADS2
    OriGene siRNA: FADS2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FADS2

    Gene Editing
    Products:    		DNA2.0 Custom Protein Engineering Service for FADS2

    Clone
    Products:             		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for FADS2 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for FADS2
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: FADS2 (NM_004265)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for FADS2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FADS2 

    Cell Line
    Products:             		GenScript Custom overexpressing Cell Line Services for FADS2
    Search LifeMap BioReagents cell lines for FADS2

    In Situ Assay
    Products:       
         		Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FADS2

    Gene Ontology (GO): 4 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004768stearoyl-CoA 9-desaturase activity IEA--
    GO:0005506iron ion binding IEA--
    GO:0016717oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water ----
    GO:0020037heme binding IEA--


    FADS2 for ontologies           About GeneDecksing


    1 GenomeRNAi human phenotype for FADS2:
     Synthetic lethal with Ras 

    Animal Models:
         Mouse knock-outs for FADS2: Fads2tm1Mtna Fads2tm1Wst
         12 MGI mutant phenotypes (inferred from 2 alleles) (MGI details for Fads2):
     behavior/neurological  digestive/alimentary  endocrine/exocrine gland  growth/size  hematopoietic system 
     homeostasis/metabolism  immune system  integument  liver/biliary system  mortality/aging 
     renal/urinary system  reproductive system 

    FADS2 for phenotypes           About GeneDecksing


    Pathways & Interactions
    for FADS2 gene

    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways - 5/6 super-pathways (see all 6) About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1alpha-linolenic (omega3) and linoleic (omega6) acid metabolism
    		alpha-linolenic (omega3) and linoleic (omega6) acid metabolism1.00
    		Linoleic acid (LA) metabolism0.55
    		alpha-linolenic acid (ALA) metabolism1.00
    2eicosapentaenoate biosynthesis II (metazoa)
    		eicosapentaenoate biosynthesis II (metazoa)1.00
    		gamma-linolenate biosynthesis II (animals)0.69
    3Biosynthesis of unsaturated fatty acids
    		Biosynthesis of unsaturated fatty acids1.00
    		oleate biosynthesis II (animals)0.32
    4Metabolism
    		Metabolism1.00
    		Metabolism of lipids and lipoproteins0.34
    5PPAR signaling pathway
    		PPAR signaling pathway1.00

    Pathway sources
    See GeneCards unified pathways
    Show all pathways


    3 BioSystems Pathways for FADS2 
        gamma-linolenate biosynthesis II (animals)
    oleate biosynthesis II (animals)
    eicosapentaenoate biosynthesis II (metazoa)

    5        Reactome Pathways for FADS2
        Linoleic acid (LA) metabolism
    Metabolism
    alpha-linolenic (omega3) and linoleic (omega6) acid metabolism
    alpha-linolenic acid (ALA) metabolism
    Metabolism of lipids and lipoproteins


    3         Kegg Pathways  (Kegg details for FADS2):
        alpha-Linolenic acid metabolism
    Biosynthesis of unsaturated fatty acids
    PPAR signaling pathway

    UniProtKB/Swiss-Prot: FADS2_HUMAN, O95864
    Pathway: Lipid metabolism; polyunsaturated fatty acid biosynthesis


    FADS2 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for FADS2

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/27 Interacting proteins for FADS2 (O958642, 3 ENSP000002788404) via UniProtKB, MINT, STRING, and/or I2D (see all 27)

    InteractantInteraction Details
    GeneCardExternal ID(s)
    UBCP0CG483, ENSP000003448184I2D: score=1 STRING: ENSP00000344818
    ACSL1ENSP000002814554STRING: ENSP00000281455
    ACSL3ENSP000003500124STRING: ENSP00000350012
    ACSL4ENSP000003397874STRING: ENSP00000339787
    ELOVL2ENSP000003466934STRING: ENSP00000346693
    About this table

    Gene Ontology (GO): 5/8 biological process terms (GO ID links to tree view) (see all 8):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006629lipid metabolic process ----
    GO:0006633fatty acid biosynthetic process ----
    GO:0006636unsaturated fatty acid biosynthetic process IEA--
    GO:0022900electron transport chain IEA--
    GO:0033559unsaturated fatty acid metabolic process TAS--


    FADS2 for ontologies           About GeneDecksing



    Drugs & Compounds
    for FADS2 gene

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    FADS2 for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for FADS2

    3 HMDB Compounds for FADS2    About this table
    CompoundSynonyms CAS #PubMed Ids
    Alpha-Linolenic acid(9,12,15)-linolenate (see all 23)463-40-1--
    Heme(protoporphyrinato)iron (see all 19)14875-96-8--
    Stearidonic acidStearidonic acid (see all 4)20290-75-9--

    1 DrugBank Compound for FADS2    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    Alpha-Linolenic Acid(9Z,12Z,15Z)-Octadecatrienoic acid (see all 5)463-40-1targetligand17284757 16988497 12713571 21210105 17409318 15481543

    5 Novoseek chemical compound relationships for FADS2 gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    parinaric acid 81.5 3 15481543 (1), 15966318 (1)
    fatty acid 72.6 23 12951357 (3), 19195843 (2), 20045144 (2), 11290821 (1) (see all 12)
    alpha-linolenic acid 71.8 10 15971598 (1), 12713571 (1), 15481543 (1), 18842780 (1) (see all 5)
    gamma-linolenic acid 69.8 4 15966318 (3), 15971598 (1)
    linoleic acid 69.5 12 18842780 (2), 15971598 (1), 12713571 (1), 18936223 (1) (see all 6)

    Search CenterWatch for drugs/clinical trials and news about FADS2 

    Transcripts
    for FADS2 gene

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section
    REFSEQ mRNAs for FADS2 gene: 
    NM_004265.2  

    Unigene Cluster for FADS2:

    Fatty acid desaturase 2
    Hs.502745  [show with all ESTs]
    Unigene Representative Sequence: NM_004265
    15 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000574708 ENST00000257261(uc001nsj.2 uc010rlo.1) ENST00000522639
    ENST00000522056 ENST00000517839 ENST00000518606 ENST00000278840(uc001nsl.1)
    ENST00000517312 ENST00000521849(uc001nsk.3) ENST00000521571 ENST00000520145
    ENST00000355484 ENST00000543584 ENST00000523235 ENST00000522359

    miRNA
    Products:             		 OriGene 3'-UTR Clone: FADS2
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat FADS2
    8 QIAGEN miScript miRNA Assays for microRNAs that regulate FADS2:
    hsa-miR-877* hsa-miR-3163 hsa-miR-4271 hsa-miR-491-5p hsa-miR-2110 hsa-miR-589* hsa-miR-219-5p hsa-miR-4282
    SwitchGear 3'UTR luciferase reporter plasmid: FADS2 3' UTR sequence
    Inhib. RNA
    Products:             		Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for FADS2 (see all 7)
    OriGene shRNA RFP: FADS2
    OriGene siRNA: FADS2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FADS2
    Clone
    Products:             		 OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for FADS2 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for FADS2
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: FADS2 (NM_004265)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for FADS2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FADS2 
    Primer
    Products:            		 OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for FADS2
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat FADS2
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FADS2
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FADS2

    Additional cDNA sequence: 

    AF084559.1 AF108658.1 AF126799.1 AK027459.1 AK027513.1 AK027577.1 AK074925.1 AK074939.1 
    AK074991.1 AK123240.1 AK290291.1 AK299762.1 AL050118.1 BC009011.1 

    24/31 DOTS entries (see all 31):

    DT.100821496  DT.455705  DT.95113197  DT.100821494  DT.100836017  DT.120740171  DT.95094120  DT.120740049 
    DT.100821504  DT.120740019  DT.120739988  DT.92456403  DT.95094121  DT.120740037  DT.100821499  DT.100830160 
    DT.120740027  DT.92456410  DT.101968013  DT.101978227  DT.120739976  DT.120740069  DT.120740087  DT.87016735 

    24/474 AceView cDNA sequences (see all 474):

    AU102245 AK074991 AW296357 BG741670 BM127438 BQ962944 AI694877 BG696258 
    BQ229517 T30521 AF084559 BQ881930 BQ883702 BI962812 BQ891931 AI815395 
    BM726179 BI824768 AA662525 BQ722166 CF134755 AI859217 BU174067 BQ893841 

    GeneLoc Exon Structure

    2 Alternative Splicing Database (ASD) splice patterns (SP) for FADS2    About this scheme

    ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8
    SP1:                                      -     -         
    SP2:                                                      


    ECgene alternative splicing isoforms for FADS2

    Expression
    for FADS2 gene

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    FADS2 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: TTACTTCCCC

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)
    About this image

    FADS2 expression in embryonic tissues and stem cells
    Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine    About this table
    1 LifeMap In Vivo Development Anatomical Compartment/Cell 
    Tissue Anatomical Compartment CellCategory (developmental path)
    BoneZeugopod Growth PlateBone
    Expression: Positive    Negative     Selective marker
    Experimental details: Curated     Microarrays     In-situ hybridization

    See FADS2 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for FADS2

    SOURCE GeneReport for Unigene cluster: Hs.502745

    UniProtKB/Swiss-Prot: FADS2_HUMAN, O95864
    Tissue specificity: Expressed in a wide array of tissues, highest expression is found in liver followed by brain, lung,
    heart, and retina. A lower level is found in breast tumor when compared with normal tissues; lowest levels were found
    in patients with poor prognostic index

        SABiosciences Expression via Pathway-Focused PCR Array including FADS2: 
              PPAR Targets in human mouse rat

    Primer
    Products:    		 OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for FADS2
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat FADS2
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FADS2
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FADS2
    In Situ
    Assay Products:     
         		Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FADS2

    Orthologs
    for FADS2 gene

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section
    This gene was present in the common ancestor of eukaryotes.

    Orthologs for FADS2 gene from 6/22 species (see all 22)    About this table
    Organism Taxonomic
    classification    		 Gene Description Human
    Similarity    		 Orthology
    Type    		 Details
    chicken
    (Gallus gallus)    		 Aves FADS21 fatty acid desaturase 2 74.92(n)
    77.03(a)    		   423122  NM_001160428.2  NP_001153900.1 
    African clawed frog
    (Xenopus laevis)    		 Amphibia MGC687352 hypothetical protein MGC68735 79.02(n)    BC063726.1 
    zebrafish
    (Danio rerio)    		 Actinopterygii fads22 fatty acid desaturase 2 76.21(n)   140615  BC049438.1 
    worm
    (Caenorhabditis elegans)    		 Secernentea fat-33   -- 28(a)   IV(9803240-9806176)   --
    thale cress
    (Arabidopsis thaliana)    		 eudicotyledons AT2G462106
    AT3G615806
    		 Fatty acid/sphingolipid desaturase
    		 25(a)
    24(a)
    		 many ↔ many
    many ↔ many
    		 2(18977344-18979001)
    3(22786047-22787972)
    rice
    (Oryza sativa)    		 Liliopsida --
    		 desaturase/cytochrome b5 protein, putative, expres...
    		 24(a)
    		 1 → many
    		 9(10337557-10339696)


    ENSEMBL Gene Tree for FADS2 (if available)
    TreeFam Gene Tree for FADS2 (if available) 

    Paralogs
    for FADS2 gene

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for FADS2 gene
    FADS12  FADS32  
    3 SIMAP similar genes for FADS2 using alignment to 9 protein entries:     FADS2_HUMAN (see all proteins):
    FADS1    FADS2P1    FADS3

    FADS2 for paralogs           About GeneDecksing


    1 Pseudogenes.org Pseudogene for FADS2
    PGOHUM00000258592


    Genomic Variants
    for FADS2 gene

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/763 NCBI SNPs in FADS2 are shown (see all 763)     About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance    		Chr 11 posSequence#AA
    Chg    		TypeMore#Allele
    freq    		PopTotal
    sample    		More
    ----------
    rs666989631,2
    		C--57930772(+) CAGGG-/ACTTCTCCCT
    GCCTCCCCAGGG    CCCTG     		1 -- int11Minor allele frequency- ACTTCTCCCTGCCTCCCCAGGG:0.00NA 2
    rs1745681,2
    		C,F,A,H,--61593816(+) GTCCAC/TGCTTC 1 -- us2k123Minor allele frequency- A:0.01EA NA NS 2552
    rs1745691,2
    		C,F,A,H,--61594164(+) CAGTCT/CGTGGA 1 -- us2k17Minor allele frequency- C:0.04MN NA EA 499
    rs729201821,2
    		--61594266(+) CCCCCA/CCAAGT 1 -- us2k10--------
    rs1459292481,2
    		--61594306(+) CCCCAC/TCACCC 1 -- us2k10--------
    rs1399756531,2
    		--61594510(+) TCCTCC/TAGTGA 1 -- us2k10--------
    rs785108851,2
    		C,F,--61594788(+) ACTGAG/CCTTAC 1 -- us2k11Minor allele frequency- C:0.09WA 118
    rs38344581,2
    		C,F,--61594921(+) TTTTCT/-AAGAT 1 -- us2k12Minor allele frequency- -:0.41MN EA 376
    rs1399135001,2
    		--61595370(+) CGGGG-/CACCCG 1 -- us2k10--------
    rs9685671,2
    		C,F,H,--61595564(-) CCCGGG/AAGCTC 1 -- us2k114Minor allele frequency- A:0.09MN NS EA NA 1850

    HapMap Linkage Disequilibrium report for FADS2 (61560452 - 61634826 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
          Database of Genomic Variants (DGV) variations for FADS2: --
    Human Gene Mutation Database (HGMD): FADS2

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing FADS2
    DNA2.0 Custom Variant and Variant Library Synthesis for FADS2

    Disorders / Diseases
    for FADS2 gene

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    FADS2 for disorders           About GeneDecksing

    OMIM gene information: 606149    OMIM disorders: --

    17 diseases for FADS2:    About MalaCards
    attention deficit hyperactivity disorder    vitelliform macular dystrophy    macular dystrophy    coronary heart disease
    myocardial infarction    cystic fibrosis    bipolar disorder    eczema
    adhd    hepatitis b    fibrosis    hepatocellular carcinoma
    breast cancer    obesity    hepatitis    cholesterol
    carcinoma

    Human Genome Epidemiology (HuGE) Navigator: FADS2 (40 documents)

    Export disorders for FADS2 gene to outside databases

    Publications
    for FADS2 gene

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for FADS2 gene, integrated from 9 sources (see all 99):
    (articles sorted by number of sources associating them with FADS2)    		    Utopia: connect your pdf to the dynamic
    world of online information

    1. Identification of the delta-6 desaturase of human sebaceous glands: expression and enzyme activity. (PubMed id 12713571)1, 2, 7, 9 Ge L.... Prouty S.M. (2003)
    2. cDNA cloning, genomic structure, and chromosomal localization of three members of the human fatty acid desaturase family. (PubMed id 10860662)1, 2, 9 Marquardt A.... Weber B.H. (2000)
    3. alpha-Linolenic acid, Delta6-desaturase gene polymorphism, and the risk of nonfatal myocardial infarction. (PubMed id 17284757)1, 7 Baylin A....Campos H. (2007)
    4. Signal sequence and keyword trap in silico for selection of full- length human cDNAs encoding secretion or membrane proteins from oligo- capped cDNA libraries. (PubMed id 16303743)1, 2 Otsuki T....Isogai T. (2005)
    5. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    6. Regulation of human delta-6 desaturase gene transcription: identification of a functional direct repeat-1 element. (PubMed id 12562861)1, 2 Tang C.... Clarke S.D. (2003)
    7. Expression of human delta-6-desaturase is associated with aggressiveness of human breast cancer. (PubMed id 12851727)1, 2 Lane J.... Jiang W.G. (2003)
    8. The E-box like sterol regulatory element mediates the suppression of human Delta-6 desaturase gene by highly unsaturated fatty acids. (PubMed id 12147235)1, 2 Nara T.Y.... Nakamura M.T. (2002)
    9. Cloning, expression, and nutritional regulation of the mammalian Delta-6 desaturase. (PubMed id 9867867)1, 2 Cho H.P.... Clarke S.D. (1999)
    10. A nucleotide insertion in the transcriptional regulatory region of FADS2 gives rise to human fatty acid delta-6-desaturase deficiency. (PubMed id 12951357)1, 9 Nwankwo J.O.... Domann F.E. (2003)

    External Searches for FADS2 gene

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  
      Query String
    		PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    Genome Databases showing FADS2 gene

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 9415 HGNC: 3575 AceView: FADS2 Ensembl:ENSG00000134824 euGenes: HUgn9415
    ECgene: FADS2 Kegg: 9415 H-InvDB: FADS2

    Other Databases showing FADS2 gene

    (According to HUGE)
    About This Section
    		   --

    Specialized Databases showing FADS2 gene

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for FADS2 Pharmacogenomics, SNPs, Pathways

    Intellectual Property
    for FADS2 gene

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    		Patent Information for FADS2 gene:
    Search GeneIP for patents involving FADS2

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    Products
    for FADS2 gene

    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     Browse OriGene Antibodies   OriGene shRNA RFP for FADS2  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for FADS2   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for FADS2  
     OriGene Protein Over-expression Lysate for FADS2   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for FADS2   OriGene 3'-UTR Clone for FADS2  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for FADS2   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for FADS2  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for FADS2   OriGene Custom Protein Services for FADS2  
     OriGene Custom Immunoassay Development  

         		 
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat FADS2
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing FADS2
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat FADS2
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FADS2
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FADS2
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FADS2
     GenScript Custom Purified and Recombinant Proteins Services for FADS2 GenScript cDNA clones with any tag delivered in your preferred vector for FADS2
     GenScript Custom Assay Services for FADS2 GenScript Custom Superior Antibodies Services for FADS2
     GenScript Custom overexpressing Cell Line Services for FADS2 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in FADS2 promoter
     Search Chromatin IP Primers for FADS2
     RT2 qPCR Primer Assay in human, mouse, rat FADS2
     GNC Network for FADS2
     SABiosciences PCR Arrays including human, mouse, rat FADS2
     Search Tocris compounds for FADS2
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     FADS2 antibodies
     FADS2 proteins
     FADS2 lysates
     Search for Antibodies for FADS2 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for FADS2
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     FADS2 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for FADS2
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FADS2
     SwitchGear 3'UTR luciferase reporter plasmids for FADS2
     SwitchGear Promoter luciferase reporter plasmids for FADS2
     ThermoFisher Antibody for FADS2
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FADS2
           
    GeneCards Homepage - Last full update: 18 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 27 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 

    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Copyright © 1996-2013 , Weizmann Institute of Science. All Rights Reserved.
    Hot genes      Disease genes      FADS2 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 100 solr: 1.4