Set Analyses:
Advanced Search

Advanced Search

Search By
Section (entire)


ERCC1 Gene

protein-coding   GIFtS: 72
GCID: GC19M045912

Excision Repair Cross-Complementation Group 1

(Previous names: excision repair cross-complementing rodent repair deficiency,...)
  See related diseases

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

This gene clusters with an RNA gene
Subcategory (RNA class): antisense

Quality score for the ORGUL clustered with this gene is 3

Excision Repair Cross-Complementation Group 11 2
Excision Repair Cross-Complementing Rodent Repair Deficiency,
Complementation Group 1 (Includes Overlapping Antisense Sequence)1 2
COFS42 5
UV202 5
DNA Excision Repair Protein ERCC-12

External Ids:    HGNC: 34331   Entrez Gene: 20672   Ensembl: ENSG000000120617   OMIM: 1263805   UniProtKB: P079923   
ORGUL members:         

Export aliases for ERCC1 gene to outside databases

Previous GC identifers: GC19M046556 GC19M046303 GC19M050586 GC19M050604 GC19M050602 GC19M042340

(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for ERCC1 Gene:
The product of this gene functions in the nucleotide excision repair pathway, and is required for the repair of
DNA lesions such as those induced by UV light or formed by electrophilic compounds including cisplatin. The
encoded protein forms a heterodimer with the XPF endonuclease (also known as ERCC4), and the heterodimeric
endonuclease catalyzes the 5' incision in the process of excising the DNA lesion. The heterodimeric endonuclease
is also involved in recombinational DNA repair and in the repair of inter-strand crosslinks. Mutations in this
gene result in cerebrooculofacioskeletal syndrome, and polymorphisms that alter expression of this gene may play
a role in carcinogenesis. Multiple transcript variants encoding different isoforms have been found for this gene.
The last exon of this gene overlaps with the CD3e molecule, epsilon associated protein gene on the opposite
strand. (provided by RefSeq, Oct 2009)

GeneCards Summary for ERCC1 Gene:
ERCC1 (excision repair cross-complementation group 1) is a protein-coding gene. Diseases associated with ERCC1 include ercc1-related xeroderma pigmentosum, and cerebrooculofacioskeletal syndrome 4. GO annotations related to this gene include single-stranded DNA binding and protein C-terminus binding.

UniProtKB/Swiss-Prot: ERCC1_HUMAN, P07992
Function: Isoform 1: Non-catalytic component of a structure-specific DNA repair endonuclease responsible for the
5'-incision during DNA repair. Responsible, in conjunction with SLX4, for the first step in the repair of
interstrand cross-links (ICL). Participates in the processing of anaphase bridge-generating DNA structures, which
consist in incompletely processed DNA lesions arising during S or G2 phase, and can result in cytokinesis
failure. Also required for homology-directed repair (HDR) of DNA double-strand breaks, in conjunction with SLX4

Gene Wiki entry for ERCC1 Gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000019.10  NT_011109.17  NC_018930.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the ERCC1 gene promoter:
         AP-1   ATF-2   c-Jun   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): ERCC1 promoter sequence
   Search Chromatin IP Primers for ERCC1

DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ERCC1

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 19q13.32   Ensembl cytogenetic band:  19q13.32   HGNC cytogenetic band: 19q13.32

ERCC1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ERCC1 gene location

GeneLoc information about chromosome 19         GeneLoc Exon Structure

GeneLoc location for GC19M045912:  view genomic region     (about GC identifiers)

45,910,591 bp from pter      End:
45,982,086 bp from pter
71,496 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: ERCC1_HUMAN, P07992 (See protein sequence)
Recommended Name: DNA excision repair protein ERCC-1  
Size: 297 amino acids; 32562 Da
Subunit: Heterodimer composed of ERCC1 isoform 1 and XPF/ERRC4
5 PDB 3D structures from and Proteopedia for ERCC1:
1Z00 (3D)        2A1I (3D)        2A1J (3D)        2JNW (3D)        2JPD (3D)    
Secondary accessions: B2RC01 B3KRR0 Q7Z7F5 Q96S40
Alternative splicing: 4 isoforms:  P07992-1   P07992-2   P07992-3   P07992-4   (Not functional in the nucleotide excision repair pathway. Does not interact with XPF/ERCC4)

Explore the universe of human proteins at neXtProt for ERCC1: NX_P07992

Explore proteomics data for ERCC1 at MOPED

Post-translational modifications: 

  • Ubiquitination2 at Lys162
  • Modification sites at PhosphoSitePlus

  • See ERCC1 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (3 alternative transcripts): 
    NP_001159521.1  NP_001974.1  NP_973730.1  

    ENSEMBL proteins: 
     ENSP00000300853   ENSP00000394875   ENSP00000345203   ENSP00000466644   ENSP00000468119  
     ENSP00000468035   ENSP00000013807   ENSP00000465354   ENSP00000465225   ENSP00000468548  
     ENSP00000467183   ENSP00000468158   ENSP00000465524  
    Reactome Protein details: P07992

    ERCC1 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Proteins for ERCC1
    OriGene Protein Over-expression Lysate for ERCC1
    OriGene MassSpec for ERCC1
    OriGene Custom Protein Services for ERCC1
    GenScript Custom Purified and Recombinant Proteins Services for ERCC1
    Novus Biologicals ERCC1 Proteins
    Novus Biologicals ERCC1 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    ProSpec Recombinant Protein for ERCC1
    Cloud-Clone Corp. Proteins for ERCC1

    ERCC1 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    R&D Systems Antibodies for ERCC1
    Cell Signaling Technology (CST) Antibodies for ERCC1 
    OriGene Antibodies for ERCC1
    OriGene Custom Antibody Services for ERCC1
    Novus Biologicals ERCC1 Antibodies
    Abcam antibodies for ERCC1
    Cloud-Clone Corp. Antibodies for ERCC1
    ThermoFisher Antibody for ERCC1
    LSBio Antibodies in human, mouse, rat for ERCC1

    ERCC1 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for ERCC1
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for ERCC1
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for ERCC1
    Cloud-Clone Corp. CLIAs for ERCC1

    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    5 InterPro protein domains:
     IPR003583 Hlx-hairpin-Hlx_DNA-bd_motif
     IPR011335 Restrct_endonuc-II-like
     IPR004579 DNA_repair_Rad10
     IPR000445 HhH_motif
     IPR010994 RuvA_2-like

    Graphical View of Domain Structure for InterPro Entry P07992

    ProtoNet protein and cluster: P07992

    2 Blocks protein domains:
    IPB003583 Helix-hairpin-helix DNA-binding
    IPB004579 DNA repair protein rad10

    UniProtKB/Swiss-Prot: ERCC1_HUMAN, P07992
    Similarity: Belongs to the ERCC1/RAD10/SWI10 family

    ERCC1 for domains           About GeneDecksing

    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: ERCC1_HUMAN, P07992
    Function: Isoform 1: Non-catalytic component of a structure-specific DNA repair endonuclease responsible for the
    5'-incision during DNA repair. Responsible, in conjunction with SLX4, for the first step in the repair of
    interstrand cross-links (ICL). Participates in the processing of anaphase bridge-generating DNA structures, which
    consist in incompletely processed DNA lesions arising during S or G2 phase, and can result in cytokinesis
    failure. Also required for homology-directed repair (HDR) of DNA double-strand breaks, in conjunction with SLX4

         Genatlas biochemistry entry for ERCC1:
    excision repair cross-complementing rodent repair defect in CHO cells (includes overlapping antisense
    sequence),complementation group 1,yeast RAD10 homolog,specific for leukemic blasts

         Gene Ontology (GO): Selected molecular function terms (see all 11):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000014contributes to single-stranded DNA endodeoxyribonuclease activity IDA7559382
    GO:0001094TFIID-class transcription factor binding IEA--
    GO:0003677DNA binding ----
    GO:0003684damaged DNA binding IDA17720715
    GO:0003697single-stranded DNA binding IDA16076955
    ERCC1 for ontologies           About GeneDecksing

         2 GenomeRNAi human phenotypes for ERCC1:
     Decreased Hepatitis C virus re  Increased gamma-H2AX phosphory 

         Selected MGI mutant phenotypes (inferred from 5 alleles(MGI details for Ercc1) (see all 17):
     adipose tissue  behavior/neurological  cellular  embryogenesis  endocrine/exocrine gland 
     growth/size/body  hematopoietic system  homeostasis/metabolism  immune system  integument 
     liver/biliary system  mortality/aging  muscle  renal/urinary system  reproductive system 

    ERCC1 for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-outs for ERCC1: Ercc1tm1Dwm Ercc1tm1Jhjh

       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for ERCC1
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for ERCC1

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for ERCC1
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for ERCC1

    miRTarBase miRNAs that target ERCC1:
    hsa-let-7b-5p (MIRT052171), hsa-mir-296-3p (MIRT038492)

    Block miRNA regulation of human, mouse, rat ERCC1 using miScript Target Protectors
    Search for qRT-PCR Assays for microRNAs that regulate ERCC1
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for ERCC1
    Predesigned siRNA for gene silencing in human, mouse, rat ERCC1

    Gene Editing
    DNA2.0 Custom Protein Engineering Service for ERCC1

    OriGene clones in human, mouse for ERCC1 (see all 18)
    OriGene ORF clones in mouse, rat for ERCC1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): ERCC1 (NM_001983)
    Sino Biological Human cDNA Clone for ERCC1
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ERCC1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ERCC1

    Cell Line
    GenScript Custom overexpressing Cell Line Services for ERCC1
    Browse ESI BIO Cell Lines and PureStem Progenitors for ERCC1 
    In Situ Assay

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ERCC1

    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    ERCC1_HUMAN, P07992: Isoform 1: Nucleus
    ERCC1_HUMAN, P07992: Isoform 2: Cytoplasm. Nucleus
    ERCC1_HUMAN, P07992: Isoform 3: Nucleus
    ERCC1_HUMAN, P07992: Isoform 4: Nucleus
    Subcellular locations from COMPARTMENTS: 


    Gene Ontology (GO): Selected cellular component terms (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000109nucleotide-excision repair complex IDA3290851
    GO:0000784nuclear chromosome, telomeric region IDA14690602
    GO:0005634nucleus IDA--
    GO:0005654nucleoplasm TAS--
    GO:0005669transcription factor TFIID complex IEA--

    ERCC1 for ontologies           About GeneDecksing

    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for ERCC1 About   (see all 6)  
    See pathways by source

    SuperPathContained pathways About
    1Global Genomic NER (GG-NER)
    Global Genomic NER (GG-NER)0.69
    Formation of incision complex in GG-NER0.62
    Nucleotide excision repair0.69
    Nucleotide Excision Repair Pathway0.48
    Dual incision reaction in GG-NER0.62
    2DNA Repair
    Transcription-coupled NER (TC-NER)0.90
    Dual incision reaction in TC-NER0.65
    Nucleotide Excision Repair0.90
    DNA Repair0.45
    Formation of transcription-coupled NER (TC-NER) repair complex0.65
    3Cell Cycle / Checkpoint Control
    Cell Cycle / Checkpoint Control0.32
    DNA Damage0.32
    4Chks in Checkpoint Regulation
    DNA Repair Mechanisms0.32
    5Fanconi anemia pathway (KEGG)
    Fanconi anemia pathway

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    2 Downloadable PowerPoint Slides of GeneGlobe Pathway Central Maps for ERCC1
        DNA Repair Mechanisms
    Nucleotide Excision Repair Pathway

    2 Cell Signaling Technology (CST) Pathways for ERCC1
        Cell Cycle / Checkpoint Control
    DNA Damage

    4 Reactome Pathways for ERCC1
        Formation of transcription-coupled NER (TC-NER) repair complex
    Dual incision reaction in TC-NER
    Formation of incision complex in GG-NER
    Dual incision reaction in GG-NER

    1 PharmGKB Pathway for ERCC1
        Cyclophosphamide Pathway, Pharmacodynamics

    2 Kegg Pathways  (Kegg details for ERCC1):
        Nucleotide excision repair
    Fanconi anemia pathway

    ERCC1 for pathways           About GeneDecksing

        Pathway & Disease-focused RT2 Profiler PCR Arrays including ERCC1 (see all 7): 
              Lung Cancer in human mouse rat
              Insulin Signaling Pathway in human mouse rat
              DNA Damage Signaling Pathway in human mouse rat
              p53 Signaling Pathway in human mouse rat
              Telomeres & Telomerase in human mouse rat


        GeneGlobe Interaction Network for ERCC1

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    Selected Interacting proteins for ERCC1 (P079921, 2, 3 ENSP000000138074) via UniProtKB, MINT, STRING, and/or I2D (see all 680)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    SLX4Q8IY921, 3, ENSP000002940084EBI-750962,EBI-2370740 I2D: score=2 STRING: ENSP00000294008
    SLX1AQ9BQ833, ENSP000002513034I2D: score=2 STRING: ENSP00000251303
    SLX1BQ9BQ833, ENSP000003289404I2D: score=2 STRING: ENSP00000328940
    XPAP230253, ENSP000003642704I2D: score=5 STRING: ENSP00000364270
    ERCC4Q928893, ENSP000003105204I2D: score=3 STRING: ENSP00000310520
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 33):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000718nucleotide-excision repair, DNA damage removal TAS--
    GO:0000720pyrimidine dimer repair by nucleotide-excision repair IEA--
    GO:0000737DNA catabolic process, endonucleolytic IDA7559382
    GO:0001302replicative cell aging IEA--
    GO:0006281DNA repair TAS--

    ERCC1 for ontologies           About GeneDecksing

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for ERCC1

    Selected Novoseek inferred chemical compound relationships for ERCC1 gene (see all 42)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    cisplatin 82.4 254 10810335 (7), 18756932 (6), 19626585 (6), 11163512 (6) (see all 97)
    oxaliplatin 77.4 30 19194123 (3), 18204222 (2), 19105824 (2), 15629453 (1) (see all 15)
    gemcitabine 75.3 52 18494946 (4), 20211060 (3), 19884554 (3), 19667277 (3) (see all 27)
    thymidylate 74.8 29 19051292 (2), 19194123 (2), 18565686 (2), 18507058 (1) (see all 22)
    irinotecan 67.6 5 12749725 (1), 17417781 (1), 18231104 (1), 19457654 (1) (see all 5)
    n-acetoxy-2-acetylaminofluorene 67.1 1 16882524 (1)
    5fluorouracil 62.3 27 9268987 (4), 18497992 (3), 15655543 (1), 9440758 (1) (see all 17)
    carboplatin 59.8 18 18977553 (3), 19667277 (3), 19884554 (2), 18494946 (2) (see all 11)
    vinorelbine 57.2 3 17417781 (1), 17166391 (1), 20082278 (1)
    platinum 57.1 41 19240185 (6), 18024864 (4), 18575867 (3), 19035454 (2) (see all 9)

    6 PharmGKB related drug/compound annotations for ERCC1 gene    About this table
    Drug/compound PharmGKB Annotation
    Platinum compoundsCA  

    ERCC1 for compounds           About GeneDecksing

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for ERCC1 gene (3 alternative transcripts): 
    NM_001166049.1  NM_001983.3  NM_202001.2  

    Unigene Cluster for ERCC1:

    Excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)
    Hs.435981  [show with all ESTs]
    Unigene Representative Sequence: NM_001983
    17 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000300853(uc002pbs.2) ENST00000423698(uc002pbu.2) ENST00000588738
    ENST00000340192(uc002pbt.2) ENST00000590701 ENST00000591636 ENST00000589165
    ENST00000013807(uc002pbv.3) ENST00000592410 ENST00000592444 ENST00000587888
    ENST00000589381 ENST00000592083 ENST00000592905 ENST00000592023 ENST00000588300
    Block miRNA regulation of human, mouse, rat ERCC1 using miScript Target Protectors
    Search for qRT-PCR Assays for microRNAs that regulate ERCC1
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for ERCC1
    Predesigned siRNA for gene silencing in human, mouse, rat ERCC1
    OriGene clones in human, mouse for ERCC1 (see all 18)
    OriGene ORF clones in mouse, rat for ERCC1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): ERCC1 (NM_001983)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ERCC1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ERCC1
    OriGene qPCR primer pairs and template standards for ERCC1
    OriGene qSTAR qPCR primer pairs in human, mouse for ERCC1
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ERCC1
      QuantiTect SYBR Green Assays in human, mouse, rat ERCC1
      QuantiFast Probe-based Assays in human, mouse, rat ERCC1

    Additional mRNA sequence: 

    AB069681.1 AF001925.1 AF433652.1 AK092039.1 AK314884.1 BC008930.2 BC052813.1 BT019806.1 
    M13194.1 M28650.1 S94539.1 

    20 DOTS entries:

    DT.100792041  DT.99949247  DT.215064  DT.80101937  DT.91686496  DT.121483494  DT.101960319  DT.40114141 
    DT.95256351  DT.97847780  DT.453132  DT.92444217  DT.100792038  DT.100721167  DT.80101939  DT.100792039 
    DT.100792040  DT.100792042  DT.121483560  DT.95099220 

    Selected AceView cDNA sequences (see all 318):

    BQ648919 BE772375 CR616265 BG390552 BQ010328 BU631339 BE772447 BE832630 
    BG574302 BU625078 NM_202001 CA415582 AI086816 BE831520 H42886 BM845336 
    CN482258 AW163286 BM666497 AA972775 BE831497 M13194 BE831495 BM453702 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for ERCC1 (see all 10)    About this scheme

    ExUns: 1a · 1b · 1c · 1d ^ 2a · 2b · 2c · 2d ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9a · 9b ^ 10a · 10b · 10c ^ 11a · 11b
    SP1:                          -     -                                         -           -                       -     -               
    SP2:                          -     -                                         -           -     -     -           -     -               
    SP3:                                                                          -           -                                             
    SP4:                    -     -     -                                         -                                                         
    SP5:                                                                          -           -     -     -                                 

    ECgene alternative splicing isoforms for ERCC1

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    ERCC1 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    ERCC1 Expression
    About this image

    ERCC1 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 6) fully expand
     Ovary (Reproductive System)    fully expand to see all 2 entries
             Ovarian Mesenchymal Stroma Cells Ovary Interstitium
     Brain (Nervous System)    fully expand to see all 2 entries
             Cerebral Cortex
     Trophoblast (Extraembryonic Tissues)
             Trophoblast Cells Trophoblast
     Pancreas (Endocrine System)
             Islets of Langerhans
     Testis (Reproductive System)
             Leydig Cells Testis Interstitium
    ERCC1 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    ERCC1 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.435981
        Pathway & Disease-focused RT2 Profiler PCR Arrays including ERCC1 (see all 7): 
              Lung Cancer in human mouse rat
              Insulin Signaling Pathway in human mouse rat
              DNA Damage Signaling Pathway in human mouse rat
              p53 Signaling Pathway in human mouse rat
              Telomeres & Telomerase in human mouse rat

    OriGene qPCR primer pairs and template standards for ERCC1
    OriGene qSTAR qPCR primer pairs in human, mouse for ERCC1
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ERCC1
    QuantiTect SYBR Green Assays in human, mouse, rat ERCC1
    QuantiFast Probe-based Assays in human, mouse, rat ERCC1
    In Situ
    Assay Products:

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ERCC1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for ERCC1 gene from Selected species (see all 19)    About this table
    Organism Taxonomic
    Gene Description Human
    (Mus musculus)
    Mammalia Ercc11 , 5 excision repair cross-complementing rodent repair deficiency, more1, 5 82.6(n)1
      7 (9.60 cM)5
    138701  NM_007948.21  NP_031974.21 
    (Anolis carolinensis)
    Reptilia --
    Uncharacterized protein
    many → 1
    many → 1
    African clawed frog
    (Xenopus laevis)
    Amphibia ercc1-prov2 excision repair cross-complementing rodent repair deficiency, more 75.59(n)    BC043824.1 
    (Danio rerio)
    Actinopterygii ercc11 excision repair cross-complementing rodent repair deficiency, more 68.52(n)
      100001425  NM_001103138.1  NP_001096608.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta Ercc11 , 3 nucleotide-excision repair
    single-stranded DNA more3
    366541  NM_058120.21  NP_477468.11 
    (Caenorhabditis elegans)
    Secernentea ercc-16
    Protein ERCC-1 (ercc-1) mRNA, complete cds
    1 ↔ 1
    I(10030172-10046760) WBGene00008665
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes RAD10(YML095C)4 Single-stranded DNA endonuclease (with Rad1p), cleaves more   --   13(82113-81481) 854878  NP_013614.1 
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons ERCC11 ERCC1 51.82(n)
      819685  NM_111394.4  NP_187172.1 
    (Oryza sativa)
    Liliopsida Os10g05189001 Os10g0518900 56.38(n)
      4349131  NM_001071612.1  NP_001065077.1 

    ENSEMBL Gene Tree for ERCC1 (if available)
    TreeFam Gene Tree for ERCC1 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to Build 68)
    About This Section

    TryGeneCards Plus

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for ERCC1 (see all 548)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    Chr 19 posSequence#AA
    Cerebro-oculo-facio-skeletal syndrome 4 (COFS4)4--see VAR_0327762 F L mis40--------
    Cuntested146112209(-) TCCCTA/GCCCCC 3 -- int10--------
    C,Funtested146113551(-) GGTGCA/GAGGAG 3 -- int10--------
    C--45914707(+) TGTCC-/ACCATTTGT
    2 -- int11Minor allele frequency- ACCATTTGTTATTGCCTGTCC:0.00NA 2
    C,F--45915502(+) ACCTCC/TGTCTC 2 -- int12Minor allele frequency- T:0.50WA CSA 4
    C,F--45918536(+) TGCAGG/TGAGCC 3 -- int11Minor allele frequency- T:0.50NA 2
    C--45918620(+) CCGGGC/TGTGGT 3 -- int11Minor allele frequency- T:0.50WA 2
    C,F--45921797(-) gccATA/CTCTCT 3 -- int14Minor allele frequency- C:0.11NS WA 276
    C,F,H--45921803(-) tgcctG/AgccAT 3 -- int15Minor allele frequency- A:0.01NS EA 570
    C,F--45924299(-) cattc-/ATTC  
    3 -- int16Minor allele frequency- ATTC:0.31NS MN 558

    HapMap Linkage Disequilibrium report for ERCC1 (45910591 - 45982086 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 5 variations for ERCC1:    About this table    
    Variant IDTypeSubtypePubMed ID
    nsv912154CNV Loss21882294
    nsv833845CNV Loss17160897
    nsv833846CNV Loss17160897
    nsv458711CNV Gain19166990
    nsv428365CNV Gain+Loss18775914

    Human Gene Mutation Database (HGMD): ERCC1
    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing ERCC1
    DNA2.0 Custom Variant and Variant Library Synthesis for ERCC1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 126380   
    OMIM disorders: 610758  
    UniProtKB/Swiss-Prot: ERCC1_HUMAN, P07992
  • Cerebro-oculo-facio-skeletal syndrome 4 (COFS4) [MIM:610758]: A disorder of prenatal onset characterized
    by microcephaly, congenital cataracts, facial dysmorphism, neurogenic arthrogryposis, growth failure and severe
    psychomotor retardation. COFS is considered to be part of the nucleotide-excision repair disorders spectrum that
    include also xeroderma pigmentosum, trichothiodystrophy and Cockayne syndrome. Note=The disease is caused by
    mutations affecting the gene represented in this entry

  • Selected diseases for ERCC1 (see all 88):    
    About MalaCards
    ercc1-related xeroderma pigmentosum    cerebrooculofacioskeletal syndrome 4    pancreas adenocarcinoma    peritoneal carcinoma
    xeroderma pigmentosum, group f    cerebro-oculo-facio-skeletal syndrome    primary peritoneal carcinoma    cheilitis
    actinic cheilitis    cockayne syndrome type ii    cockayne syndrome    thymic epithelial tumor
    xeroderma pigmentosum    squamous cell carcinoma of the head and neck    peritonitis    diffuse gastric cancer
    testicular cancer    progeria    esophageal cancer    lung cancer susceptibility

    6 diseases from the University of Copenhagen DISEASES database for ERCC1:
    Xeroderma pigmentosum     Lung cancer     Cockayne syndrome     Ovarian cancer
    Colorectal cancer     Carcinoma

    ERCC1 for disorders           About GeneDecksing

    Selected Novoseek inferred disease relationships for ERCC1 gene (see all 43)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    xeroderma pigmentosum 84.4 20 8972858 (1), 15358100 (1), 18635523 (1), 15709194 (1) (see all 18)
    nsclc 75.7 119 19538866 (5), 15764785 (4), 19799875 (4), 18804893 (4) (see all 52)
    cockayne syndrome 74.2 2 10910954 (1), 7596355 (1)
    cancer lung 67.7 61 17502833 (4), 12880561 (3), 18623378 (3), 16054657 (3) (see all 34)
    ovarian cancer 60.9 63 18756932 (6), 8040325 (4), 19832035 (3), 15375562 (3) (see all 28)
    nsclc metastatic 59.2 5 19733931 (2), 15277258 (1), 18823676 (1)
    trichothiodystrophy 57.9 1 7596355 (1)
    tumors 54.2 136 19488864 (5), 17606717 (5), 15095299 (4), 14614013 (3) (see all 80)
    cancer 51.1 58 15629453 (2), 17707593 (2), 19832035 (2), 17976974 (2) (see all 29)
    colorectal cancer 48.7 17 16224397 (3), 19020759 (3), 19194123 (3), 16144923 (2) (see all 7)

    GeneTests: ERCC1
    GeneReviews: ERCC1
    Genetic Association Database (GAD): ERCC1
    Human Genome Epidemiology (HuGE) Navigator: ERCC1 (195 documents)

    Export disorders for ERCC1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for ERCC1 gene, integrated from 10 sources (see all 695):
    (articles sorted by number of sources associating them with ERCC1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. ERCC1 polymorphism, expression and clinical outcome of oxaliplatin-based adjuvant chemotherapy in gastric cancer. (PubMed id 19009659)1, 4, 9 Huang Z.H....Zhou X.K. (World J. Gastroenterol. 2008)
    2. ERCC1 genotype and phenotype in epithelial ovarian cancer identify patients likely to benefit from paclitaxel treatment in addition to platinum-based therapy. (PubMed id 18024864)1, 4, 9 Smith S....Katsaros D. (J. Clin. Oncol. 2007)
    3. ERCC1 gene polymorphism as a predictor for clinical outcome in advanced colorectal cancer patients treated with platinum-based chemotherapy. (PubMed id 16224397)1, 4, 9 Park D.J....Lenz H.J. (amp 2003)
    4. A distinct ERCC1 haplotype is associated with mRNA expression levels in prostate cancer patients. (PubMed id 18332046)1, 4, 9 Woelfelschneider A....Schmezer P. (Carcinogenesis 2008)
    5. Crystal structure and DNA binding functions of ERCC1, a subunit of the DNA structure-specific endonuclease XPF-ERCC1. (PubMed id 16076955)1, 2, 9 Tsodikov O.V....Ellenberger T. (Proc. Natl. Acad. Sci. U.S.A. 2005)
    6. Effects of excision repair cross-complementation group 1 (ERCC1) single nucleotide polymorphisms on the prognosis of non-small cell lung cancer patients. (PubMed id 19361884)1, 4, 9 Takenaka T....Maehara Y. (Lung Cancer 2010)
    7. Prediction of response to chemotherapy by ERCC1 immunohistochemistry and ERCC1 polymorphism in ovarian cancer. (PubMed id 17961161)1, 4, 9 Steffensen K.D....Jakobsen A. (Int. J. Gynecol. Cancer 2008)
    8. Genotypes and haplotypes of ERCC1 and ERCC2/XPD genes predict levels of benzo[a]pyrene diol epoxide-induced DNA adducts in cultured primary lymphocytes from healthy individuals: a genotype-phenotype correlation analysis. (PubMed id 18635523)1, 4, 9 Zhao H....Wei Q. (Carcinogenesis 2008)
    9. Tagging single nucleotide polymorphisms in excision repair cross-complementing group 1 (ERCC1) and risk of primary lung cancer in a Chinese population. (PubMed id 17502833)1, 4, 9 Ma H....Lu D. (Pharmacogenet. Genomics 2007)
    10. Association between polymorphisms of ERCC1 and XPD and survival in non-small-cell lung cancer patients treated with cisplatin combination chemotherapy. (PubMed id 15140544)1, 4, 9 Ryu J.S....Hwang T.S. (Lung Cancer 2004)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
    Free Text  

      Query String
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 2067 HGNC: 3433 AceView: ERCC1 Ensembl:ENSG00000012061 euGenes: HUgn2067
    ECgene: ERCC1 Kegg: 2067 H-InvDB: ERCC1

    (According to HUGE)
    About This Section

    TryGeneCards Plus

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    PharmGKB entry for ERCC1 Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for ERCC1 Genetics and Cytogenetics in Oncology and Haematology

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for ERCC1 gene:
    Search GeneIP for patents involving ERCC1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search

    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     EMD Millipore genomic analysis products

     Antibodies for ERCC1 (ERCC1)   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for ERCC1   OriGene RNAi products in human, mouse, rat for ERCC1  
     OriGene qPCR primer pairs and template standards for ERCC1   OriGene Protein Over-expression Lysate for ERCC1  
     OriGene MassSpec something-or-other for ERCC1   OriGene clones in human, mouse for ERCC1  
     OriGene qSTAR qPCR primer pairs in human, mouse for ERCC1   OriGene Purified Protein for ERCC1  
     OriGene ORF clones in mouse, rat for ERCC1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for ERCC1   OriGene Custom Protein Services for ERCC1  

     Block miRNA regulation of human, mouse, rat ERCC1 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing ERCC1
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ERCC1 Predesigned siRNA for gene silencing in human, mouse, rat ERCC1
     QuantiFast Probe-based Assays in human, mouse, rat ERCC1 QuantiTect SYBR Green Assays in human, mouse, rat ERCC1
     PCR Arrays including human, mouse, rat ERCC1 Search Chromatin IP Primers for ERCC1
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ERCC1  GeneGlobe Interaction Network for ERCC1
     Regulatory tfbs in ERCC1 promoter
     GenScript Custom Purified and Recombinant Proteins Services for ERCC1 GenScript cDNA clones with any tag delivered in your preferred vector for ERCC1
     GenScript Custom Assay Services for ERCC1 GenScript Custom overexpressing Cell Line Services for ERCC1
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Antibodies & Assays for ERCC1 

     Search Tocris compounds for ERCC1
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     cDNA Clones for ERCC1
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     ERCC1 antibodies
     ERCC1 proteins
     ERCC1 lysates
     Antibodies for ERCC1
     See all of Abcam's Antibodies, Kits and Proteins for ERCC1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Recombinant Protein for ERCC1
     Proteins for ERCC1
     Antibodies for ERCC1
     ELISAs for ERCC1
     CLIAs for ERCC1

     Browse ESI BIO Cell Lines and PureStem Progenitors for ERCC1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ERCC1
     Browse SwitchGear 3'UTR luciferase reporter plasmids for ERCC1
     SwitchGear Promoter luciferase reporter plasmids for ERCC1
     ThermoFisher Antibody for ERCC1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ERCC1
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for ERCC1
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for ERCC1
     LSBio Antibodies in human, mouse, rat for ERCC1
    Customized transgenic rodents for:
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

    View Random Gene

    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 

    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      ERCC1 gene at Home site.
    Version: 3.12.166 28 Aug 2014
    hostname: index build: 126 solr: 1.4