Free for academic non-profit institutions. Other users need a Commercial license

Aliases for EIF3G Gene

Aliases for EIF3G Gene

  • Eukaryotic Translation Initiation Factor 3, Subunit G 2 3
  • EIF3S4 3 4 6
  • Eukaryotic Translation Initiation Factor 3, Subunit 4 Delta, 44kDa 2 3
  • Eukaryotic Translation Initiation Factor 3 RNA-Binding Subunit 3 4
  • Eukaryotic Translation Initiation Factor 3 Subunit 4 3 4
  • EIF-3 RNA-Binding Subunit 3 4
  • EIF-3-Delta 3 4
  • EIF3 P42 3 4
  • EIF3 P44 3 4
  • Eukaryotic Translation Initiation Factor 3, Subunit 4 (Delta, 44kD) 3
  • Eukaryotic Translation Initiation Factor 3 Subunit P42 3
  • Eukaryotic Translation Initiation Factor 3 Subunit G 3
  • EIF3-Delta 3
  • EIF3-P42 3
  • EIF3-P44 3
  • EIF3g 4

External Ids for EIF3G Gene

Previous HGNC Symbols for EIF3G Gene

  • EIF3S4

Previous GeneCards Identifiers for EIF3G Gene

  • GC19M010091
  • GC19M010225
  • GC19M009806

Summaries for EIF3G Gene

GeneCards Summary for EIF3G Gene

EIF3G (Eukaryotic Translation Initiation Factor 3, Subunit G) is a Protein Coding gene. Among its related pathways are p70S6K Signaling and Apoptotic Pathways in Synovial Fibroblasts. GO annotations related to this gene include nucleotide binding and translation initiation factor activity.

UniProtKB/Swiss-Prot for EIF3G Gene

  • Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S preinitiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation. This subunit can bind 18S rRNA

Gene Wiki entry for EIF3G Gene

No data available for Entrez Gene Summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for EIF3G Gene

Genomics for EIF3G Gene

Regulatory Elements for EIF3G Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for EIF3G Gene

10,115,014 bp from pter
10,119,923 bp from pter
4,910 bases
Minus strand

Genomic View for EIF3G Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for EIF3G Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for EIF3G Gene

Proteins for EIF3G Gene

  • Protein details for EIF3G Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Eukaryotic translation initiation factor 3 subunit G
    Protein Accession:
    Secondary Accessions:
    • O14801
    • Q969U5

    Protein attributes for EIF3G Gene

    320 amino acids
    Molecular mass:
    35611 Da
    Quaternary structure:
    • Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is composed of 13 subunits: EIF3A, EIF3B, EIF3C, EIF3D, EIF3E, EIF3F, EIF3G, EIF3H, EIF3I, EIF3J, EIF3K, EIF3L and EIF3M. The eIF-3 complex appears to include 3 stable modules: module A is composed of EIF3A, EIF3B, EIF3G and EIF3I; module B is composed of EIF3F, EIF3H, and EIF3M; and module C is composed of EIF3C, EIF3D, EIF3E, EIF3K and EIF3L. EIF3C of module C binds EIF3B of module A and EIF3H of module B, thereby linking the three modules. EIF3J is a labile subunit that binds to the eIF-3 complex via EIF3B. The eIF-3 complex interacts with RPS6KB1 under conditions of nutrient depletion. Mitogenic stimulation leads to binding and activation of a complex composed of MTOR and RPTOR, leading to phosphorylation and release of RPS6KB1 and binding of EIF4B to eIF-3. Interacts (via C-terminus) with AIFM1 (via N-terminus).

    Three dimensional structures from OCA and Proteopedia for EIF3G Gene

neXtProt entry for EIF3G Gene

Proteomics data for EIF3G Gene at MOPED

Post-translational modifications for EIF3G Gene

  • Phosphorylated. Phosphorylation is enhanced upon serum stimulation.
  • Ubiquitination at Lys65 and Lys180
  • Modification sites at PhosphoSitePlus

Other Protein References for EIF3G Gene

No data available for DME Specific Peptides for EIF3G Gene

Domains for EIF3G Gene

Gene Families for EIF3G Gene

  • RBM :RNA binding motif (RRM) containing

Protein Domains for EIF3G Gene

Suggested Antigen Peptide Sequences for EIF3G Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • O75821
  • Contains 1 RRM (RNA recognition motif) domain.
  • Belongs to the eIF-3 subunit G family.
genes like me logo Genes that share domains with EIF3G: view

Function for EIF3G Gene

Molecular function for EIF3G Gene

UniProtKB/Swiss-Prot Function: Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S preinitiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation. This subunit can bind 18S rRNA

Gene Ontology (GO) - Molecular Function for EIF3G Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000166 nucleotide binding IEA --
GO:0003676 nucleic acid binding --
GO:0003743 contributes_to translation initiation factor activity IDA 17581632
GO:0005515 protein binding IPI 14688252
GO:0044822 poly(A) RNA binding IDA 22658674
genes like me logo Genes that share ontologies with EIF3G: view
genes like me logo Genes that share phenotypes with EIF3G: view

Animal Model Products

CRISPR Products

miRNA for EIF3G Gene

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for EIF3G

In Situ Assay Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targeting and HOMER Transcription for EIF3G Gene

Localization for EIF3G Gene

Subcellular locations from UniProtKB/Swiss-Prot for EIF3G Gene

Cytoplasm. Nucleus. Cytoplasm, perinuclear region. Note=Colocalizes with AIFM1 in the nucleus and perinuclear region.

Subcellular locations from

Jensen Localization Image for EIF3G Gene COMPARTMENTS Subcellular localization image for EIF3G gene
Compartment Confidence
nucleus 5
cytosol 4

Gene Ontology (GO) - Cellular Components for EIF3G Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 NOT nucleus IDA 12426392
GO:0005737 cytoplasm IDA --
GO:0005829 cytosol TAS --
GO:0005852 eukaryotic translation initiation factor 3 complex IDA 17322308
GO:0016282 eukaryotic 43S preinitiation complex IEA --
genes like me logo Genes that share ontologies with EIF3G: view

Pathways for EIF3G Gene

genes like me logo Genes that share pathways with EIF3G: view

Pathways by source for EIF3G Gene

2 Qiagen pathways for EIF3G Gene
1 BioSystems pathway for EIF3G Gene

Gene Ontology (GO) - Biological Process for EIF3G Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001731 formation of translation preinitiation complex IEA --
GO:0006412 translation TAS --
GO:0006413 translational initiation TAS --
GO:0006446 regulation of translational initiation IEA --
GO:0010467 gene expression TAS --
genes like me logo Genes that share ontologies with EIF3G: view

Transcripts for EIF3G Gene

Unigene Clusters for EIF3G Gene

Eukaryotic translation initiation factor 3, subunit G:
Representative Sequences:

CRISPR Products

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for EIF3G

Primer Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for EIF3G Gene

ExUns: 1a · 1b · 1c · 1d ^ 2 ^ 3a · 3b · 3c · 3d ^ 4a · 4b ^ 5a · 5b ^ 6 ^ 7a · 7b ^ 8a · 8b · 8c · 8d ^ 9a · 9b · 9c ^ 10a · 10b ^ 11a ·
SP1: - - - - - -
SP2: - - - - - -
SP3: - - - - - - -
SP4: - - -
SP5: - - - - - -
SP6: - - - -
SP7: - - - -
SP8: - - -
SP9: - - - -
SP10: -
SP11: - - -
SP12: - -
SP13: - -

ExUns: 11b ^ 12

Relevant External Links for EIF3G Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for EIF3G Gene

mRNA expression in normal human tissues for EIF3G Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Integrated Proteomics: protein expression from ProteomicsDB, PaxDb, MOPED, and MaxQB for EIF3G Gene

SOURCE GeneReport for Unigene cluster for EIF3G Gene Hs.529059

genes like me logo Genes that share expressions with EIF3G: view

In Situ Assay Products

No data available for mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for EIF3G Gene

Orthologs for EIF3G Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for EIF3G Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia EIF3G 35
  • 99.48 (n)
  • 100 (a)
EIF3G 36
  • 100 (a)
(Bos Taurus)
Mammalia EIF3G 35
  • 92.6 (n)
  • 99.37 (a)
EIF3G 36
  • 100 (a)
(Canis familiaris)
Mammalia EIF3G 35
  • 91.67 (n)
  • 99.37 (a)
EIF3G 36
  • 99 (a)
(Mus musculus)
Mammalia Eif3g 35
  • 89.17 (n)
  • 98.44 (a)
Eif3g 16
Eif3g 36
  • 98 (a)
(Monodelphis domestica)
Mammalia -- 36
  • 87 (a)
-- 36
  • 60 (a)
(Ornithorhynchus anatinus)
Mammalia EIF3G 36
  • 88 (a)
(Rattus norvegicus)
Mammalia Eif3g 35
  • 88.75 (n)
  • 98.44 (a)
(Gallus gallus)
Aves EIF3G 35
  • 85.93 (n)
  • 94.44 (a)
(Anolis carolinensis)
Reptilia EIF3G 36
  • 82 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia eif3s4 35
  • 74.87 (n)
  • 85.44 (a)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.9507 35
(Danio rerio)
Actinopterygii -- 35
eif3g 35
  • 78.01 (n)
  • 88.32 (a)
eif3g 36
  • 88 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta EIF3G_ANOGA 35
  • 56.77 (n)
  • 48.5 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG10881 35
  • 57.28 (n)
  • 48.57 (a)
CG10881 36
  • 47 (a)
CG8636 36
  • 48 (a)
(Caenorhabditis elegans)
Secernentea eif-3.G 35
  • 49.92 (n)
  • 40.93 (a)
eif-3.G 36
  • 38 (a)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_ADR189W 35
  • 47.6 (n)
  • 36.21 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes TIF35 35
  • 43.9 (n)
  • 36.63 (a)
TIF35 36
  • 33 (a)
TIF35 38
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0B00847g 35
  • 47.16 (n)
  • 39.83 (a)
(Oryza sativa)
Liliopsida Os02g0788400 35
  • 53.77 (n)
  • 49.57 (a)
bread mold
(Neurospora crassa)
Ascomycetes NCU08046 35
  • 54.39 (n)
  • 45.34 (a)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes tif35 35
  • 50.5 (n)
  • 46.35 (a)
Species with no ortholog for EIF3G:
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for EIF3G Gene

Gene Tree for EIF3G (if available)
Gene Tree for EIF3G (if available)

Paralogs for EIF3G Gene

genes like me logo Genes that share paralogs with EIF3G: view

No data available for Paralogs for EIF3G Gene

Variants for EIF3G Gene

Sequence variations from dbSNP and Humsavar for EIF3G Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type MAF
rs870612 -- 10,120,814(+) AAAAA(A/C)GAAAA upstream-variant-2KB
rs2001657 -- 10,120,461(-) tcccg(C/G)ctcag upstream-variant-2KB
rs2290687 -- 10,118,845(+) CCCCA(C/T)TCCCT intron-variant
rs3217685 -- 10,119,078(+) GCAGT(-/CCTCACTCACCTCCCGGCAGT)AGCTC intron-variant
rs3826784 other 10,116,334(+) GGGGC(A/G)GCAGC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for EIF3G Gene

Variant ID Type Subtype PubMed ID
nsv833743 CNV Loss 17160897
nsv911028 CNV Loss 21882294

Relevant External Links for EIF3G Gene

HapMap Linkage Disequilibrium report
Human Gene Mutation Database (HGMD)

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for EIF3G Gene

Disorders for EIF3G Gene

No disorders were found for EIF3G Gene.

No data available for UniProtKB/Swiss-Prot for EIF3G Gene

Publications for EIF3G Gene

  1. Characterization of cDNAs encoding the p44 and p35 subunits of human translation initiation factor eIF3. (PMID: 9822659) Block K.L. … Hershey J.W.B. (J. Biol. Chem. 1998) 2 3 4 23
  2. Cloning and characterization of the p42 subunit of mammalian translation initiation factor 3 (eIF3): demonstration that eIF3 interacts with eIF5 in mammalian cells. (PMID: 9973622) Bandyopadhyay A. … Maitra U. (Nucleic Acids Res. 1999) 3 4
  3. Characterization of eIF3k: a newly discovered subunit of mammalian translation initiation factor eIF3. (PMID: 14519125) Mayeur G.L. … Hershey J.W.B. (Eur. J. Biochem. 2003) 3 4
  4. The j-subunit of human translation initiation factor eIF3 is required for the stable binding of eIF3 and its subcomplexes to 40 S ribosomal subunits in vitro. (PMID: 14688252) Fraser C.S. … Hershey J.W.B. (J. Biol. Chem. 2004) 3 4
  5. Apoptosis-inducing factor (AIF) inhibits protein synthesis by interacting with the eukaryotic translation initiation factor 3 subunit p44 (eIF3g). (PMID: 17094969) Kim J.T. … Lim J.S. (FEBS Lett. 2006) 3 4

Products for EIF3G Gene

Sources for EIF3G Gene

Back to Top
