Free for academic non-profit institutions. Other users need a Commercial license

Aliases for EXOC3L2 Gene

Aliases for EXOC3L2 Gene

  • Exocyst Complex Component 3 Like 2 2 3
  • HBV X-Transactivated Gene 7 Protein 3 4
  • HBV XAg-Transactivated Protein 7 3 4
  • XTP7 3 4
  • Protein 7 Transactivated By Hepatitis B Virus X Antigen (HBxAg) 3
  • Exocyst Complex Component 3-Like Protein 2 3
  • Exocyst Complex Component 3-Like 2 5

External Ids for EXOC3L2 Gene

Previous GeneCards Identifiers for EXOC3L2 Gene

  • GC19M050408
  • GC19M045715
  • GC19M042147

Summaries for EXOC3L2 Gene

GeneCards Summary for EXOC3L2 Gene

EXOC3L2 (Exocyst Complex Component 3 Like 2) is a Protein Coding gene. GO annotations related to this gene include SNARE binding. An important paralog of this gene is ENSG00000283632.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for EXOC3L2 Gene

Genomics for EXOC3L2 Gene

Regulatory Elements for EXOC3L2 Gene

Enhancers for EXOC3L2 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
- Elite enhancer/Elite enhancer-gene association

Enhancers around EXOC3L2 on UCSC Golden Path with GeneCards custom track

Genomic Location for EXOC3L2 Gene

45,212,621 bp from pter
45,234,211 bp from pter
21,591 bases
Minus strand

Genomic View for EXOC3L2 Gene

Genes around EXOC3L2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
EXOC3L2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for EXOC3L2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for EXOC3L2 Gene

Proteins for EXOC3L2 Gene

  • Protein details for EXOC3L2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Exocyst complex component 3-like protein 2
    Protein Accession:
    Secondary Accessions:
    • Q8N9W2
    • Q96GV2

    Protein attributes for EXOC3L2 Gene

    409 amino acids
    Molecular mass:
    45859 Da
    Quaternary structure:
    No Data Available

neXtProt entry for EXOC3L2 Gene

Post-translational modifications for EXOC3L2 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for EXOC3L2 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for EXOC3L2 Gene

Domains & Families for EXOC3L2 Gene

Protein Domains for EXOC3L2 Gene


Suggested Antigen Peptide Sequences for EXOC3L2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the SEC6 family.
  • Belongs to the SEC6 family.
genes like me logo Genes that share domains with EXOC3L2: view

No data available for Gene Families for EXOC3L2 Gene

Function for EXOC3L2 Gene

Gene Ontology (GO) - Molecular Function for EXOC3L2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000149 SNARE binding IBA --
GO:0003674 molecular_function ND --
genes like me logo Genes that share ontologies with EXOC3L2: view
genes like me logo Genes that share phenotypes with EXOC3L2: view

Animal Models for EXOC3L2 Gene

MGI Knock Outs for EXOC3L2:

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , miRNA , Transcription Factor Targets and HOMER Transcription for EXOC3L2 Gene

Localization for EXOC3L2 Gene

Subcellular locations from

Jensen Localization Image for EXOC3L2 Gene COMPARTMENTS Subcellular localization image for EXOC3L2 gene
Compartment Confidence
cytosol 2
nucleus 2

Gene Ontology (GO) - Cellular Components for EXOC3L2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000145 exocyst IBA --
GO:0005575 cellular_component ND --
genes like me logo Genes that share ontologies with EXOC3L2: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for EXOC3L2 Gene

Pathways & Interactions for EXOC3L2 Gene

SuperPathways for EXOC3L2 Gene

No Data Available

Interacting Proteins for EXOC3L2 Gene

Gene Ontology (GO) - Biological Process for EXOC3L2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006887 exocytosis IBA --
GO:0008150 biological_process ND --
GO:0051601 exocyst localization IBA --
genes like me logo Genes that share ontologies with EXOC3L2: view

No data available for Pathways by source and SIGNOR curated interactions for EXOC3L2 Gene

Drugs & Compounds for EXOC3L2 Gene

No Compound Related Data Available

Transcripts for EXOC3L2 Gene

mRNA/cDNA for EXOC3L2 Gene

(1) REFSEQ mRNAs :
(5) Additional mRNA sequences :
(13) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for EXOC3L2 Gene

Exocyst complex component 3-like 2:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for EXOC3L2 Gene

No ASD Table

Relevant External Links for EXOC3L2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for EXOC3L2 Gene

mRNA expression in normal human tissues for EXOC3L2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for EXOC3L2 Gene

This gene is overexpressed in Kidney - Cortex (x7.0) and Thyroid (x5.9).

Protein differential expression in normal tissues from HIPED for EXOC3L2 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (38.7), Adrenal (11.6), and Plasma (8.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for EXOC3L2 Gene

Protein tissue co-expression partners for EXOC3L2 Gene

NURSA nuclear receptor signaling pathways regulating expression of EXOC3L2 Gene:


SOURCE GeneReport for Unigene cluster for EXOC3L2 Gene:

genes like me logo Genes that share expression patterns with EXOC3L2: view

Primer Products

No data available for mRNA Expression by UniProt/SwissProt for EXOC3L2 Gene

Orthologs for EXOC3L2 Gene

This gene was present in the common ancestor of animals.

Orthologs for EXOC3L2 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia EXOC3L2 34
  • 88.98 (n)
  • 90.44 (a)
EXOC3L2 35
  • 89 (a)
(Canis familiaris)
Mammalia EXOC3L2 34
  • 90.08 (n)
  • 92.11 (a)
EXOC3L2 35
  • 78 (a)
(Mus musculus)
Mammalia Exoc3l2 34
  • 83.54 (n)
  • 89 (a)
Exoc3l2 16
(Pan troglodytes)
Mammalia EXOC3L2 34
  • 99.76 (n)
  • 99.76 (a)
EXOC3L2 35
  • 100 (a)
(Rattus norvegicus)
Mammalia Exoc3l2 34
  • 83.94 (n)
  • 89.49 (a)
(Monodelphis domestica)
Mammalia EXOC3L2 35
  • 30 (a)
(Ornithorhynchus anatinus)
Mammalia EXOC3L2 35
  • 76 (a)
(Anolis carolinensis)
Reptilia EXOC3L2 35
  • 2 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100486119 34
  • 50.48 (n)
  • 40.11 (a)
(Danio rerio)
Actinopterygii LOC565839 34
  • 54.4 (n)
  • 45.95 (a)
exoc3l2a 35
  • 42 (a)
exoc3l2b 35
  • 20 (a)
fruit fly
(Drosophila melanogaster)
Insecta sec6 35
  • 8 (a)
(Caenorhabditis elegans)
Secernentea sec-6 35
  • 7 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 10 (a)
Species where no ortholog for EXOC3L2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for EXOC3L2 Gene

Gene Tree for EXOC3L2 (if available)
Gene Tree for EXOC3L2 (if available)

Paralogs for EXOC3L2 Gene

Paralogs for EXOC3L2 Gene

genes like me logo Genes that share paralogs with EXOC3L2: view

Variants for EXOC3L2 Gene

Sequence variations from dbSNP and Humsavar for EXOC3L2 Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type
rs10411314 - 45,224,801(+) CAGGT(C/T)GGCCA reference, missense
rs3826909 -- 45,218,338(+) AGTAG(A/G)GGGTC intron-variant
rs11267990 -- 45,229,325(+) TATAT(-/ACATATATTTATGTATTAAATATAT)GTTAT intron-variant
rs28564302 -- 45,221,610(+) TGCTG(A/G)GATTA intron-variant
rs28607628 -- 45,221,485(+) CTGGG(A/G)CTACA intron-variant

Structural Variations from Database of Genomic Variants (DGV) for EXOC3L2 Gene

Variant ID Type Subtype PubMed ID
esv23015 CNV gain 19812545
esv2422482 CNV duplication 17116639
esv2678049 CNV deletion 23128226
esv3583434 CNV loss 25503493
esv3644501 CNV loss 21293372
nsv833843 CNV loss 17160897
nsv833844 CNV loss 17160897
nsv960854 CNV duplication 23825009

Variation tolerance for EXOC3L2 Gene

Residual Variation Intolerance Score: 88.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.52; 71.92% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for EXOC3L2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for EXOC3L2 Gene

Disorders for EXOC3L2 Gene

Relevant External Links for EXOC3L2

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for EXOC3L2 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for EXOC3L2 Gene

Publications for EXOC3L2 Gene

  1. Exocyst complex component 3-like 2 (EXOC3L2) associates with the exocyst complex and mediates directional migration of endothelial cells. (PMID: 21566143) Barkefors I. … Kreuger J. (J. Biol. Chem. 2011) 2 3 65
  2. New gene functions in megakaryopoiesis and platelet formation. (PMID: 22139419) Gieger C. … Soranzo N. (Nature 2011) 3 46 65
  3. Genome-wide analysis of genetic loci associated with Alzheimer disease. (PMID: 20460622) Seshadri S. … . (JAMA 2010) 3 46 65
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4 65
  5. Overrepresentation of glutamate signaling in Alzheimer's disease: network-based pathway enrichment using meta-analysis of genome-wide association studies. (PMID: 24755620) PAcrez-Palma E. … . (PLoS ONE 2014) 3 65

Products for EXOC3L2 Gene

Sources for EXOC3L2 Gene

Loading form....