Free for academic non-profit institutions. Other users need a Commercial license

Aliases for EIF3G Gene

Aliases for EIF3G Gene

  • Eukaryotic Translation Initiation Factor 3 Subunit G 2 3 5
  • Eukaryotic Translation Initiation Factor 3, Subunit 4 Delta, 44kDa 2 3
  • Eukaryotic Translation Initiation Factor 3 RNA-Binding Subunit 3 4
  • Eukaryotic Translation Initiation Factor 3, Subunit G 2 3
  • Eukaryotic Translation Initiation Factor 3 Subunit 4 3 4
  • EIF-3 RNA-Binding Subunit 3 4
  • EIF-3-Delta 3 4
  • EIF3 P42 3 4
  • EIF3 P44 3 4
  • EIF3S4 3 4
  • Eukaryotic Translation Initiation Factor 3, Subunit 4 (Delta, 44kD) 3
  • Eukaryotic Translation Initiation Factor 3 Subunit P42 3
  • EIF3-Delta 3
  • EIF3-P42 3
  • EIF3-P44 3
  • EIF3g 4

External Ids for EIF3G Gene

Previous HGNC Symbols for EIF3G Gene

  • EIF3S4

Previous GeneCards Identifiers for EIF3G Gene

  • GC19M010091
  • GC19M010225
  • GC19M009806

Summaries for EIF3G Gene

GeneCards Summary for EIF3G Gene

EIF3G (Eukaryotic Translation Initiation Factor 3 Subunit G) is a Protein Coding gene. Diseases associated with EIF3G include parainfluenza virus type 3. Among its related pathways are Gene Expression and Transport to the Golgi and subsequent modification. GO annotations related to this gene include nucleic acid binding and nucleotide binding.

UniProtKB/Swiss-Prot for EIF3G Gene

  • Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation. This subunit can bind 18S rRNA. In case of FCV infection, plays a role in the ribosomal termination-reinitiation event leading to the translation of VP2 (PubMed:18056426).

Gene Wiki entry for EIF3G Gene

No data available for Entrez Gene Summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for EIF3G Gene

Genomics for EIF3G Gene

Regulatory Elements for EIF3G Gene

Promoters for EIF3G Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around EIF3G on UCSC Golden Path with GeneCards custom track

Genomic Location for EIF3G Gene

Chromosome:
19
Start:
10,115,014 bp from pter
End:
10,119,923 bp from pter
Size:
4,910 bases
Orientation:
Minus strand

Genomic View for EIF3G Gene

Genes around EIF3G on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
EIF3G Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for EIF3G Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for EIF3G Gene

Proteins for EIF3G Gene

  • Protein details for EIF3G Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O75821-EIF3G_HUMAN
    Recommended name:
    Eukaryotic translation initiation factor 3 subunit G
    Protein Accession:
    O75821
    Secondary Accessions:
    • O14801
    • Q969U5

    Protein attributes for EIF3G Gene

    Size:
    320 amino acids
    Molecular mass:
    35611 Da
    Quaternary structure:
    • Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is composed of 13 subunits: EIF3A, EIF3B, EIF3C, EIF3D, EIF3E, EIF3F, EIF3G, EIF3H, EIF3I, EIF3J, EIF3K, EIF3L and EIF3M. The eIF-3 complex appears to include 3 stable modules: module A is composed of EIF3A, EIF3B, EIF3G and EIF3I; module B is composed of EIF3F, EIF3H, and EIF3M; and module C is composed of EIF3C, EIF3D, EIF3E, EIF3K and EIF3L. EIF3C of module C binds EIF3B of module A and EIF3H of module B, thereby linking the three modules. EIF3J is a labile subunit that binds to the eIF-3 complex via EIF3B. The eIF-3 complex interacts with RPS6KB1 under conditions of nutrient depletion. Mitogenic stimulation leads to binding and activation of a complex composed of MTOR and RPTOR, leading to phosphorylation and release of RPS6KB1 and binding of EIF4B to eIF-3. Interacts (via C-terminus) with AIFM1 (via N-terminus).

    Three dimensional structures from OCA and Proteopedia for EIF3G Gene

neXtProt entry for EIF3G Gene

Proteomics data for EIF3G Gene at MOPED

Post-translational modifications for EIF3G Gene

  • Phosphorylated. Phosphorylation is enhanced upon serum stimulation.
  • Ubiquitination at Lys 65 and Lys 180
  • Modification sites at PhosphoSitePlus

Antibody Products

  • Santa Cruz Biotechnology (SCBT) Antibodies for EIF3G

No data available for DME Specific Peptides for EIF3G Gene

Domains & Families for EIF3G Gene

Protein Domains for EIF3G Gene

Suggested Antigen Peptide Sequences for EIF3G Gene

Graphical View of Domain Structure for InterPro Entry

O75821

UniProtKB/Swiss-Prot:

EIF3G_HUMAN :
  • Contains 1 RRM (RNA recognition motif) domain.
  • Belongs to the eIF-3 subunit G family.
Domain:
  • Contains 1 RRM (RNA recognition motif) domain.
Family:
  • Belongs to the eIF-3 subunit G family.
genes like me logo Genes that share domains with EIF3G: view

Function for EIF3G Gene

Molecular function for EIF3G Gene

UniProtKB/Swiss-Prot Function:
Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation. This subunit can bind 18S rRNA. In case of FCV infection, plays a role in the ribosomal termination-reinitiation event leading to the translation of VP2 (PubMed:18056426).

Gene Ontology (GO) - Molecular Function for EIF3G Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IEA,IPI 14688252
genes like me logo Genes that share ontologies with EIF3G: view
genes like me logo Genes that share phenotypes with EIF3G: view

Animal Model Products

miRNA for EIF3G Gene

Inhibitory RNA Products

In Situ Assay Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for EIF3G Gene

Localization for EIF3G Gene

Subcellular locations from UniProtKB/Swiss-Prot for EIF3G Gene

Cytoplasm. Nucleus. Cytoplasm, perinuclear region. Note=Colocalizes with AIFM1 in the nucleus and perinuclear region.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for EIF3G Gene COMPARTMENTS Subcellular localization image for EIF3G gene
Compartment Confidence
cytosol 5
nucleus 3

Gene Ontology (GO) - Cellular Components for EIF3G Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005829 cytosol TAS --
GO:0048471 perinuclear region of cytoplasm IEA --
genes like me logo Genes that share ontologies with EIF3G: view

Pathways & Interactions for EIF3G Gene

genes like me logo Genes that share pathways with EIF3G: view

Pathways by source for EIF3G Gene

1 KEGG pathway for EIF3G Gene
2 Qiagen pathways for EIF3G Gene

Gene Ontology (GO) - Biological Process for EIF3G Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006413 translational initiation IEA,TAS --
GO:0006446 regulation of translational initiation IEA --
genes like me logo Genes that share ontologies with EIF3G: view

No data available for SIGNOR curated interactions for EIF3G Gene

Drugs & Compounds for EIF3G Gene

No Compound Related Data Available

Transcripts for EIF3G Gene

Unigene Clusters for EIF3G Gene

Eukaryotic translation initiation factor 3, subunit G:
Representative Sequences:

Inhibitory RNA Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for EIF3G Gene

ExUns: 1a · 1b · 1c · 1d ^ 2 ^ 3a · 3b · 3c · 3d ^ 4a · 4b ^ 5a · 5b ^ 6 ^ 7a · 7b ^ 8a · 8b · 8c · 8d ^ 9a · 9b · 9c ^ 10a · 10b ^ 11a ·
SP1: - - - - - -
SP2: - - - - - -
SP3: - - - - - - -
SP4: - - -
SP5: - - - - - -
SP6: - - - -
SP7: - - - -
SP8: - - -
SP9: - - - -
SP10: -
SP11: - - -
SP12: - -
SP13: - -
SP14:

ExUns: 11b ^ 12
SP1:
SP2:
SP3:
SP4:
SP5:
SP6:
SP7:
SP8:
SP9:
SP10:
SP11:
SP12:
SP13:
SP14:

Relevant External Links for EIF3G Gene

GeneLoc Exon Structure for
EIF3G
ECgene alternative splicing isoforms for
EIF3G

Expression for EIF3G Gene

mRNA expression in normal human tissues for EIF3G Gene

Protein differential expression in normal tissues from HIPED for EIF3G Gene

This gene is overexpressed in Bone marrow stromal cell (7.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MOPED, and MaxQB for EIF3G Gene



SOURCE GeneReport for Unigene cluster for EIF3G Gene Hs.529059

genes like me logo Genes that share expression patterns with EIF3G: view

Protein tissue co-expression partners for EIF3G Gene

- Elite partner

Primer Products

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for EIF3G Gene

Orthologs for EIF3G Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for EIF3G Gene

Organism Taxonomy Gene Similarity Type Details
cow
(Bos Taurus)
Mammalia EIF3G 35
  • 92.6 (n)
  • 99.37 (a)
EIF3G 36
  • 100 (a)
OneToOne
dog
(Canis familiaris)
Mammalia EIF3G 35
  • 91.67 (n)
  • 99.37 (a)
EIF3G 36
  • 99 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Eif3g 35
  • 89.17 (n)
  • 98.44 (a)
Eif3g 16
Eif3g 36
  • 98 (a)
OneToOne
chimpanzee
(Pan troglodytes)
Mammalia EIF3G 35
  • 99.48 (n)
  • 100 (a)
EIF3G 36
  • 100 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Eif3g 35
  • 88.75 (n)
  • 98.44 (a)
oppossum
(Monodelphis domestica)
Mammalia -- 36
  • 87 (a)
OneToMany
-- 36
  • 60 (a)
OneToMany
platypus
(Ornithorhynchus anatinus)
Mammalia EIF3G 36
  • 88 (a)
OneToOne
chicken
(Gallus gallus)
Aves EIF3G 35
  • 85.93 (n)
  • 94.44 (a)
lizard
(Anolis carolinensis)
Reptilia EIF3G 36
  • 82 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia eif3s4 35
  • 74.87 (n)
  • 85.44 (a)
zebrafish
(Danio rerio)
Actinopterygii -- 35
eif3g 35
  • 78.01 (n)
  • 88.32 (a)
eif3g 36
  • 88 (a)
OneToOne
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.9507 35
African malaria mosquito
(Anopheles gambiae)
Insecta EIF3G_ANOGA 35
  • 56.77 (n)
  • 48.5 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG10881 35
  • 57.28 (n)
  • 48.57 (a)
CG10881 36
  • 47 (a)
OneToMany
CG8636 36
  • 48 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea eif-3.G 35
  • 49.92 (n)
  • 40.93 (a)
eif-3.G 36
  • 38 (a)
OneToOne
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_ADR189W 35
  • 47.6 (n)
  • 36.21 (a)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0B00847g 35
  • 47.16 (n)
  • 39.83 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes TIF35 35
  • 43.9 (n)
  • 36.63 (a)
TIF35 36
  • 33 (a)
OneToOne
TIF35 38
rice
(Oryza sativa)
Liliopsida Os02g0788400 35
  • 53.77 (n)
  • 49.57 (a)
bread mold
(Neurospora crassa)
Ascomycetes NCU08046 35
  • 54.39 (n)
  • 45.34 (a)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes tif35 35
  • 50.5 (n)
  • 46.35 (a)
Species with no ortholog for EIF3G:
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for EIF3G Gene

ENSEMBL:
Gene Tree for EIF3G (if available)
TreeFam:
Gene Tree for EIF3G (if available)

Paralogs for EIF3G Gene

genes like me logo Genes that share paralogs with EIF3G: view

No data available for Paralogs for EIF3G Gene

Variants for EIF3G Gene

Sequence variations from dbSNP and Humsavar for EIF3G Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type
rs870612 -- 10,120,814(+) AAAAA(A/C)GAAAA upstream-variant-2KB
rs2290687 -- 10,118,845(+) CCCCA(C/T)TCCCT intron-variant
rs4555265 -- 10,121,508(+) cctgg(A/G/T)caaca upstream-variant-2KB
rs3217685 -- 10,119,078(+) GCAGT(-/CCTCACTCACCTCCCGGCAGT)AGCTC intron-variant
rs3826784 -- 10,116,334(+) GGGGC(A/G)GCAGC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for EIF3G Gene

Variant ID Type Subtype PubMed ID
nsv833743 CNV Loss 17160897
nsv911028 CNV Loss 21882294

Variation tolerance for EIF3G Gene

Residual Variation Intolerance Score: 27.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.55; 11.90% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for EIF3G Gene

HapMap Linkage Disequilibrium report
EIF3G
Human Gene Mutation Database (HGMD)
EIF3G

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for EIF3G Gene

Disorders for EIF3G Gene

MalaCards: The human disease database

(1) MalaCards diseases for EIF3G Gene - From: GeneCards

Disorder Aliases PubMed IDs
parainfluenza virus type 3
  • human parainfluenza virus type 3
- elite association - COSMIC cancer census association via MalaCards
Search EIF3G in MalaCards View complete list of genes associated with diseases

Relevant External Links for EIF3G

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
EIF3G
genes like me logo Genes that share disorders with EIF3G: view

No data available for UniProtKB/Swiss-Prot and Genatlas for EIF3G Gene

Publications for EIF3G Gene

  1. Characterization of cDNAs encoding the p44 and p35 subunits of human translation initiation factor eIF3. (PMID: 9822659) Block K.L. … Hershey J.W.B. (J. Biol. Chem. 1998) 2 3 4 23 67
  2. Temporal proteomics of NGF-TrkA signaling identifies an inhibitory role for the E3 ligase Cbl-b in neuroblastoma cell differentiation. (PMID: 25921289) Emdal K.B. … Olsen J.V. (Sci Signal 2015) 3
  3. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin E.L. … Gygi S.P. (Cell 2015) 3
  4. Panorama of ancient metazoan macromolecular complexes. (PMID: 26344197) Wan C. … Emili A. (Nature 2015) 3
  5. Control of Paip1-eukayrotic translation initiation factor 3 interaction by amino acids through S6 kinase. (PMID: 24396066) Martineau Y. … Sonenberg N. (Mol. Cell. Biol. 2014) 3

Products for EIF3G Gene

Sources for EIF3G Gene

Back to Top

Content