Free for academic non-profit institutions. Other users need a Commercial license

Aliases for EEF1G Gene

Aliases for EEF1G Gene

  • Eukaryotic Translation Elongation Factor 1 Gamma 2 3
  • EF1G 3 4 6
  • EEF-1B Gamma 3 4
  • EF-1-Gamma 3 4
  • Translation Elongation Factor EEF-1 Gamma Chain 3
  • Pancreatic Tumor-Related Protein 3
  • Elongation Factor 1-Gamma 3
  • PRO1608 3
  • GIG35 3

External Ids for EEF1G Gene

Previous GeneCards Identifiers for EEF1G Gene

  • GC11M064840
  • GC11M063902
  • GC11M062577
  • GC11M062102
  • GC11M062083
  • GC11M062328
  • GC11M062332

Summaries for EEF1G Gene

Entrez Gene Summary for EEF1G Gene

  • This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit contains an N-terminal glutathione transferase domain, which may be involved in regulating the assembly of multisubunit complexes containing this elongation factor and aminoacyl-tRNA synthetases. [provided by RefSeq, Jul 2008]

GeneCards Summary for EEF1G Gene

EEF1G (Eukaryotic Translation Elongation Factor 1 Gamma) is a Protein Coding gene. Among its related pathways are Biosynthesis of the N-glycan precursor (dolichol lipid-linked oligosaccharide, LLO) and transfer to a nascent protein and Gene Expression. GO annotations related to this gene include translation elongation factor activity.

UniProtKB/Swiss-Prot for EEF1G Gene

  • Probably plays a role in anchoring the complex to other cellular components

Gene Wiki entry for EEF1G Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for EEF1G Gene

Genomics for EEF1G Gene

Regulatory Elements for EEF1G Gene

Genomic Location for EEF1G Gene

62,559,601 bp from pter
62,574,086 bp from pter
14,486 bases
Minus strand

Genomic View for EEF1G Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for EEF1G Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for EEF1G Gene

Proteins for EEF1G Gene

  • Protein details for EEF1G Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Elongation factor 1-gamma
    Protein Accession:
    Secondary Accessions:
    • B4DTG2
    • Q6PJ62
    • Q6PK31
    • Q96CU2
    • Q9P196

    Protein attributes for EEF1G Gene

    437 amino acids
    Molecular mass:
    50119 Da
    Quaternary structure:
    • EF-1 is composed of four subunits: alpha, beta, delta, and gamma

    Three dimensional structures from OCA and Proteopedia for EEF1G Gene

    Alternative splice isoforms for EEF1G Gene


neXtProt entry for EEF1G Gene

Proteomics data for EEF1G Gene at MOPED

Post-translational modifications for EEF1G Gene

  • Ubiquitination at Lys17, Lys147, Lys212, Lys285, and Lys294
  • Modification sites at PhosphoSitePlus

Other Protein References for EEF1G Gene

ENSEMBL proteins:
Reactome Protein details:
REFSEQ proteins:

No data available for DME Specific Peptides for EEF1G Gene

Domains for EEF1G Gene

Suggested Antigen Peptide Sequences for EEF1G Gene

Graphical View of Domain Structure for InterPro Entry



  • Contains 1 EF-1-gamma C-terminal domain.
  • Contains 1 EF-1-gamma C-terminal domain.
  • Contains 1 GST C-terminal domain.
  • Contains 1 GST N-terminal domain.
genes like me logo Genes that share domains with EEF1G: view

No data available for Gene Families for EEF1G Gene

Function for EEF1G Gene

Molecular function for EEF1G Gene

UniProtKB/Swiss-Prot Function:
Probably plays a role in anchoring the complex to other cellular components
UniProtKB/Swiss-Prot Induction:
Down-regulated in response to enterovirus 71 (EV71) infection.

Gene Ontology (GO) - Molecular Function for EEF1G Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003746 translation elongation factor activity IEA --
GO:0005515 protein binding IPI 10908348
genes like me logo Genes that share ontologies with EEF1G: view

Animal Model Products

miRNA for EEF1G Gene

miRTarBase miRNAs that target EEF1G

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for EEF1G

In Situ Assay Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes , Animal Models , Transcription Factor Targets and HOMER Transcription for EEF1G Gene

Localization for EEF1G Gene

Subcellular locations from

Jensen Localization Image for EEF1G Gene COMPARTMENTS Subcellular localization image for EEF1G gene
Compartment Confidence
nucleus 5
cytosol 4

Gene Ontology (GO) - Cellular Components for EEF1G Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IDA 21630459
GO:0005737 cytoplasm IDA 8743958
GO:0005783 colocalizes_with endoplasmic reticulum IDA 8743958
GO:0005829 cytosol TAS --
GO:0016020 membrane IDA 19946888
genes like me logo Genes that share ontologies with EEF1G: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for EEF1G Gene

Pathways for EEF1G Gene

genes like me logo Genes that share pathways with EEF1G: view

Pathways by source for EEF1G Gene

1 BioSystems pathway for EEF1G Gene
1 KEGG pathway for EEF1G Gene

Gene Ontology (GO) - Biological Process for EEF1G Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006412 translation TAS --
GO:0006414 translational elongation TAS --
GO:0009615 response to virus IEP 16548883
GO:0010467 gene expression TAS --
GO:0044267 cellular protein metabolic process TAS --
genes like me logo Genes that share ontologies with EEF1G: view

Drugs for EEF1G Gene

(1) Novoseek inferred chemical compound relationships for EEF1G Gene

Compound -log(P) Hits PubMed IDs
aminoacyl-trna 58 1
genes like me logo Genes that share compounds with EEF1G: view

Transcripts for EEF1G Gene

mRNA/cDNA for EEF1G Gene

Unigene Clusters for EEF1G Gene

Eukaryotic translation elongation factor 1 gamma:
Representative Sequences:

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for EEF1G

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for EEF1G Gene

No ASD Table

Relevant External Links for EEF1G Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for EEF1G Gene

mRNA expression in normal human tissues for EEF1G Gene

Integrated Proteomics: protein expression from ProteomicsDB, PaxDb, MOPED, and MaxQB for EEF1G Gene

SOURCE GeneReport for Unigene cluster for EEF1G Gene Hs.144835

mRNA Expression by UniProt/SwissProt for EEF1G Gene

Tissue specificity: Highly expressed in pancreatic tumor tissue and to a lesser extent in normal kidney, intestine, pancreas, stomach, lung, brain, spleen and liver
genes like me logo Genes that share expressions with EEF1G: view

Expression partners for EEF1G Gene

* - Elite partner

Primer Products

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and Protein differential expression in normal tissues for EEF1G Gene

Orthologs for EEF1G Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for EEF1G Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia EEF1G 35
  • 92.75 (n)
  • 97.94 (a)
EEF1G 36
  • 97 (a)
(Canis familiaris)
Mammalia EEF1G 35
  • 94.81 (n)
  • 98.4 (a)
-- 36
  • 98 (a)
-- 36
  • 92 (a)
-- 36
  • 96 (a)
-- 36
  • 70 (a)
-- 36
  • 94 (a)
(Mus musculus)
Mammalia Eef1g 35
  • 91.46 (n)
  • 98.17 (a)
Eef1g 16
Eef1g 36
  • 98 (a)
(Pan troglodytes)
Mammalia EEF1G 35
  • 99.77 (n)
  • 100 (a)
EEF1G 36
  • 89 (a)
(Rattus norvegicus)
Mammalia Eef1g 35
  • 89.7 (n)
  • 97.71 (a)
(Monodelphis domestica)
Mammalia -- 36
  • 92 (a)
-- 36
  • 68 (a)
-- 36
  • 55 (a)
-- 36
  • 92 (a)
(Ornithorhynchus anatinus)
Mammalia EEF1G 36
  • 93 (a)
(Anolis carolinensis)
Reptilia -- 36
  • 84 (a)
-- 36
  • 86 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia MGC76278 35
African clawed frog
(Xenopus laevis)
Amphibia LOC397861 35
(Danio rerio)
Actinopterygii eef1g 35
  • 75.54 (n)
  • 77.98 (a)
eef1g 36
  • 77 (a)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.12147 35
fruit fly
(Drosophila melanogaster)
Insecta Ef1gamma 37
  • 57 (a)
Ef1gamma 35
  • 63.16 (n)
  • 59.58 (a)
Ef1gamma 36
  • 58 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP000883 35
  • 60.47 (n)
  • 58.35 (a)
(Caenorhabditis elegans)
Secernentea eef-1G 35
  • 55.89 (n)
  • 52.16 (a)
eef-1G 36
  • 49 (a)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_ADR147C 35
  • 49.17 (n)
  • 37 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes CAM1 36
  • 34 (a)
TEF4 36
  • 34 (a)
CAM1 38
thale cress
(Arabidopsis thaliana)
eudicotyledons AT1G09640 35
  • 49.88 (n)
  • 41.03 (a)
(Oryza sativa)
Liliopsida Os02g0220600 35
  • 48.18 (n)
  • 39.42 (a)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.2821 36
  • 50 (a)
Species with no ortholog for EEF1G:
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for EEF1G Gene

Gene Tree for EEF1G (if available)
Gene Tree for EEF1G (if available)

Paralogs for EEF1G Gene

(1) SIMAP similar genes for EEF1G Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with EEF1G: view

No data available for Paralogs for EEF1G Gene

Variants for EEF1G Gene

Sequence variations from dbSNP and Humsavar for EEF1G Gene

SNP ID Clin Chr 11 pos Sequence Context AA Info Type MAF
rs529293193 -- 62,565,853(+) CAATT(C/T)TATGC intron-variant
rs529321916 -- 62,572,232(+) ACACA(C/G)CACTT intron-variant
rs538173760 -- 62,566,428(+) CCGGG(-/CGCGTGGCGCACCGCAAGGCT)CTCTG intron-variant
rs546789952 -- 62,562,276(+) CTCAG(A/G)GCCGA intron-variant
rs538102308 -- 62,561,078(+) TCCAC(A/G)ATTGG intron-variant

Structural Variations from Database of Genomic Variants (DGV) for EEF1G Gene

Variant ID Type Subtype PubMed ID
nsv832180 CNV Loss 17160897
nsv832182 CNV Gain+Loss 17160897
nsv347 CNV Loss 18451855
nsv825939 CNV Gain 20364138

Relevant External Links for EEF1G Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for EEF1G Gene

Disorders for EEF1G Gene

(4) Novoseek inferred disease relationships for EEF1G Gene

Disease -log(P) Hits PubMed IDs
colorectal carcinoma 47.2 3
pancreatic cancer 42.1 3
adenocarcinoma 10.6 2
tumors 0 3
genes like me logo Genes that share disorders with EEF1G: view

No data available for MalaCards , OMIM , UniProtKB/Swiss-Prot , University of Copenhagen DISEASES , Genatlas and External Links for EEF1G Gene

Publications for EEF1G Gene

  1. Human cDNAs encoding elongation factor 1 gamma and the ribosomal protein L19. (PMID: 1598220) Kumabe T. … Yamamoto T. (Nucleic Acids Res. 1992) 2 3 4 23
  2. Elongation factor-1 messenger-RNA levels in cultured cells are high compared to tissue and are not drastically affected further by oncogenic transformation. (PMID: 1461723) Sanders J. … Moeller W. (Nucleic Acids Res. 1992) 2 3 4 23
  3. Expression of elongation factor-1 gamma-related sequence in human pancreatic cancer. (PMID: 1372736) Lew Y. … Frazier M.L. (Pancreas 1992) 3 4 23
  4. Transcriptomic and proteomic analyses of rhabdomyosarcoma cells reveal differential cellular gene expression in response to enterovirus 71 infection. (PMID: 16548883) Leong W.F. … Chow V.T. (Cell. Microbiol. 2006) 3 4
  5. 1H, 15N and 13C resonance assignments of the highly conserved 19 kDa C-terminal domain from human elongation factor 1Bgamma. (PMID: 12766415) Vanwetswinkel S. … Siegal G. (J. Biomol. NMR 2003) 3 4

Products for EEF1G Gene

Sources for EEF1G Gene

Back to Top
