Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

ESRRA Gene

protein-coding   GIFtS: 65
GCID: GC11P064073

estrogen-related receptor alpha


(Previous symbol: ESRL1)
 Explore 27 diseases affiliated with
ESRRA via our new
 Human Malady Compendium 
Biological research products
for ESRRA
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Estrogen-Related Receptor Alpha1 2 3     Estrogen Receptor-Like 12 3
ESRL11 2 3 5     Nuclear Receptor Subfamily 3 Group B Member 12 3
ERR11 2 3     ERR-Alpha1
NR3B11 2 3     Estrogen-Related Nuclear Receptor Alpha2
ERRa1 2     Steroid Hormone Receptor ERR12
ERRalpha1 2     

External Ids:    HGNC: 34711   Entrez Gene: 21012   Ensembl: ENSG000001731537   OMIM: 6019985   UniProtKB: P114743   

Export aliases for ESRRA gene to outside databases

Previous GC identifers: GC11P066588 GC11P065754 GC11P064323 GC11P063848 GC11P063829 GC11P060400


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for ESRRA:
The protein encoded by this gene is a nuclear receptor that is closely related to the estrogen receptor. This protein
acts as a site-specific transcription regulator and has been also shown to interact with estrogen and the transcripton
factor TFIIB by direct protein-protein contact. The binding and regulatory activities of this protein have been
demonstrated in the regulation of a variety of genes including lactoferrin, osteopontin, medium-chain acyl coenzyme A
dehydrogenase (MCAD) and thyroid hormone receptor genes. A processed pseudogene of ESRRA is located on chromosome
13q12.1. (provided by RefSeq, Jul 2008)

UniProtKB/Swiss-Prot: ERR1_HUMAN, P11474
Function: Binds to an ERR-alpha response element (ERRE) containing a single consensus half-site, 5'-TNAAGGTCA-3'. Can
bind to the medium-chain acyl coenzyme A dehydrogenase (MCAD) response element NRRE-1 and may act as an important
regulator of MCAD promoter. Binds to the C1 region of the lactoferrin gene promoter. Requires dimerization and the
coactivator, PGC-1A, for full activity. The ERRalpha/PGC1alpha complex is a regulator of energy metabolism

summary for ESRRA:
Estrogen controls many cellular processes including growth, differentiation and function of the reproductive
system. In females, estrogen's main targets are the ovaries, uterus, vagina and mammary glands. In the male,
target organs are the testes, prostate and epididymis. Estrogen is also responsible for the growth and
maintenance of the skeleton and the normal functioning of the cardiovascular and nervous systems. Estrogen
exerts most of its actions via estrogen receptors (ER). Estrogen receptors are ligand-activated
transcription factors belonging to the nuclear hormone receptor superfamily. Today, two estrogen receptors
are known, ERalpha and ERbeta. ERalpha protein is highly homologous to ERbeta protein, especially in the DNA
and ligand binding domains, although divergence exists in the N-terminal transactivation domain. Both
receptors interact with the same DNA response element and show a similar ligand binding profile. Upon ligand
binding estrogen receptors undergo a conformational change allowing spontaneous dimerization to form either
homo- or heterodimers. As a dimer, the estrogen receptor binds to the estrogen response element (ERE) in the
promoter region of target genes. ERalpha and ERbeta which are present in a broad spectrum of tissues.

Gene Wiki entry for ESRRA (Estrogen-related receptor alpha)


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000011.9  NC_018922.1  NT_167190.1  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the ESRRA gene promoter:
         CREB   PPAR-gamma1   deltaCREB   ATF-2   PPAR-gamma2   c-Jun   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): ESRRA promoter sequence
   Search SABiosciences Chromatin IP Primers for ESRRA

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ESRRA


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 11q13   Ensembl cytogenetic band:  11q13.1   HGNC cytogenetic band: 11q12

ESRRA Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ESRRA gene location

GeneLoc information about chromosome 11         GeneLoc Exon Structure

GeneLoc location for GC11P064073:  view genomic region     (about GC identifiers)

Start:
64,073,044 bp from pter      End:
64,084,215 bp from pter
Size:
11,172 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: ERR1_HUMAN, P11474 (See protein sequence)
Recommended Name: Steroid hormone receptor ERR1  
Size: 423 amino acids; 45510 Da
Subunit: Binds DNA as a monomer or a homodimer. Interacts (via the AF2 domain) with coactivator PPARGC1A (via the L3
motif); the interaction greatly enhances transriptional activity of genes involved in energy metabolism. Interacts
with PIAS4; the interaction enhances sumoylation
Subcellular location: Nucleus
Sequence caution: Sequence=AAB17015.1; Type=Erroneous initiation; Sequence=CAA35778.1; Type=Frameshift; Positions=345,
354;
4 PDB 3D structures from and Proteopedia for ESRRA:
1XB7 (3D)        2PJL (3D)        3D24 (3D)        3K6P (3D)    
Secondary accessions: Q14514
Alternative splicing: 2 isoforms:  P11474-1   P11474-2   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for ESRRA: NX_P11474

Post-translational modifications:

  • Phosphorylation on Ser-19 enhances sumoylation on Lys-14 increasing repression of transcriptional activity1
  • Sumoylated with SUMO2. Main site is Lys-14 which is enhanced by phosphorylation on Ser-19, cofactor activation, and by
  • interaction with PIAS4. Sumoylation enhances repression of transcriptional activiy, but has no effect on subcellular
    location nor on DNA binding1
  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_P11474

  • ESRRA Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins: NP_004442.3  
    ENSEMBL proteins: 
     ENSP00000385971   ENSP00000000442   ENSP00000439896   ENSP00000384851   ENSP00000441970  
     ENSP00000444710  
    Reactome Protein details: P11474
    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom Protein Services for ESRRA 
    GenScript Custom Purified and Recombinant Proteins Services for ESRRA
    Novus Biologicals ESRRA Proteins
    Novus Biologicals ESRRA Lysates
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for ESRRA

    Gene Ontology (GO): 2 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus TAS9286700
    GO:0005654nucleoplasm TAS--


    ESRRA for ontologies           About GeneDecksing



    ESRRA Antibody Products: 
    EMD Millipore Mono- and Polyclonal Antibodies for the study of ESRRA
    R&D Systems Antibodies for ESRRA (ERR alpha/NR3B1)
    OriGene Antibodies: ESRRA
    OriGene Custom Antibody Services for ESRRA 
    GenScript Superior Antibodies for ESRRA
    Novus Biologicals ESRRA Antibodies
    Abcam antibodies for ESRRA 
    Uscn Antibodies for ESRRA
    ThermoFisher Antibody for ESRRA

    Assay Products for ESRRA: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for ESRRA
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for ESRRA


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    ESRRA for domains           About GeneDecksing

    5/7 InterPro domains/families (see all 7):
     IPR008946 Nucl_hormone_rcpt_ligand-bd
     IPR001723 Str_hrmn_rcpt
     IPR027289 Oest-rel_rcp
     IPR024178 Oest_rcpt/oest-rel_rcp
     IPR013088 Znf_NHR/GATA

    Graphical View of Domain Structure for InterPro Entry P11474

    ProtoNet protein and cluster: P11474

    2 Blocks protein families:
    IPB000003 Retinoic acid receptor signature
    IPB001723 Steroid hormone receptor signature


    UniProtKB/Swiss-Prot: ERR1_HUMAN, P11474
    Similarity: Belongs to the nuclear hormone receptor family. NR3 subfamily
    Similarity: Contains 1 nuclear receptor DNA-binding domain


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: ERR1_HUMAN, P11474
    Function: Binds to an ERR-alpha response element (ERRE) containing a single consensus half-site, 5'-TNAAGGTCA-3'. Can
    bind to the medium-chain acyl coenzyme A dehydrogenase (MCAD) response element NRRE-1 and may act as an important
    regulator of MCAD promoter. Binds to the C1 region of the lactoferrin gene promoter. Requires dimerization and the
    coactivator, PGC-1A, for full activity. The ERRalpha/PGC1alpha complex is a regulator of energy metabolism
    Induction: Induced by PGC1alpha in a number of specific cell types including heart, kidney and muscle

         Genatlas biochemistry entry for ESRRA:
    estrogen-related receptor A,orphan receptors family,steroid/thyroid hormone receptor superfamily,involved in the
    expression of SV40 major late promoter modulator of ESR response of lactoferrin promoter,regulator of medium chain
    acyl CoA dehydrogenase

    miRNA
    Products:
        
    OriGene 3'-UTR Clone: ESRRA
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ESRRA
    8/65 QIAGEN miScript miRNA Assays for microRNAs that regulate ESRRA (see all 65):
    hsa-miR-323-3p hsa-miR-642a hsa-miR-3194-5p hsa-miR-15a hsa-miR-637 hsa-miR-761 hsa-miR-4324 hsa-miR-34c-5p
    SwitchGear 3'UTR luciferase reporter plasmidESRRA 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ESRRA (see all 7)
    OriGene shRNA RFP: ESRRA
    OriGene siRNA: ESRRA
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ESRRA

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for ESRRA

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ESRRA (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ESRRA
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: ESRRA (NM_004451)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ESRRA
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ESRRA 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for ESRRA
    Search LifeMap BioReagents cell lines for ESRRA

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ESRRA

    Gene Ontology (GO): 5/9 molecular function terms (GO ID links to tree view) (see all 9):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003677DNA binding TAS9286700
    GO:0003700sequence-specific DNA binding transcription factor activity ----
    GO:0003707steroid hormone receptor activity IEA--
    GO:0004879ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity TAS9286700
    GO:0005496steroid binding IEA--


    ESRRA for ontologies           About GeneDecksing


    1 GenomeRNAi human phenotype for ESRRA:
     Increased Salmonella enterica  

    Animal Models:
         Mouse knock-outs for ESRRA: Esrratm1Lex Esrratm1Vgi
         8 MGI mutant phenotypes (inferred from 3 alleles(MGI details for Esrra):
     adipose tissue  cellular  growth/size  hematopoietic system  homeostasis/metabolism 
     immune system  normal  skeleton 

    ESRRA for phenotypes           About GeneDecksing


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways  About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1Generic Transcription Pathway
    Generic Transcription Pathway1.00
    Gene Expression0.46
    2Nuclear Receptor transcription pathway
    Nuclear Receptor transcription pathway1.00
    Nuclear Receptors0.68
    3Mitochondrial Gene Expression
    Mitochondrial Gene Expression1.00
    4PEDF Induced Signaling
    PGC1Alpha Pathway0.33
    5The fatty acid cycling model
    Energy Metabolism0.04

    Pathway sources
    See GeneCards unified pathways
    Show all pathways

    1 Downloadable PowerPoint Slide of QIAGEN Pathway Central Maps for ESRRA
        PGC1Alpha Pathway

    3 BioSystems Pathways for ESRRA 
        Nuclear Receptors
    Mitochondrial Gene Expression
    Energy Metabolism

    3        Reactome Pathways for ESRRA
        Generic Transcription Pathway
    Nuclear Receptor transcription pathway
    Gene Expression



    ESRRA for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for ESRRA

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/80 Interacting proteins for ESRRA (P114741, 2, 3 ENSP000000004424) via UniProtKB, MINT, STRING, and/or I2D (see all 80)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    PNRC2Q9NPJ42, 3, ENSP000003348404MINT-15069 I2D: score=2 STRING: ENSP00000334840
    LOC100996626Q9NPJ42, 3MINT-15069 I2D: score=2 
    TRRAPQ9Y4A51, 3, ENSP000003477334EBI-372412,EBI-399128 I2D: score=2 STRING: ENSP00000347733
    PPARGC1AQ9UBK23, ENSP000002648674I2D: score=3 STRING: ENSP00000264867
    EXOSC6Q5RKV63, ENSP000003985974I2D: score=2 STRING: ENSP00000398597
    About this table

    Gene Ontology (GO): 5/11 biological process terms (GO ID links to tree view) (see all 11):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006351transcription, DNA-dependent ----
    GO:0006367transcription initiation from RNA polymerase II promoter TAS--
    GO:0010467gene expression TAS--
    GO:0030278regulation of ossification ----
    GO:0030522intracellular receptor mediated signaling pathway TAS9286700


    ESRRA for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    ESRRA for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Compounds for ESRRA available from Tocris Bioscience    About this table
    CompoundAction CAS #
    GSK 4716Selective ERRgamma and ERRbeta agonist[101574-65-6]

    2 DrugBank Compounds for ESRRA    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    1-CYCLOHEXYL-N-{[1-(4-METHYLPHENYL)-1H-INDOL-3-YL]METHYL}METHANAMINE-- --target--10592235
    Troglitazone-- 97322-87-7targetinverse agonist20298676

    10/17 Novoseek chemical compound relationships for ESRRA gene (see all 17)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    estrogen 77 223 16464951 (8), 12960079 (7), 18974123 (4), 15713703 (4) (see all 62)
    fulvestrant 67.5 4 16687070 (3), 17631492 (1)
    biochanin a 67.2 1 16515477 (1)
    diethylstilbestrol 51.8 1 11559547 (1)
    daidzein 48.4 1 16515477 (1)
    acetyl-coa 44.3 1 16022198 (1)
    pyruvate 43.3 1 17079227 (1)
    steroid 40.3 11 19264843 (2), 15878968 (2), 18697814 (1), 20400511 (1) (see all 8)
    genistein 35.2 1 16515477 (1)
    tamoxifen 20.9 6 20211987 (2)

    Search CenterWatch for drugs/clinical trials and news about ESRRA / ERR1 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for ESRRA gene: 
    NM_004451.3  

    Unigene Cluster for ESRRA:

    Estrogen-related receptor alpha
    Hs.110849  [show with all ESTs]
    Unigene Representative Sequence: BC092470
    7 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000406310(uc001nzq.1 uc001nzr.1) ENST00000000442(uc009ypn.1)
    ENST00000539594 ENST00000405666(uc001nzs.1) ENST00000468670 ENST00000467987
    ENST00000545035

    miRNA
    Products:
         
    OriGene 3'-UTR Clone: ESRRA
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ESRRA
    8/65 QIAGEN miScript miRNA Assays for microRNAs that regulate ESRRA (see all 65):
    hsa-miR-323-3p hsa-miR-642a hsa-miR-3194-5p hsa-miR-15a hsa-miR-637 hsa-miR-761 hsa-miR-4324 hsa-miR-34c-5p
    SwitchGear 3'UTR luciferase reporter plasmidESRRA 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ESRRA (see all 7)
    OriGene shRNA RFP: ESRRA
    OriGene siRNA: ESRRA
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ESRRA
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ESRRA (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ESRRA
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: ESRRA (NM_004451)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ESRRA
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ESRRA 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ESRRA
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat ESRRA
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ESRRA
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ESRRA

    Additional cDNA sequence: 

    AB362579.1 BC007915.2 BC011528.1 BC033701.1 BC063795.1 BC073956.1 BC092470.1 BC093720.1 
    BC093722.1 HQ692867.1 L38487.1 

    19 DOTS entries:

    DT.75155335  DT.100788956  DT.92032780  DT.100796196  DT.95275489  DT.120754174  DT.100788950  DT.100788958 
    DT.100796190  DT.100038831  DT.120754141  DT.120754248  DT.40267222  DT.95130749  DT.102838738  DT.92412672 
    DT.97860417  DT.100788945  DT.100788946 

    24/828 AceView cDNA sequences (see all 828):

    BM739017 BM760651 BG757759 BG397458 CD556643 BM747467 BM853924 BM791802 
    L38487 BU734349 CF131663 BF664452 BE298055 BE790729 CB216707 BM040936 
    BM739014 BG757878 BQ941699 BM850193 BE278200 BQ948248 BF970830 CR625609 

    GeneLoc Exon Structure

    5 Alternative Splicing Database (ASD) splice patterns (SP) for ESRRA    About this scheme

    ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8 ^ 9
    SP1:        -     -           -                                 
    SP2:                                                            
    SP3:              -           -                                 
    SP4:                                                            
    SP5:                                                            


    ECgene alternative splicing isoforms for ESRRA

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    ESRRA expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: GGGCAAGCCA

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image

    ESRRA expression in embryonic tissues and stem cells
    Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine    About this table
    3 LifeMap In Vivo Development Anatomical Compartments/Cells 
    Tissue Anatomical Compartment CellCategory (developmental path)
    KidneyProximal TubuleProximal Tubule CellsKidney
    KidneyEpithelial TubuleKidney
    KidneyProximal TubuleKidney
    Expression: Positive    Negative     Selective marker
    Experimental details: Curated     Microarrays     In-situ hybridization

    See ESRRA Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for ESRRA

    SOURCE GeneReport for Unigene cluster: Hs.110849
        SABiosciences Expression via Pathway-Focused PCR Arrays including ESRRA: 
              Circadian Rhythms in human mouse rat
              Nuclear Receptors & Coregulators in human mouse rat

    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ESRRA
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat ESRRA
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ESRRA
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ESRRA
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ESRRA

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for ESRRA gene from 4/14 species (see all 14)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    lizard
    (Anolis carolinensis)
    Reptilia ESRRA6
    --
    76(a)
    1 ↔ 1
    AAWZ02036029(262-5534)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.102092 Xenopus laevis, clone IMAGE5542776, mRNA 75.12(n)    BC044274.1 
    zebrafish
    (Danio rerio)
    Actinopterygii esrra1 estrogen-related receptor alpha 65.34(n)
    68.49(a)
      405891  NM_212955.1  NP_998120.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta ERR3 ligand-dependent nuclear receptor 43(a)   66B11   --


    ENSEMBL Gene Tree for ESRRA (if available)
    TreeFam Gene Tree for ESRRA (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for ESRRA gene
    RXRG2  PGR2  ESR22  ESRRB2  HNF4G2  NR2F62  NR2E12  ESRRG2  
    NR3C22  RXRA2  NR2F12  NR3C12  NR2F22  AR2  ESR12  NR2C12  
    HNF4A2  NR2C22  RXRB2  
    18/28 SIMAP similar genes for ESRRA using alignment to 8 protein entries:     ERR1_HUMAN (see all proteins) (see all similar genes):
    HNF4G    ESR1    AR    VDR    ERRgamma    NR3B3
    ESRRG    ESRRB    HNF4alpha    RARG    NR3C2    THRA
    NR3A1    NR3A2    ESR2    NR2F1    NR2F2    PGR

    ESRRA for paralogs           About GeneDecksing


    2 Pseudogenes.org Pseudogenes for ESRRA
    PGOHUM00000248311 PGOHUM00000248516


    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/32 NCBI SNPs in ESRRA are shown (see all 32    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 11 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs5207101,2
    --60398811(-) AATTTG/ACCTAT 1 -- us2k11Minor allele frequency- A:0.00MN 184
    rs412943711,2
    F--60400085(+) ACCTT-/CATTCGGTCA
    CGGCAGGGACCTT
    GAGCT
    1 -- us2k15Minor allele frequency- CATTCGGTCACGGCAGGGACCTT:0.05NS 160
    rs799414581,2
    F,--60411458(+) AGGGGG/ACTGCA 1 -- ut311Minor allele frequency- A:0.04EA 120
    rs32049191,2
    C--60411762(+) TGCCTC/TTATGC 1 -- ut31 ese30--------
    rs178526601,2
    C--60412093(+) CCTCTT/CCACTC 1 -- ds50012Minor allele frequency- C:0.00NA 4
    rs1882300001,2
    --64071482(+) GGGCAC/GAGGAA 1 -- int10--------
    rs1449716171,2
    C,--64071579(+) GGCTG-/GTTTTTCT 1 -- int10--------
    rs1809339961,2
    --64071627(+) CGACTG/TCCTCT 1 -- int10--------
    rs6500121,2
    C,F,H,--64071693(-) CTACCC/ACAGCA 1 -- int1 tfbs321Minor allele frequency- A:0.04MN NS NA WA CSA 1411
    rs1862889831,2
    --64071926(+) ATCTGC/TGGTTC 1 -- int10--------

    HapMap Linkage Disequilibrium report for ESRRA (64073044 - 64084215 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
          Database of Genomic Variants (DGV) variations for ESRRA: --

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ESRRA
    DNA2.0 Custom Variant and Variant Library Synthesis for ESRRA

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    ESRRA for disorders           About GeneDecksing

    OMIM gene information: 601998    OMIM disorders: --

    20/27 diseases for ESRRA (see all 27):    About MalaCards
    acyl-coa dehydrogenase    estrogen-receptor negative breast cancer    prostatitis    thyroiditis
    insulin resistance    metabolic disorders    epithelial ovarian cancer    endometrial carcinoma
    ovarian cancer    endometrial cancer    osteoporosis    breast cancer
    endometrial adenocarcinoma    breast carcinoma    crohn's disease    obesity
    cervical cancer    carcinoma    cervicitis    astrocytoma

    10/12 Novoseek disease relationships for ESRRA gene (see all 12)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    endometrial carcinoma 54.8 21 17068614 (4), 16681769 (3), 15968320 (2), 17010074 (2) (see all 8)
    metabolic disorder 46.9 14 15184675 (1), 18052088 (1), 19462000 (1), 16515477 (1) (see all 7)
    breast cancer 43.7 55 19138740 (6), 19622763 (5), 19429439 (4), 18974123 (3) (see all 16)
    endometrial cancer 30.3 17 16464951 (7), 17697604 (7), 19416752 (2)
    breast carcinoma 23.2 9 19491275 (3), 15231680 (3), 18974123 (1)
    insulin resistance 17.9 1 17187250 (1)
    obesity 17.1 6 16755280 (2), 15466464 (1), 16286534 (1), 15184675 (1)
    osteoporosis 13.8 5 17556356 (1), 15713703 (1)
    ovarian cancer 11.6 16 16202294 (6), 17509876 (3), 17259555 (1), 18974123 (1)
    tumors 0 25 12438245 (6), 19491275 (3), 19622763 (2), 19429439 (2) (see all 12)

    Genetic Association Database (GAD): ESRRA
    Human Genome Epidemiology (HuGE) Navigator: ESRRA (10 documents)

    Export disorders for ESRRA gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for ESRRA gene, integrated from 9 sources (see all 196):
    (articles sorted by number of sources associating them with ESRRA)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Identification of a new class of steroid hormone receptors. (PubMed id 3267207)1, 2, 3 Giguere V.... Evans R.M. (1988)
    2. The orphan nuclear receptor estrogen-related receptor alpha is a transcriptional regulator of the human medium-chain acyl coenzyme A dehydrogenase gene. (PubMed id 9271417)1, 2, 9 Sladek R.... Giguere V. (1997)
    3. A frequent regulatory variant of the estrogen-related receptor alpha gene associated with BMD in French-Canadian premenopausal women. (PubMed id 15883633)1, 4, 9 Laflamme N....Rousseau F. (2005)
    4. Evidence for ligand-independent transcriptional activation of the human estrogen-related receptor alpha (ERRalpha): crystal structure of ERRalpha ligand binding domain in complex with peroxisome proliferator-activated receptor coactivator-1alpha. (PubMed id 15337744)1, 2, 9 Kallen J....Fournier B. (2004)
    5. The transcriptional coactivator PGC-1 regulates the expression and activity of the orphan nuclear receptor estrogen-related receptor alpha (ERRalpha). (PubMed id 12522104)1, 2, 9 Schreiber S.N.... Kralli A. (2003)
    6. A single nucleotide in an estrogen-related receptor alpha site can dictate mode of binding and peroxisome proliferator-activated receptor gamma coactivator 1alpha activation of target promoters. (PubMed id 16150865)1, 2, 9 Barry J.B.... Giguere V. (2006)
    7. Estrogen-related receptor, hERR1, modulates estrogen receptor- mediated response of human lactoferrin gene promoter. (PubMed id 8621448)1, 2 Yang N.... Teng C.T. (1996)
    8. SV40 early-to-late switch involves titration of cellular transcriptional repressors. (PubMed id 8224847)1, 2 Wiley S.R.... Mertz J.E. (1993)
    9. A polymorphic autoregulatory hormone response element in the human estrogen-related receptor alpha (ERRalpha) promoter dictates peroxisome proliferator-activated receptor gamma coactivator-1alpha control of ERRalpha expression. (PubMed id 14978033)1, 9 Laganiere J....Giguere V. (2004)
    10. Estrogen receptor-related receptor alpha mediates up- regulation of aromatase expression by prostaglandin E2 in prostate stromal cell s. (PubMed id 20351196)1, 9 Miao L....Zhang J. (2010)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 2101 HGNC: 3471 AceView: ESRRAandPRDX5 Ensembl:ENSG00000173153 euGenes: HUgn2101
    ECgene: ESRRA H-InvDB: ESRRA

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for ESRRA Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for ESRRA gene:
    Search GeneIP for patents involving ESRRA

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
     Browse Small Molecules at EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of ESRRA
     Browse Purified and Recombinant Proteins at EMD Millipore
     Browse for Gene Knock-down Tools from EMD Millipore
     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Antibodies for ESRRA (ERR alpha/NR3B1)   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     OriGene Antibodies for ESRRA   OriGene shRNA RFP for ESRRA  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ESRRA   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ESRRA  
     Browse OriGene Protein Over-expression Lysates   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for ESRRA   OriGene 3'-UTR Clone for ESRRA  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ESRRA   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ESRRA  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for ESRRA   OriGene Custom Protein Services for ESRRA  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat ESRRA
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ESRRA
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ESRRA
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ESRRA
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ESRRA
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ESRRA
     GenScript Custom Purified and Recombinant Proteins Services for ESRRA GenScript cDNA clones with any tag delivered in your preferred vector for ESRRA
     GenScript Custom Assay Services for ESRRA GenScript Superior Antibodies for ESRRA
     GenScript Custom overexpressing Cell Line Services for ESRRA CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in ESRRA promoter
     Search Chromatin IP Primers for ESRRA
     RT2 qPCR Primer Assay in human, mouse, rat ESRRA
     GNC Network for ESRRA
     SABiosciences PCR Arrays including human, mouse, rat ESRRA
     Tocris compounds for ESRRA
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     ESRRA antibodies
     ESRRA proteins
     ESRRA lysates
     Antibodies for ESRRA
     See all of Abcam's Antibodies, Kits and Proteins for ESRRA
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     ESRRA Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for ESRRA
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ESRRA
     SwitchGear 3'UTR luciferase reporter plasmids for ESRRA
     SwitchGear Promoter luciferase reporter plasmids for ESRRA
     ThermoFisher Antibody for ESRRA
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ESRRA
           
    GeneCards Homepage - Last full update: 18 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      ESRRA gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 100 solr: 1.4