Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ELOVL2 Gene

Aliases for ELOVL2 Gene

  • ELOVL Fatty Acid Elongase 2 2 3 4 5
  • Elongation Of Very Long Chain Fatty Acids (FEN1/Elo2, SUR4/Elo3, Yeast)-Like 2 2 3
  • Very Long Chain 3-Ketoacyl-CoA Synthase 2 3 4
  • Very Long Chain 3-Oxoacyl-CoA Synthase 2 3 4
  • 3-Keto Acyl-CoA Synthase ELOVL2 3 4
  • ELOVL FA Elongase 2 3 4
  • SSC2 3 4
  • Elongation Of Very Long Chain Fatty Acids Protein 2 3
  • EC 4

External Ids for ELOVL2 Gene

Previous GeneCards Identifiers for ELOVL2 Gene

  • GC06M011040
  • GC06M011088
  • GC06M010912

Summaries for ELOVL2 Gene

GeneCards Summary for ELOVL2 Gene

ELOVL2 (ELOVL Fatty Acid Elongase 2) is a Protein Coding gene. Among its related pathways are Metabolism and alpha-linolenic (omega3) and linoleic (omega6) acid metabolism. GO annotations related to this gene include transferase activity, transferring acyl groups other than amino-acyl groups and fatty acid elongase activity. An important paralog of this gene is ELOVL5.

UniProtKB/Swiss-Prot for ELOVL2 Gene

  • Catalyzes the first and rate-limiting reaction of the four that constitute the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process, allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids/VLCFAs per cycle. Acts specifically toward polyunsaturated acyl-CoA with the higher activity toward C20:4(n-6) acyl-CoA. Condensing enzyme that catalyzes the synthesis of polyunsaturated very long chain fatty acid (C20- and C22-PUFA). May participate in the production of polyunsaturated VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators.

No data available for Entrez Gene Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ELOVL2 Gene

Genomics for ELOVL2 Gene

Regulatory Elements for ELOVL2 Gene

Enhancers for ELOVL2 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH06F011010 0.8 Ensembl ENCODE 12 +32.4 32415 3.3 ATF1 MLX ZFP64 ARID4B SIN3A DMAP1 YY1 SLC30A9 SP5 MIER2 ELOVL2-AS1 SYCP2L ELOVL2 GCM2 ENSG00000235051 LOC100421248 LOC101928191
GH06F011007 1.2 Ensembl ENCODE 11.3 +35.8 35815 3.0 ELF3 MLX ARID4B SIN3A DMAP1 DNMT3B THRB ZSCAN9 RARA GATA4 ELOVL2-AS1 ELOVL2 SYCP2L LOC100421248 LOC101928191
GH06F010954 0.6 ENCODE 11.1 +89.7 89669 0.2 ATF1 MLX WRNIP1 ARID4B ZNF2 ZNF48 YY1 ZNF143 YY2 SP5 ELOVL2 ELOVL2-AS1 SYCP2L GCM2 ENSG00000235051 LOC101928191 LOC100421248
GH06F011066 0.4 ENCODE 11 -22.9 -22889 1.8 ATF1 MLX ARID4B YY1 SLC30A9 SP5 PPARG KAT8 NFIL3 MBD2 ELOVL2 ELOVL2-AS1 GCM2 SYCP2L ENSG00000235051 GC06P011100 PIR60223 PIR31848
GH06F010951 1.1 Ensembl ENCODE 10.8 +92.4 92425 0.7 CTCF MXI1 SAP130 ARID4B ZSCAN9 RAD21 HBP1 RFX5 TEAD3 GATAD1 ELOVL2 ELOVL2-AS1 SYCP2L LOC101928191 GC06M010903
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around ELOVL2 on UCSC Golden Path with GeneCards custom track

Promoters for ELOVL2 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00001210866 191 1201 ZNF133 ARID4B SIN3A GLI4 ZNF2 ZNF48 ZNF766 GLIS2 CBX5 ZNF143

Genomic Location for ELOVL2 Gene

10,980,759 bp from pter
11,044,391 bp from pter
63,633 bases
Minus strand

Genomic View for ELOVL2 Gene

Genes around ELOVL2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ELOVL2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ELOVL2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ELOVL2 Gene

Proteins for ELOVL2 Gene

  • Protein details for ELOVL2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Elongation of very long chain fatty acids protein 2
    Protein Accession:
    Secondary Accessions:
    • Q6P9E1
    • Q86W94

    Protein attributes for ELOVL2 Gene

    296 amino acids
    Molecular mass:
    34585 Da
    Quaternary structure:
    No Data Available

neXtProt entry for ELOVL2 Gene

Post-translational modifications for ELOVL2 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for ELOVL2 Gene

No data available for DME Specific Peptides for ELOVL2 Gene

Domains & Families for ELOVL2 Gene

Protein Domains for ELOVL2 Gene

Suggested Antigen Peptide Sequences for ELOVL2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • The C-terminal di-lysine motif may confer endoplasmic reticulum localization.
  • Belongs to the ELO family. ELOVL2 subfamily.
  • The C-terminal di-lysine motif may confer endoplasmic reticulum localization.
  • Belongs to the ELO family. ELOVL2 subfamily.
genes like me logo Genes that share domains with ELOVL2: view

No data available for Gene Families for ELOVL2 Gene

Function for ELOVL2 Gene

Molecular function for ELOVL2 Gene

UniProtKB/Swiss-Prot CatalyticActivity:
A very-long-chain acyl-CoA + malonyl-CoA = CoA + a very-long-chain 3-oxoacyl-CoA + CO(2).
UniProtKB/Swiss-Prot Function:
Catalyzes the first and rate-limiting reaction of the four that constitute the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process, allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids/VLCFAs per cycle. Acts specifically toward polyunsaturated acyl-CoA with the higher activity toward C20:4(n-6) acyl-CoA. Condensing enzyme that catalyzes the synthesis of polyunsaturated very long chain fatty acid (C20- and C22-PUFA). May participate in the production of polyunsaturated VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators.

Enzyme Numbers (IUBMB) for ELOVL2 Gene

Gene Ontology (GO) - Molecular Function for ELOVL2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 20937905
GO:0009922 fatty acid elongase activity TAS --
GO:0016740 transferase activity IEA --
GO:0016747 transferase activity, transferring acyl groups other than amino-acyl groups IEA --
GO:0102336 3-oxo-arachidoyl-CoA synthase activity IEA --
genes like me logo Genes that share ontologies with ELOVL2: view

Phenotypes for ELOVL2 Gene

genes like me logo Genes that share phenotypes with ELOVL2: view

Animal Model Products

  • Taconic Biosciences Mouse Models for ELOVL2

miRNA for ELOVL2 Gene

miRTarBase miRNAs that target ELOVL2

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for ELOVL2 Gene

Localization for ELOVL2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ELOVL2 Gene

Endoplasmic reticulum membrane; Multi-pass membrane protein.

Subcellular locations from

Jensen Localization Image for ELOVL2 Gene COMPARTMENTS Subcellular localization image for ELOVL2 gene
Compartment Confidence
endoplasmic reticulum 5
cytosol 1
extracellular 1
golgi apparatus 1
mitochondrion 1
nucleus 1
plasma membrane 1

Gene Ontology (GO) - Cellular Components for ELOVL2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005783 endoplasmic reticulum IDA 20937905
GO:0005789 endoplasmic reticulum membrane TAS --
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
GO:0030176 integral component of endoplasmic reticulum membrane IBA --
genes like me logo Genes that share ontologies with ELOVL2: view

Pathways & Interactions for ELOVL2 Gene

genes like me logo Genes that share pathways with ELOVL2: view

UniProtKB/Swiss-Prot Q9NXB9-ELOV2_HUMAN

  • Pathway: Lipid metabolism; polyunsaturated fatty acid biosynthesis.

Gene Ontology (GO) - Biological Process for ELOVL2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006629 lipid metabolic process IEA --
GO:0006631 fatty acid metabolic process IEA --
GO:0006633 fatty acid biosynthetic process IEA --
GO:0006636 unsaturated fatty acid biosynthetic process IEA --
GO:0019367 fatty acid elongation, saturated fatty acid IBA --
genes like me logo Genes that share ontologies with ELOVL2: view

No data available for SIGNOR curated interactions for ELOVL2 Gene

Drugs & Compounds for ELOVL2 Gene

(4) Drugs for ELOVL2 Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Carbon dioxide Approved, Vet_approved Pharma 0
Acetoacetyl-CoA Experimental Pharma 0
malonyl-coa Experimental Pharma 0
Coenzyme A Nutra 0

(1) Additional Compounds for ELOVL2 Gene - From: HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • (S)-3-hydroxyhexadecanoyl-coenzyme A
  • (S)-3-hydroxypalmitoyl-coenzyme A
  • b-Hydroxypalmitoyl-CoA
  • b-Hydroxypalmitoyl-Coenzyme A
  • beta-Hydroxypalmitoyl-CoA
genes like me logo Genes that share compounds with ELOVL2: view

Transcripts for ELOVL2 Gene

mRNA/cDNA for ELOVL2 Gene

Unigene Clusters for ELOVL2 Gene

ELOVL fatty acid elongase 2:
Representative Sequences:

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for ELOVL2 Gene

No ASD Table

Relevant External Links for ELOVL2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for ELOVL2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for ELOVL2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for ELOVL2 Gene

This gene is overexpressed in Brain - Spinal cord (cervical c-1) (x6.2), Brain - Nucleus accumbens (basal ganglia) (x4.5), and Liver (x4.0).

Protein differential expression in normal tissues from HIPED for ELOVL2 Gene

This gene is overexpressed in Breast (32.4), Fetal testis (27.4), and Fetal Liver (9.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for ELOVL2 Gene

Protein tissue co-expression partners for ELOVL2 Gene

NURSA nuclear receptor signaling pathways regulating expression of ELOVL2 Gene:


SOURCE GeneReport for Unigene cluster for ELOVL2 Gene:


mRNA Expression by UniProt/SwissProt for ELOVL2 Gene:

Tissue specificity: Liver and testis.
genes like me logo Genes that share expression patterns with ELOVL2: view

Primer Products

Orthologs for ELOVL2 Gene

This gene was present in the common ancestor of animals.

Orthologs for ELOVL2 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia ELOVL2 34 35
  • 99.44 (n)
(Canis familiaris)
Mammalia ELOVL2 34 35
  • 89.25 (n)
(Bos Taurus)
Mammalia ELOVL2 34 35
  • 87.07 (n)
(Mus musculus)
Mammalia Elovl2 34 16 35
  • 85.39 (n)
(Rattus norvegicus)
Mammalia Elovl2 34
  • 84.71 (n)
(Monodelphis domestica)
Mammalia ELOVL2 35
  • 84 (a)
(Ornithorhynchus anatinus)
Mammalia ELOVL2 35
  • 83 (a)
(Gallus gallus)
Aves ELOVL2 34 35
  • 75.9 (n)
(Anolis carolinensis)
Reptilia ELOVL2 35
  • 78 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia elovl2 34
  • 71.96 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.16695 34
(Danio rerio)
Actinopterygii elovl2 34 35
  • 67.44 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG6921 36
  • 36 (a)
Elo68alpha 35
  • 36 (a)
Elo68beta 35
  • 35 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 33 (a)
Species where no ortholog for ELOVL2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for ELOVL2 Gene

Gene Tree for ELOVL2 (if available)
Gene Tree for ELOVL2 (if available)

Paralogs for ELOVL2 Gene

Paralogs for ELOVL2 Gene

(4) SIMAP similar genes for ELOVL2 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with ELOVL2: view

Variants for ELOVL2 Gene

Sequence variations from dbSNP and Humsavar for ELOVL2 Gene

SNP ID Clin Chr 06 pos Sequence Context AA Info Type
rs10456358 -- 11,027,719(+) ATAAG(A/G)AAATT intron-variant
rs10456359 -- 11,030,547(+) AGTGC(A/C)GTGGC intron-variant
rs10498676 -- 11,026,766(+) TTGCC(A/G)TCTGT intron-variant
rs111257381 -- 10,984,265(+) CACCC(A/G)CCTCG intron-variant
rs111318368 -- 11,037,171(+) GAGAC(-/AA/AGAGAGGCAGAGAGGGAAAG)GAGAG intron-variant

Structural Variations from Database of Genomic Variants (DGV) for ELOVL2 Gene

Variant ID Type Subtype PubMed ID
esv2661047 CNV deletion 23128226
esv2665577 CNV deletion 23128226
esv2731587 CNV deletion 23290073
esv2731588 CNV deletion 23290073
esv2731589 CNV deletion 23290073
esv2731590 CNV deletion 23290073
esv3567273 CNV deletion 23714750
nsv1073958 CNV deletion 25765185
nsv1074909 CNV deletion 25765185
nsv1114779 CNV deletion 24896259
nsv1135959 CNV deletion 24896259
nsv1151471 CNV deletion 26484159
nsv5198 CNV insertion 18451855

Variation tolerance for ELOVL2 Gene

Residual Variation Intolerance Score: 45.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.59; 30.61% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for ELOVL2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ELOVL2 Gene

Disorders for ELOVL2 Gene

Relevant External Links for ELOVL2

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for ELOVL2 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for ELOVL2 Gene

Publications for ELOVL2 Gene

  1. Identification and expression of mammalian long-chain PUFA elongation enzymes. (PMID: 12371743) Leonard A.E. … Huang Y.-S. (Lipids 2002) 2 3 4 64
  2. Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (PMID: 22359512) Demirkan A. … Schmitz G. (PLoS Genet. 2012) 3 46 64
  3. Genetic loci associated with plasma phospholipid n-3 fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium. (PMID: 21829377) Lemaitre R.N. … Steffen L.M. (PLoS Genet. 2011) 3 46 64
  4. Human metabolic individuality in biomedical and pharmaceutical research. (PMID: 21886157) Suhre K. … Gieger C. (Nature 2011) 3 46 64
  5. A genome-wide perspective of genetic variation in human metabolism. (PMID: 20037589) Illig T. … Suhre K. (Nat. Genet. 2010) 3 46 64

Products for ELOVL2 Gene

Sources for ELOVL2 Gene

Loading form....