Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

ERCC1 Gene

protein-coding   GIFtS: 70
GCID: GC19M045912

Excision Repair Cross-Complementing Rodent Repair Deficiency,...

Alzheimer's & Parkinson's Diseases Congress
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
Excision Repair Cross-Complementing Rodent Repair Deficiency,
Complementation Group 1 (Includes Overlapping Antisense Sequence)1 2
COFS42 5
UV202 5
RAD102
DNA Excision Repair Protein ERCC-12

External Ids:    HGNC: 34331   Entrez Gene: 20672   Ensembl: ENSG000000120617   OMIM: 1263805   UniProtKB: P079923   

Export aliases for ERCC1 gene to outside databases

Previous GC identifers: GC19M046556 GC19M046303 GC19M050586 GC19M050604 GC19M050602 GC19M042340


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for ERCC1 Gene:
The product of this gene functions in the nucleotide excision repair pathway, and is required for the repair of
DNA lesions such as those induced by UV light or formed by electrophilic compounds including cisplatin. The
encoded protein forms a heterodimer with the XPF endonuclease (also known as ERCC4), and the heterodimeric
endonuclease catalyzes the 5' incision in the process of excising the DNA lesion. The heterodimeric endonuclease
is also involved in recombinational DNA repair and in the repair of inter-strand crosslinks. Mutations in this
gene result in cerebrooculofacioskeletal syndrome, and polymorphisms that alter expression of this gene may play
a role in carcinogenesis. Multiple transcript variants encoding different isoforms have been found for this gene.
The last exon of this gene overlaps with the CD3e molecule, epsilon associated protein gene on the opposite
strand. (provided by RefSeq, Oct 2009)

GeneCards Summary for ERCC1 Gene: 
ERCC1 (excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)) is a protein-coding gene. Diseases associated with ERCC1 include ercc1-related xeroderma pigmentosum, and cerebrooculofacioskeletal syndrome 4, and among its related super-pathways are Global Genomic NER (GG-NER) and Nucleotide Excision Repair. GO annotations related to this gene include single-stranded DNA binding and protein domain specific binding.

UniProtKB/Swiss-Prot: ERCC1_HUMAN, P07992
Function: Structure-specific DNA repair endonuclease responsible for the 5'-incision during DNA repair

Gene Wiki entry for ERCC1 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000019.9  NT_011109.16  NC_018930.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the ERCC1 gene promoter:
         AP-1   ATF-2   c-Jun   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): ERCC1 promoter sequence
   Search SABiosciences Chromatin IP Primers for ERCC1

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ERCC1


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 19q13.32   Ensembl cytogenetic band:  19q13.32   HGNC cytogenetic band: 19q13.32

ERCC1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ERCC1 gene location

GeneLoc information about chromosome 19         GeneLoc Exon Structure

GeneLoc location for GC19M045912:  view genomic region     (about GC identifiers)

Start:
45,910,591 bp from pter      End:
45,982,086 bp from pter
Size:
71,496 bases      Orientation:
minus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: ERCC1_HUMAN, P07992 (See protein sequence)
Recommended Name: DNA excision repair protein ERCC-1  
Size: 297 amino acids; 32562 Da
Subunit: Heterodimer composed of ERCC1 and XPF/ERRC4
Subcellular location: Nucleus
5 PDB 3D structures from and Proteopedia for ERCC1:
1Z00 (3D)        2A1I (3D)        2A1J (3D)        2JNW (3D)        2JPD (3D)    
Secondary accessions: Q7Z7F5 Q96S40
Alternative splicing: 3 isoforms:  P07992-1   P07992-2   P07992-3   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for ERCC1: NX_P07992

Explore proteomics data for ERCC1 at MOPED 

Post-translational modifications:

  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_P07992

  • ERCC1 Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    ERCC1 Protein Expression
    REFSEQ proteins (3 alternative transcripts): 
    NP_001159521.1  NP_001974.1  NP_973730.1  

    ENSEMBL proteins: 
     ENSP00000300853   ENSP00000394875   ENSP00000345203   ENSP00000466644   ENSP00000468119  
     ENSP00000468035   ENSP00000013807   ENSP00000465354   ENSP00000465225   ENSP00000468548  
     ENSP00000467183   ENSP00000468158   ENSP00000465524  
    Reactome Protein details: P07992
    Human Recombinant Protein Products for ERCC1: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Proteins for ERCC1
    OriGene Protein Over-expression Lysate for ERCC1
    OriGene MassSpec for ERCC1 
    OriGene Custom Protein Services for ERCC1
    GenScript Custom Purified and Recombinant Proteins Services for ERCC1
    Novus Biologicals ERCC1 Proteins
    Novus Biologicals ERCC1 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    ProSpec Recombinant Protein for ERCC1
    Cloud-Clone Corp. Proteins for ERCC1 

    Gene Ontology (GO): 5/7 cellular component terms (GO ID links to tree view) (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000109nucleotide-excision repair complex IDA3290851
    GO:0000784nuclear chromosome, telomeric region IDA14690602
    GO:0005634nucleus IDA--
    GO:0005654nucleoplasm TAS--
    GO:0005669transcription factor TFIID complex IEA--

    ERCC1 for ontologies           About GeneDecksing



    ERCC1 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    R&D Systems Antibodies for ERCC1
    Cell Signaling Technology (CST) Antibodies for ERCC1 
    OriGene Antibodies for ERCC1
    OriGene Custom Antibody Services for ERCC1
    GenScript Custom Superior Antibodies Services for ERCC1
    Novus Biologicals ERCC1 Antibodies
    Abcam antibodies for ERCC1
    Cloud-Clone Corp. Antibodies for ERCC1 
    ThermoFisher Antibody for ERCC1
    LSBio Antibodies in human, mouse, rat for ERCC1 

    Assay Products for ERCC1: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for ERCC1
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for ERCC1
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for ERCC1 
    Cloud-Clone Corp. CLIAs for ERCC1


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    5 InterPro protein domains:
     IPR003583 Hlx-hairpin-Hlx_DNA-bd_motif
     IPR011335 Restrct_endonuc-II-like
     IPR004579 DNA_repair_Rad10
     IPR000445 HhH_motif
     IPR010994 RuvA_2-like

    Graphical View of Domain Structure for InterPro Entry P07992

    ProtoNet protein and cluster: P07992

    2 Blocks protein domains:
    IPB003583 Helix-hairpin-helix DNA-binding
    IPB004579 DNA repair protein rad10


    UniProtKB/Swiss-Prot: ERCC1_HUMAN, P07992
    Similarity: Belongs to the ERCC1/RAD10/SWI10 family


    ERCC1 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: ERCC1_HUMAN, P07992
    Function: Structure-specific DNA repair endonuclease responsible for the 5'-incision during DNA repair

         Genatlas biochemistry entry for ERCC1:
    excision repair cross-complementing rodent repair defect in CHO cells (includes overlapping antisense
    sequence),complementation group 1,yeast RAD10 homolog,specific for leukemic blasts

         Gene Ontology (GO): 5/11 molecular function terms (GO ID links to tree view) (see all 11):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000014contributes to single-stranded DNA endodeoxyribonuclease activity IDA7559382
    GO:0001094TFIID-class transcription factor binding IEA--
    GO:0003677DNA binding ----
    GO:0003684damaged DNA binding IDA17720715
    GO:0003697single-stranded DNA binding IDA16076955
         
    ERCC1 for ontologies           About GeneDecksing


    Phenotypes:
         2 GenomeRNAi human phenotypes for ERCC1:
     Decreased Hepatitis C virus re  Increased gamma-H2AX phosphory 

         15/17 MGI mutant phenotypes (inferred from 4 alleles(MGI details for Ercc1) (see all 17):
     adipose tissue  behavior/neurological  cellular  embryogenesis  endocrine/exocrine gland 
     growth/size  hematopoietic system  homeostasis/metabolism  immune system  integument 
     liver/biliary system  mortality/aging  muscle  renal/urinary system  reproductive system 

    ERCC1 for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-outs for ERCC1: Ercc1tm1Dwm Ercc1tm1Jhjh

       inGenious Targeting Laboratory - Custom generated mouse model solutions for ERCC1 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for ERCC1

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for ERCC1 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for ERCC1 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ERCC1
    Search QIAGEN for miScript miRNA Assays for microRNAs that regulate ERCC1
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for ERCC1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ERCC1

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for ERCC1
    Sirion Biotech Customized adenovirus for overexpression of ERCC1

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for ERCC1 (see all 20)
    OriGene ORF clones in mouse, rat for ERCC1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): ERCC1 (NM_001983)
    Sino Biological Human cDNA Clone for ERCC1
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ERCC1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ERCC1
    Sirion Biotech Customized lentivirus for stable overexpression of ERCC1 
                         Customized lentivirus expression plasmids for stable overexpression of ERCC1 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for ERCC1
    Search LifeMap BioReagents cell lines for ERCC1
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ERCC1


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for ERCC1 About   (see all 7)                                                                                              See pathways by source

    SuperPathContained pathways About
    1Global Genomic NER (GG-NER)
    Global Genomic NER (GG-NER)0.70
    Formation of incision complex in GG-NER0.61
    Nucleotide excision repair0.70
    Nucleotide Excision Repair Pathway0.49
    Dual incision reaction in GG-NER0.61
    2Nucleotide Excision Repair
    Nucleotide Excision Repair0.90
    DNA Repair0.46
    Transcription-coupled NER (TC-NER)0.90
    3Formation of RNA Pol II elongation complex
    Dual incision reaction in TC-NER0.64
    Formation of transcription-coupled NER (TC-NER) repair complex0.64
    4DNA Damage
    DNA Damage0.32
    Cell Cycle / Checkpoint Control0.32
    5Ifosfamide Pathway, Pharmacodynamics
    Cyclophosphamide Pathway, Pharmacodynamics0.72

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    2 Downloadable PowerPoint Slides of QIAGEN Pathway Central Maps for ERCC1
        DNA Repair Mechanisms
    Nucleotide Excision Repair Pathway

    2 Cell Signaling Technology (CST) Pathways for ERCC1
        Cell Cycle / Checkpoint Control
    DNA Damage


    5/8        Reactome Pathways for ERCC1 (see all 8)
        DNA Repair
    Transcription-coupled NER (TC-NER)
    Formation of transcription-coupled NER (TC-NER) repair complex
    Dual incision reaction in TC-NER
    Global Genomic NER (GG-NER)

    1 PharmGKB Pathway for ERCC1
        Cyclophosphamide Pathway, Pharmacodynamics

    2         Kegg Pathways  (Kegg details for ERCC1):
        Nucleotide excision repair
    Fanconi anemia pathway


    ERCC1 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for ERCC1

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/607 Interacting proteins for ERCC1 (P079921, 2, 3 ENSP000000138074) via UniProtKB, MINT, STRING, and/or I2D (see all 607)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    SLX4Q8IY921, 3, ENSP000002940084EBI-750962,EBI-2370740 I2D: score=2 STRING: ENSP00000294008
    SLX1AQ9BQ833, ENSP000002513034I2D: score=2 STRING: ENSP00000251303
    SLX1BQ9BQ833, ENSP000003289404I2D: score=2 STRING: ENSP00000328940
    XPAP230253, ENSP000003642704I2D: score=5 STRING: ENSP00000364270
    ERCC4Q928893, ENSP000003105204I2D: score=3 STRING: ENSP00000310520
    About this table

    Gene Ontology (GO): 5/33 biological process terms (GO ID links to tree view) (see all 33):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000718nucleotide-excision repair, DNA damage removal TAS--
    GO:0000720pyrimidine dimer repair by nucleotide-excision repair IEA--
    GO:0001302replicative cell aging IEA--
    GO:0006281DNA repair TAS--
    GO:0006283transcription-coupled nucleotide-excision repair TAS--

    ERCC1 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    ERCC1 for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for ERCC1

    10/42 Novoseek inferred chemical compound relationships for ERCC1 gene (see all 42)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    cisplatin 82.4 254 10810335 (7), 18756932 (6), 19626585 (6), 11163512 (6) (see all 97)
    oxaliplatin 77.4 30 19194123 (3), 18204222 (2), 19105824 (2), 15629453 (1) (see all 15)
    gemcitabine 75.3 52 18494946 (4), 20211060 (3), 19884554 (3), 19667277 (3) (see all 27)
    thymidylate 74.8 29 19051292 (2), 19194123 (2), 18565686 (2), 18507058 (1) (see all 22)
    irinotecan 67.6 5 12749725 (1), 17417781 (1), 18231104 (1), 19457654 (1) (see all 5)
    n-acetoxy-2-acetylaminofluorene 67.1 1 16882524 (1)
    5fluorouracil 62.3 27 9268987 (4), 18497992 (3), 15655543 (1), 9440758 (1) (see all 17)
    carboplatin 59.8 18 18977553 (3), 19667277 (3), 19884554 (2), 18494946 (2) (see all 11)
    vinorelbine 57.2 3 17417781 (1), 17166391 (1), 20082278 (1)
    platinum 57.1 41 19240185 (6), 18024864 (4), 18575867 (3), 19035454 (2) (see all 9)

    6 PharmGKB related drug/compound annotations for ERCC1 gene    About this table
    Drug/compound PharmGKB Annotation
    Platinum compoundsCA  
    carboplatinCA  
    cisplatinCA  
    cyclophosphamideCA  
    oxaliplatinCA  
    platinumCA  

    Search CenterWatch for drugs/clinical trials and news about ERCC1

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for ERCC1 gene (3 alternative transcripts): 
    NM_001166049.1  NM_001983.3  NM_202001.2  

    Unigene Cluster for ERCC1:

    Excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)
    Hs.435981  [show with all ESTs]
    Unigene Representative Sequence: NM_001983
    17 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000300853(uc002pbs.2) ENST00000423698(uc002pbu.2) ENST00000588738
    ENST00000340192(uc002pbt.2) ENST00000590701 ENST00000591636 ENST00000589165
    ENST00000013807(uc002pbv.3) ENST00000592410 ENST00000592444 ENST00000587888
    ENST00000589381 ENST00000592083 ENST00000592905 ENST00000592023 ENST00000588300
    ENST00000589214

    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ERCC1
    Search QIAGEN for miScript miRNA Assays for microRNAs that regulate ERCC1
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for ERCC1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ERCC1
    Clone
    Products:
         
    OriGene clones in human, mouse for ERCC1 (see all 20)
    OriGene ORF clones in mouse, rat for ERCC1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): ERCC1 (NM_001983)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ERCC1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ERCC1
    Sirion Biotech Customized lentivirus for stable overexpression of ERCC1 
                         Customized lentivirus expression plasmids for stable overexpression of ERCC1 
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for ERCC1
    OriGene qSTAR qPCR primer pairs in human, mouse for ERCC1
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat ERCC1
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ERCC1
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ERCC1

    Additional mRNA sequence: 

    AB069681.1 AF001925.1 AF433652.1 AK092039.1 AK314884.1 BC008930.2 BC052813.1 BT019806.1 
    M13194.1 M28650.1 S94539.1 

    20 DOTS entries:

    DT.100792041  DT.99949247  DT.215064  DT.80101937  DT.91686496  DT.121483494  DT.101960319  DT.40114141 
    DT.95256351  DT.97847780  DT.453132  DT.92444217  DT.100792038  DT.100721167  DT.80101939  DT.100792039 
    DT.100792040  DT.100792042  DT.121483560  DT.95099220 

    24/318 AceView cDNA sequences (see all 318):

    BG574302 CA390318 BM556010 BE831530 CR590512 AW013980 BQ574605 BE832630 
    BE831503 BQ278774 AW163286 AF001925 BU632118 BU625078 BE772403 C00084 
    BE772422 CA308883 BQ648919 CN482258 BM453702 BU786723 AA972775 BU789636 

    GeneLoc Exon Structure

    5/10 Alternative Splicing Database (ASD) splice patterns (SP) for ERCC1 (see all 10)    About this scheme

    ExUns: 1a · 1b · 1c · 1d ^ 2a · 2b · 2c · 2d ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9a · 9b ^ 10a · 10b · 10c ^ 11a · 11b
    SP1:                          -     -                                         -           -                       -     -               
    SP2:                          -     -                                         -           -     -     -           -     -               
    SP3:                                                                          -           -                                             
    SP4:                    -     -     -                                         -                                                         
    SP5:                                                                          -           -     -     -                                 


    ECgene alternative splicing isoforms for ERCC1

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    ERCC1 expression in normal human tissues (normalized intensities)      ERCC1 embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: GGCGGCTGCA
    ERCC1 Expression
    About this image


    ERCC1 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/34 selected tissues (see all 34) fully expand
     
     Epithelium
             vagina ; squamous epithelial cells   
     
     Uterus
             uterus, post-menopause ; glandular cells   
     
     Testis (Reproductive System)    fully expand to see all 4 entries
             Leydig Cells Testis Interstitium
             seminal vesicle ; glandular cells   
     
     Colon (Gastrointestinal Tract)    fully expand to see all 4 entries
             colon ; peripheral nerve/ganglion   
     
     Blood (Hematopoietic System)    fully expand to see all 3 entries
             Hematopoietic Stem Cells Hematopoietic Bone Marrow
             lung ; macrophages   
             bone marrow   

    See ERCC1 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for ERCC1

    SOURCE GeneReport for Unigene cluster: Hs.435981
        SABiosciences Expression via Pathway-Focused PCR Arrays including ERCC1 (see all 7): 
              Lung Cancer in human mouse rat
              Insulin Signaling Pathway in human mouse rat
              DNA Damage Signaling Pathway in human mouse rat
              p53 Signaling Pathway in human mouse rat
              Telomeres & Telomerase in human mouse rat

    Primer
    Products:
    OriGene qPCR primer pairs and template standards for ERCC1
    OriGene qSTAR qPCR primer pairs in human, mouse for ERCC1
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat ERCC1
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ERCC1
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ERCC1
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ERCC1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for ERCC1 gene from 9/20 species (see all 20)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Ercc11 , 5 excision repair cross-complementing rodent repair deficiency, more1, 5 82.6(n)1
    86.2(a)1
      7 (9.60 cM)5
    138701  NM_007948.21  NP_031974.21 
     193447785 
    lizard
    (Anolis carolinensis)
    Reptilia --
    --
    Uncharacterized protein
    68(a)
    51(a)
    many → 1
    many → 1
    GL343290.1(1358386-1358952)
    GL343868.1(159468-169285)
    African clawed frog
    (Xenopus laevis)
    Amphibia ercc1-prov2 excision repair cross-complementing rodent repair deficiency, more 75.59(n)    BC043824.1 
    zebrafish
    (Danio rerio)
    Actinopterygii ercc11 excision repair cross-complementing rodent repair deficiency, more 60.05(n)
    64.59(a)
      100001425  NM_001103138.1  NP_001096608.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta Ercc11 , 3 nucleotide-excision repair
    single-stranded DNA more3
    CG10215-PA1
    46(a)3
    51.65(n)1
    46.69(a)1
      51C53
    366541  NM_058120.21  NP_477468.11 
    worm
    (Caenorhabditis elegans)
    Secernentea ercc-16
    Protein ERCC-1
    26(a)
    1 ↔ 1
    I(10030172-10046760)
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes RAD10(YML095C)4 Single-stranded DNA endonuclease (with Rad1p), cleaves more   --   13(82113-81481) 854878  NP_013614.1 
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons ERCC11 DNA excision repair protein ERCC-1 50.36(n)
    46.74(a)
      819685  NM_111394.4  NP_187172.1 
    rice
    (Oryza sativa)
    Liliopsida Os10g05189001 hypothetical protein 50.12(n)
    44.33(a)
      4349131  NM_001071612.1  NP_001065077.1 


    ENSEMBL Gene Tree for ERCC1 (if available)
    TreeFam Gene Tree for ERCC1 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
      --

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/548 SNPs in ERCC1 are shown (see all 548)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 19 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0327764
    Cerebro-oculo-facio-skeletal syndrome 4 (COFS4)4--see VAR_0327762 F L mis40--------
    rs1048949901,2
    Cuntested146112209(-) TCCCTA/GCCCCC 3 -- int10--------
    rs1048949911,2
    C,Funtested146113551(-) GGTGCA/GAGGAG 3 -- int10--------
    rs601736641,2
    C--45914707(+) TGTCC-/ACCATTTGT
    TATTGCCTGTCC
    TTTGG
    2 -- int11Minor allele frequency- ACCATTTGTTATTGCCTGTCC:0.00NA 2
    rs1119233511,2
    C,F--45915502(+) ACCTCC/TGTCTC 2 -- int12Minor allele frequency- T:0.50WA CSA 4
    rs1133582711,2
    C,F--45918536(+) TGCAGG/TGAGCC 3 -- int11Minor allele frequency- T:0.50NA 2
    rs1130929871,2
    C--45918620(+) CCGGGC/TGTGGT 3 -- int11Minor allele frequency- T:0.50WA 2
    rs32129631,2
    C,F--45921797(-) gccATA/CTCTCT 3 -- int14Minor allele frequency- C:0.11NS WA 276
    rs32129621,2
    C,F,H--45921803(-) tgcctG/AgccAT 3 -- int15Minor allele frequency- A:0.01NS EA 570
    rs32129491,2
    C,F--45924299(-) cattc-/ATTC  
            
    attca
    3 -- int16Minor allele frequency- ATTC:0.31NS MN 558

    HapMap Linkage Disequilibrium report for ERCC1 (45910591 - 45982086 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 5 variations for ERCC1:    About this table     
    Variant IDTypeSubtypePubMed ID
    nsv912154CNV Loss21882294
    nsv833845CNV Loss17160897
    nsv833846CNV Loss17160897
    nsv458711CNV Gain19166990
    nsv428365CNV Gain+Loss18775914


    Human Gene Mutation Database (HGMD): ERCC1
    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing ERCC1
    DNA2.0 Custom Variant and Variant Library Synthesis for ERCC1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 126380   
    OMIM disorders: 610758  
    UniProtKB/Swiss-Prot: ERCC1_HUMAN, P07992
  • Cerebro-oculo-facio-skeletal syndrome 4 (COFS4) [MIM:610758]: A disorder of prenatal onset characterized
    by microcephaly, congenital cataracts, facial dysmorphism, neurogenic arthrogryposis, growth failure and severe
    psychomotor retardation. COFS is considered to be part of the nucleotide-excision repair disorders spectrum that
    include also xeroderma pigmentosum, trichothiodystrophy and Cockayne syndrome. Note=The disease is caused by
    mutations affecting the gene represented in this entry

  • 20/81 diseases for ERCC1 (see all 81):    About MalaCards
    ercc1-related xeroderma pigmentosum    cerebrooculofacioskeletal syndrome 4    primary peritoneal carcinoma    xeroderma pigmentosum, group f
    peritoneal carcinoma    cerebro-oculo-facio-skeletal syndrome    cheilitis    actinic cheilitis
    xeroderma pigmentosum    thymic epithelial tumor    pancreas adenocarcinoma    diffuse gastric cancer
    esophageal adenocarcinoma    progeria    testicular cancer    squamous cell carcinoma of the head and neck
    gallbladder cancer    esophageal cancer    lung cancer    adrenocortical carcinoma

    6 diseases from the University of Copenhagen DISEASES database for ERCC1:
    Xeroderma pigmentosum     Lung cancer     Cockayne syndrome     Ovarian cancer
    Colorectal cancer     Carcinoma

    ERCC1 for disorders           About GeneDecksing


    Congresses - knowledge worth sharing:  
    Alzheimer's & Parkinson's Diseases Congress (ADPD) 18 - 22 March 2015

    10/43 Novoseek inferred disease relationships for ERCC1 gene (see all 43)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    xeroderma pigmentosum 84.4 20 8972858 (1), 15358100 (1), 18635523 (1), 15709194 (1) (see all 18)
    nsclc 75.7 119 19538866 (5), 15764785 (4), 19799875 (4), 18804893 (4) (see all 52)
    cockayne syndrome 74.2 2 10910954 (1), 7596355 (1)
    cancer lung 67.7 61 17502833 (4), 12880561 (3), 18623378 (3), 16054657 (3) (see all 34)
    ovarian cancer 60.9 63 18756932 (6), 8040325 (4), 19832035 (3), 15375562 (3) (see all 28)
    nsclc metastatic 59.2 5 19733931 (2), 15277258 (1), 18823676 (1)
    trichothiodystrophy 57.9 1 7596355 (1)
    tumors 54.2 136 19488864 (5), 17606717 (5), 15095299 (4), 14614013 (3) (see all 80)
    cancer 51.1 58 15629453 (2), 17707593 (2), 19832035 (2), 17976974 (2) (see all 29)
    colorectal cancer 48.7 17 16224397 (3), 19020759 (3), 19194123 (3), 16144923 (2) (see all 7)

    GeneTests: ERCC1
    GeneReviews: ERCC1
    Genetic Association Database (GAD): ERCC1
    Human Genome Epidemiology (HuGE) Navigator: ERCC1 (195 documents)

    Export disorders for ERCC1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for ERCC1 gene, integrated from 9 sources (see all 674):
    (articles sorted by number of sources associating them with ERCC1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. ERCC1 polymorphism, expression and clinical outcome of oxaliplatin-based adjuvant chemotherapy in gastric cancer. (PubMed id 19009659)1, 4, 9 Huang Z.H....Zhou X.K. (2008)
    2. ERCC1 genotype and phenotype in epithelial ovarian cancer identify patients likely to benefit from paclitaxel treatment in addition to platinum-based therapy. (PubMed id 18024864)1, 4, 9 Smith S....Katsaros D. (2007)
    3. ERCC1 gene polymorphism as a predictor for clinical outcome in advanced colorectal cancer patients treated with platinum-based chemotherapy. (PubMed id 16224397)1, 4, 9 Park D.J....Lenz H.J. (2003)
    4. A distinct ERCC1 haplotype is associated with mRNA expression levels in prostate cancer patients. (PubMed id 18332046)1, 4, 9 Woelfelschneider A....Schmezer P. (2008)
    5. Effects of excision repair cross-complementation group 1 (ERCC1) single nucleotide polymorphisms on the prognosis of non-small cell lung cancer patients. (PubMed id 19361884)1, 4, 9 Takenaka T....Maehara Y. (2009)
    6. Genotypes and haplotypes of ERCC1 and ERCC2/XPD genes predict levels of benzo[a]pyrene diol epoxide-induced DNA adducts in cultured primary lymphocytes from healthy individuals: a genotype-phenotype correlation analysis. (PubMed id 18635523)1, 4, 9 Zhao H....Wei Q. (2008)
    7. Tagging single nucleotide polymorphisms in excision repair cross-complementing group 1 (ERCC1) and risk of primary lung cancer in a Chinese population. (PubMed id 17502833)1, 4, 9 Ma H....Lu D. (2007)
    8. Prediction of response to chemotherapy by ERCC1 immunohistochemistry and ERCC1 polymorphism in ovarian cancer. (PubMed id 17961161)1, 4, 9 Steffensen K.D....Jakobsen A. (2007)
    9. Association between polymorphisms of ERCC1 and XPD and survival in non-small-cell lung cancer patients treated with cisplatin combination chemotherapy. (PubMed id 15140544)1, 4, 9 Ryu J.S....Hwang T.S. (2004)
    10. Association between polymorphisms in DNA repair genes and survival of non-smoking female patients with lung adenocarcinoma. (PubMed id 20003463)1, 4, 9 Yin Z....Li X. (2009)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 2067 HGNC: 3433 AceView: ERCC1 Ensembl:ENSG00000012061 euGenes: HUgn2067
    ECgene: ERCC1 Kegg: 2067 H-InvDB: ERCC1

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for ERCC1 Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for ERCC1 Genetics and Cytogenetics in Oncology and Haematology
    NIEHS-SNPshttp://egp.gs.washington.edu/data/ercc1/

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for ERCC1 gene:
    Search GeneIP for patents involving ERCC1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Antibodies for ERCC1 (ERCC1)   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for ERCC1   OriGene RNAi products in human, mouse, rat for ERCC1  
     OriGene qPCR primer pairs and template standards for ERCC1   OriGene Protein Over-expression Lysate for ERCC1  
     OriGene MassSpec something-or-other for ERCC1   OriGene clones in human, mouse for ERCC1  
     OriGene qSTAR qPCR primer pairs in human, mouse for ERCC1   OriGene Purified Protein for ERCC1  
     OriGene ORF clones in mouse, rat for ERCC1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for ERCC1   OriGene Custom Protein Services for ERCC1  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat ERCC1
     QIAGEN SeqTarget long-range PCR primers for resequencing ERCC1
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ERCC1
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ERCC1
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ERCC1
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ERCC1
     GenScript Custom Purified and Recombinant Proteins Services for ERCC1 GenScript cDNA clones with any tag delivered in your preferred vector for ERCC1
     GenScript Custom Assay Services for ERCC1 GenScript Custom Superior Antibodies Services for ERCC1
     GenScript Custom overexpressing Cell Line Services for ERCC1 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Antibodies & Assays for ERCC1 

     Regulatory tfbs in ERCC1 promoter
     Search Chromatin IP Primers for ERCC1
     RT2 qPCR Primer Assay in human, mouse, rat ERCC1
     GNC Network for ERCC1
     SABiosciences PCR Arrays including human, mouse, rat ERCC1
     Search Tocris compounds for ERCC1
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     cDNA Clones for ERCC1
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     ERCC1 antibodies
     ERCC1 proteins
     ERCC1 lysates
     Antibodies for ERCC1
     See all of Abcam's Antibodies, Kits and Proteins for ERCC1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Recombinant Protein for ERCC1




     Proteins for ERCC1
     Antibodies for ERCC1
     ELISAs for ERCC1
     CLIAs for ERCC1
     Search LifeMap BioReagents cell lines for ERCC1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ERCC1
     Browse SwitchGear 3'UTR luciferase reporter plasmids for ERCC1
     SwitchGear Promoter luciferase reporter plasmids for ERCC1
     ThermoFisher Antibody for ERCC1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ERCC1
     inGenious Targeting Laboratory - Custom generated mouse model solutions for ERCC1
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for ERCC1
    Customized:
     lentivirus for stable overexpression of ERCC1
     lentivirus expression plasmids for stable overexpression of ERCC1
     adenovirus for overexpression of ERCC1
     LSBio Antibodies in human, mouse, rat for ERCC1
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 3 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      ERCC1 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4