Free for academic non-profit institutions. Other users need a Commercial license

Aliases for EIF2S2 Gene

Aliases for EIF2S2 Gene

  • Eukaryotic Translation Initiation Factor 2, Subunit 2 Beta, 38kDa 2 3
  • Eukaryotic Translation Initiation Factor 2 Subunit Beta 3 4
  • EIF-2-Beta 3 4
  • EIF2B 3 4
  • Eukaryotic Translation Initiation Factor 2, Subunit 2 (Beta, 38kD ) 2
  • Protein Phosphatase 1, Regulatory Subunit 67 3
  • Protein Phosphatase 1 2
  • Regulatory Subunit 67 2
  • EIF2beta 3
  • PPP1R67 3
  • EIF2 3

External Ids for EIF2S2 Gene

Previous HGNC Symbols for EIF2S2 Gene

  • EIF2

Previous GeneCards Identifiers for EIF2S2 Gene

  • GC20M032435
  • GC20M033345
  • GC20M033392
  • GC20M033391
  • GC20M032140
  • GC20M032676
  • GC20M029461

Summaries for EIF2S2 Gene

Entrez Gene Summary for EIF2S2 Gene

  • Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

GeneCards Summary for EIF2S2 Gene

EIF2S2 (Eukaryotic Translation Initiation Factor 2, Subunit 2 Beta, 38kDa) is a Protein Coding gene. Diseases associated with EIF2S2 include leukoencephalopathy with vanishing white matter. Among its related pathways are Apoptotic Pathways in Synovial Fibroblasts and Nanog in Mammalian ESC Pluripotency. GO annotations related to this gene include poly(A) RNA binding and translation initiation factor activity.

UniProtKB/Swiss-Prot for EIF2S2 Gene

  • eIF-2 functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA. This complex binds to a 40S ribosomal subunit, followed by mRNA binding to form a 43S preinitiation complex. Junction of the 60S ribosomal subunit to form the 80S initiation complex is preceded by hydrolysis of the GTP bound to eIF-2 and release of an eIF-2-GDP binary complex. In order for eIF-2 to recycle and catalyze another round of initiation, the GDP bound to eIF-2 must exchange with GTP by way of a reaction catalyzed by eIF-2B

Gene Wiki entry for EIF2S2 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for EIF2S2 Gene

Genomics for EIF2S2 Gene

Regulatory Elements for EIF2S2 Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for EIF2S2 Gene

34,088,298 bp from pter
34,112,332 bp from pter
24,035 bases
Minus strand

Genomic View for EIF2S2 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for EIF2S2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for EIF2S2 Gene

Proteins for EIF2S2 Gene

  • Protein details for EIF2S2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Eukaryotic translation initiation factor 2 subunit 2
    Protein Accession:
    Secondary Accessions:
    • Q9BVU0
    • Q9UJE4

    Protein attributes for EIF2S2 Gene

    333 amino acids
    Molecular mass:
    38388 Da
    Quaternary structure:
    • Heterotrimer composed of an alpha, a beta and a gamma chain. Component of an EIF2 complex at least composed of CELF1/CUGBP1, CALR, CALR3, EIF2S1, EIF2S2, HSP90B1 and HSPA5 (By similarity).

neXtProt entry for EIF2S2 Gene

Proteomics data for EIF2S2 Gene at MOPED

Post-translational modifications for EIF2S2 Gene

  • Ubiquitination at Lys 52, Lys 132, and Lys 227
  • Modification sites at PhosphoSitePlus

Other Protein References for EIF2S2 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for EIF2S2 Gene

Domains & Families for EIF2S2 Gene

Gene Families for EIF2S2 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the eIF-2-beta/eIF-5 family.
  • Belongs to the eIF-2-beta/eIF-5 family.
genes like me logo Genes that share domains with EIF2S2: view

Function for EIF2S2 Gene

Molecular function for EIF2S2 Gene

UniProtKB/Swiss-Prot Function:
eIF-2 functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA. This complex binds to a 40S ribosomal subunit, followed by mRNA binding to form a 43S preinitiation complex. Junction of the 60S ribosomal subunit to form the 80S initiation complex is preceded by hydrolysis of the GTP bound to eIF-2 and release of an eIF-2-GDP binary complex. In order for eIF-2 to recycle and catalyze another round of initiation, the GDP bound to eIF-2 must exchange with GTP by way of a reaction catalyzed by eIF-2B

Gene Ontology (GO) - Molecular Function for EIF2S2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003723 RNA binding TAS 3044606
GO:0003743 translation initiation factor activity IDA 16289705
GO:0005515 protein binding IPI 11959995
GO:0008135 translation factor activity, RNA binding TAS 3044606
GO:0044822 poly(A) RNA binding IDA 22658674
genes like me logo Genes that share ontologies with EIF2S2: view
genes like me logo Genes that share phenotypes with EIF2S2: view

Animal Model Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for EIF2S2

In Situ Assay Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for EIF2S2 Gene

Localization for EIF2S2 Gene

Subcellular locations from

Jensen Localization Image for EIF2S2 Gene COMPARTMENTS Subcellular localization image for EIF2S2 gene
Compartment Confidence
cytosol 4
nucleus 2

Gene Ontology (GO) - Cellular Components for EIF2S2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 NOT nucleus IDA 12426392
GO:0005737 cytoplasm IDA 12426392
GO:0005829 cytosol TAS --
GO:0005850 eukaryotic translation initiation factor 2 complex TAS 3044606
genes like me logo Genes that share ontologies with EIF2S2: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for EIF2S2 Gene

Pathways & Interactions for EIF2S2 Gene

genes like me logo Genes that share pathways with EIF2S2: view

Pathways by source for EIF2S2 Gene

1 KEGG pathway for EIF2S2 Gene
1 R&D Systems pathway for EIF2S2 Gene

SIGNOR curated interactions for EIF2S2 Gene

Is activated by:

Gene Ontology (GO) - Biological Process for EIF2S2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001701 in utero embryonic development IEA --
GO:0002176 male germ cell proliferation IEA --
GO:0006412 translation TAS --
GO:0006413 translational initiation TAS --
GO:0008584 male gonad development IEA --
genes like me logo Genes that share ontologies with EIF2S2: view

Drugs & Compounds for EIF2S2 Gene

(9) Drugs for EIF2S2 Gene - From: NovoSeek and HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Guanosine triphosphate Experimental Pharma 0
puromycin Experimental Pharma 0
ATP Pharma Activator 0
LY294002 Pharma 0
Rapamycin Pharma mTOR inhibitor 0

(10) Additional Compounds for EIF2S2 Gene - From: NovoSeek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • Animal starch
  • Glycogen
  • Liver starch
  • Lyoglycogen
  • Phytoglycogen
genes like me logo Genes that share compounds with EIF2S2: view

Transcripts for EIF2S2 Gene

mRNA/cDNA for EIF2S2 Gene

Unigene Clusters for EIF2S2 Gene

Eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa:
Representative Sequences:

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for EIF2S2

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for EIF2S2 Gene

No ASD Table

Relevant External Links for EIF2S2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for EIF2S2 Gene

mRNA expression in normal human tissues for EIF2S2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for EIF2S2 Gene

This gene is overexpressed in Lavage (6.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MOPED, and MaxQB for EIF2S2 Gene

SOURCE GeneReport for Unigene cluster for EIF2S2 Gene Hs.429180

genes like me logo Genes that share expression patterns with EIF2S2: view

Protein tissue co-expression partners for EIF2S2 Gene

- Elite partner

Primer Products

In Situ Assay Products

No data available for mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for EIF2S2 Gene

Orthologs for EIF2S2 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for EIF2S2 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia EIF2S2 35
  • 94.09 (n)
  • 96.7 (a)
EIF2S2 36
  • 97 (a)
(Canis familiaris)
Mammalia EIF2S2 35
  • 94.89 (n)
  • 98.2 (a)
EIF2S2 36
  • 97 (a)
(Mus musculus)
Mammalia Eif2s2 35
  • 92.65 (n)
  • 96.07 (a)
Eif2s2 16
Eif2s2 36
  • 96 (a)
(Pan troglodytes)
Mammalia EIF2S2 35
  • 99.5 (n)
  • 99.7 (a)
EIF2S2 36
  • 100 (a)
(Rattus norvegicus)
Mammalia Eif2s2 35
  • 92.89 (n)
  • 96.7 (a)
(Monodelphis domestica)
Mammalia EIF2S2 36
  • 98 (a)
(Ornithorhynchus anatinus)
Mammalia EIF2S2 36
  • 96 (a)
(Gallus gallus)
Aves EIF2S2 35
  • 84.18 (n)
  • 94.59 (a)
EIF2B 36
  • 94 (a)
(Anolis carolinensis)
Reptilia EIF2S2 36
  • 93 (a)
(Danio rerio)
Actinopterygii eif2s2 35
  • 74.72 (n)
  • 78.59 (a)
eif2s2 36
  • 79 (a)
fruit fly
(Drosophila melanogaster)
Insecta eIF-2bgr 37
  • 81 (a)
eIF-2beta 35
  • 62.77 (n)
  • 63.57 (a)
eIF-2beta 36
  • 60 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP007218 35
  • 61.43 (n)
  • 61.86 (a)
(Caenorhabditis elegans)
Secernentea iftb-1 36
  • 52 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes SUI3 36
  • 46 (a)
SUI3 38
(Glycine max)
eudicotyledons Gma.1845 35
Alicante grape
(Vitis vinifera)
eudicotyledons Vvi.2183 35
sea squirt
(Ciona savignyi)
Ascidiacea CSA.10528 36
  • 49 (a)
Species with no ortholog for EIF2S2:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for EIF2S2 Gene

Gene Tree for EIF2S2 (if available)
Gene Tree for EIF2S2 (if available)

Paralogs for EIF2S2 Gene

genes like me logo Genes that share paralogs with EIF2S2: view

No data available for Paralogs for EIF2S2 Gene

Variants for EIF2S2 Gene

Sequence variations from dbSNP and Humsavar for EIF2S2 Gene

SNP ID Clin Chr 20 pos Sequence Context AA Info Type MAF
rs7392 -- 34,089,611(-) TTGGC(A/G)AGTGG utr-variant-3-prime
rs16434 -- 34,089,222(-) CGGCC(-/TCCCACGCGAGTGTGGTGGGACCTTG)AGACT utr-variant-3-prime, downstream-variant-500B
rs1803532 -- 34,089,827(-) ACAGT(A/G)CGAAA missense, reference
rs2038123 -- 34,108,259(+) TAAAC(A/G)GTTTG intron-variant
rs2235596 -- 34,096,503(-) ATTTT(C/T)TTCAA intron-variant

Variation tolerance for EIF2S2 Gene

Residual Variation Intolerance Score: 49.73% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.47; 28.65% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for EIF2S2 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for EIF2S2 Gene

Disorders for EIF2S2 Gene

MalaCards: The human disease database

(1) MalaCards diseases for EIF2S2 Gene - From: GeneCards

Disorder Aliases PubMed IDs
leukoencephalopathy with vanishing white matter
  • leukoencephaly with vanishing white matter
- elite association

Relevant External Links for EIF2S2

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with EIF2S2: view

No data available for UniProtKB/Swiss-Prot and Genatlas for EIF2S2 Gene

Publications for EIF2S2 Gene

  1. A mechanistic model of nutritional control of protein synthesis in animal tissues. (PMID: 19808042) El-Haroun E.R. … Cant J.P. (J. Theor. Biol. 2010) 23 67
  2. Increased p70s6k phosphorylation during intake of a protein-carbohydrate drink following resistance exercise in the fasted state. (PMID: 20187284) Deldicque L. … Hespel P. (Eur. J. Appl. Physiol. 2010) 23 67
  3. Thermodynamic and kinetic framework of selenocysteyl-tRNASec recognition by elongation factor SelB. (PMID: 19940162) Paleskava A. … Rodnina M.V. (J. Biol. Chem. 2010) 23 67
  4. The ribosome-bound initiation factor 2 recruits initiator tRNA to the 30S initiation complex. (PMID: 20224578) Milon P. … Gualerzi C.O. (EMBO Rep. 2010) 23 67
  5. ABC50 promotes translation initiation in mammalian cells. (PMID: 19570978) Paytubi S. … Proud C.G. (J. Biol. Chem. 2009) 23 67

Products for EIF2S2 Gene

Sources for EIF2S2 Gene

Back to Top
