Aliases for DVL1 Gene
Aliases for DVL1 Gene
External Ids for DVL1 Gene
- HGNC: 3084
- Entrez Gene: 1855
- Ensembl: ENSG00000107404
- OMIM: 601365
- UniProtKB: O14640
Previous GeneCards Identifiers for DVL1 Gene
- GC01M000796
- GC01M001021
- GC01M001147
- GC01M001177
- GC01M001178
- GC01M001311
- GC01M001261
- GC01M001262
Summaries for DVL1 Gene
-
DVL1, the human homolog of the Drosophila dishevelled gene (dsh) encodes a cytoplasmic phosphoprotein that regulates cell proliferation, acting as a transducer molecule for developmental processes, including segmentation and neuroblast specification. DVL1 is a candidate gene for neuroblastomatous transformation. The Schwartz-Jampel syndrome and Charcot-Marie-Tooth disease type 2A have been mapped to the same region as DVL1. The phenotypes of these diseases may be consistent with defects which might be expected from aberrant expression of a DVL gene during development. [provided by RefSeq, Jul 2008]
GeneCards Summary for DVL1 Gene
DVL1 (Dishevelled Segment Polarity Protein 1) is a Protein Coding gene. Diseases associated with DVL1 include Robinow Syndrome, Autosomal Dominant 2 and Autosomal Dominant Robinow Syndrome. Among its related pathways are DNA Damage Response (only ATM dependent) and Neural Crest Differentiation. Gene Ontology (GO) annotations related to this gene include identical protein binding and enzyme binding. An important paralog of this gene is DVL3.
UniProtKB/Swiss-Prot for DVL1 Gene
-
Participates in Wnt signaling by binding to the cytoplasmic C-terminus of frizzled family members and transducing the Wnt signal to down-stream effectors. Plays a role both in canonical and non-canonical Wnt signaling. Plays a role in the signal transduction pathways mediated by multiple Wnt genes. Required for LEF1 activation upon WNT1 and WNT3A signaling. DVL1 and PAK1 form a ternary complex with MUSK which is important for MUSK-dependent regulation of AChR clustering during the formation of the neuromuscular junction (NMJ).
Additional gene information for DVL1 Gene
- Monarch Initiative
- Search for DVL1 at DataMed
- Search for DVL1 at HumanCyc
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for DVL1 Gene
Genomics for DVL1 Gene
GeneHancer (GH) Regulatory Elements for DVL1 Gene
- Top Transcription factor binding sites by QIAGEN in the DVL1 gene promoter:
Regulatory Element Products
Genomic Locations for DVL1 Gene
- chr1:1,335,276-1,349,350
- (GRCh38/hg38)
- Size:
- 14,075 bases
- Orientation:
- Minus strand
- chr1:1,270,656-1,284,730
- (GRCh37/hg19)
Genomic View for DVL1 Gene
- Cytogenetic band:
-
- 1p36.33 by Ensembl
- 1p36.33 by Entrez Gene
- 1p36.33 by HGNC


RefSeq DNA sequence for DVL1 Gene
Proteins for DVL1 Gene
-
Protein details for DVL1 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- O14640-DVL1_HUMAN
- Recommended name:
- Segment polarity protein dishevelled homolog DVL-1
- Protein Accession:
- O14640
- Q5TA33
- Q5TA35
Protein attributes for DVL1 Gene
- Size:
- 695 amino acids
- Molecular mass:
- 75187 Da
- Quaternary structure:
-
- Interacts with CXXC4. Interacts (via PDZ domain) with NXN (By similarity). Interacts with BRD7 and INVS. Interacts through its PDZ domain with the C-terminal regions of VANGL1, VANGL2 and CCDC88C/DAPLE. Interacts with ARRB1; the interaction is enhanced by phosphorylation of DVL1. Interacts with CYLD (By similarity). Interacts (via PDZ domain) with RYK. Self-associates (via DIX domain) and forms higher homooligomers. Interacts (via PDZ domain) with DACT1 and FZD7, where DACT1 and FZD7 compete for the same binding site (By similarity). Interacts (via DEP domain) with MUSK; the interaction is direct and mediates the formation a DVL1, MUSK and PAK1 ternary complex involved in AChR clustering (By similarity). Interacts (via PDZ domain) with TMEM88. Interacts with DCDC2. Interacts with FOXK2 (PubMed:25805136).
Protein Expression for DVL1 Gene
Post-translational modifications for DVL1 Gene
- Ubiquitinated; undergoes both Lys-48-linked ubiquitination, leading to its subsequent degradation by the ubiquitin-proteasome pathway, and Lys-63-linked ubiquitination. The interaction with INVS is required for ubiquitination. Deubiquitinated by CYLD, which acts on Lys-63-linked ubiquitin chains (By similarity).
Other Protein References for DVL1 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- R&D Systems Antibodies for DVL1 (Dishevelled-1)
- Novus Biologicals Antibodies for DVL1
-
Abcam antibodies for DVL1
-
Cloud-Clone Corp. Antibodies for DVL1
- Invitrogen Antibodies for DVL1
- GeneTex DVL1 antibody for DVL1
-
Santa Cruz Biotechnology (SCBT) Antibodies for DVL1
Protein Products
-
OriGene Purified Proteins for DVL1
- Search Origene for MassSpec and Protein Over-expression Lysates for DVL1
- Origene Custom Protein Services for DVL1
-
Cloud-Clone Corp. Proteins for DVL1
- Search GeneTex for Proteins for DVL1
-
Abcam proteins for DVL1
Assay Products
No data available for DME Specific Peptides for DVL1 Gene
Domains & Families for DVL1 Gene
Gene Families for DVL1 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Disease related genes
- Plasma proteins
- Predicted intracellular proteins
Protein Domains for DVL1 Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for DVL1 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
O14640UniProtKB/Swiss-Prot:
DVL1_HUMAN :- The DIX domain promotes homooligomerization.
- Belongs to the DSH family.
- Domain:
-
- The DIX domain promotes homooligomerization.
- The DEP domain mediates interaction with the cell membrane.
- Family:
-
- Belongs to the DSH family.
Function for DVL1 Gene
Molecular function for DVL1 Gene
- GENATLAS Biochemistry:
- Drosophila dishevelled segment polarity gene homolog 1,widely expressed,putatively involved in neural and heart development,activated in WNT signal transduction,frequently but not always deleted in the 1PDEL syndrome,most likely not contributing to the syndrome
- UniProtKB/Swiss-Prot Function:
- Participates in Wnt signaling by binding to the cytoplasmic C-terminus of frizzled family members and transducing the Wnt signal to down-stream effectors. Plays a role both in canonical and non-canonical Wnt signaling. Plays a role in the signal transduction pathways mediated by multiple Wnt genes. Required for LEF1 activation upon WNT1 and WNT3A signaling. DVL1 and PAK1 form a ternary complex with MUSK which is important for MUSK-dependent regulation of AChR clustering during the formation of the neuromuscular junction (NMJ).
Phenotypes From GWAS Catalog for DVL1 Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0003674 | molecular_function | ND | -- |
GO:0005109 | frizzled binding | IPI | 19388021 |
GO:0005515 | protein binding | IPI | 10330181 |
GO:0008013 | beta-catenin binding | IEA | -- |
GO:0019899 | enzyme binding | IPI | 15454084 |
Phenotypes for DVL1 Gene
- MGI mutant phenotypes for DVL1:
- inferred from 1 alleles
- GenomeRNAi human phenotypes for DVL1:
-
- Increased viability
- Increased vaccinia virus (VACV) infection
- shRNA abundance <= 50%
- Mildly decreased CFP-tsO45G cell surface transport
- Decreased viability in esophageal squamous lineage
- Decreased HIV-LTR-beta-galactosidase protein expression
- Increased epidermal growth factor receptor (EGFR) surface abundance
- Decreased Tat-dependent HIV-LTR-beta-galactosidase protein expression
Animal Models for DVL1 Gene
- MGI Knock Outs for DVL1:
-
- Dvl1 tm1Awb
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for DVL1
-
-
ViGene Biosciences lentiviral particle packaged cDNA for DVL1 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for DVL1 gene
- Search ViGene Biosciences for DVL1
CRISPR Products
-
OriGene CRISPR knockouts for DVL1
- genomics-online: gRNA clones - Search results for 93 available DVL1 gene related products
- Overview of 93 available DVL1 gene related products
- Applied Biological Materials CRISPR for DVL1
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for DVL1
- GenScript: Design CRISPR guide RNA sequences for DVL1
miRNA for DVL1 Gene
- miRTarBase miRNAs that target DVL1
-
- hsa-mir-744-5p (MIRT037606)
- hsa-mir-378a-3p (MIRT043927)
- hsa-mir-10a-5p (MIRT047691)
- hsa-mir-7155-3p (MIRT618680)
- hsa-mir-891a-3p (MIRT618681)
- hsa-mir-3688-5p (MIRT618682)
- hsa-mir-885-3p (MIRT618683)
- hsa-mir-7113-3p (MIRT618684)
- hsa-mir-4469 (MIRT618685)
- hsa-mir-339-5p (MIRT618686)
- hsa-mir-4667-3p (MIRT618687)
- hsa-mir-1470 (MIRT618688)
- hsa-mir-6793-3p (MIRT618689)
- hsa-mir-4641 (MIRT645031)
- hsa-mir-5002-3p (MIRT645032)
- hsa-mir-103a-3p (MIRT734337)
miRNA Products
- Search ViGene Biosciences for DVL1
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for DVL1
- Browse OriGene Inhibitory RNA Products For DVL1
- genomics-online: shRNA clones - Search results for 93 available DVL1 gene related products
- Overview of 93 available DVL1 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for DVL1 gene
Clone Products
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for DVL1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for DVL1
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for DVL1
- Applied Biological Materials Clones for DVL1
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for DVL1
-
ViGene Biosciences adenoviral particle packaged cDNA for DVL1 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for DVL1 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for DVL1 gene
No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for DVL1 Gene
Localization for DVL1 Gene
Subcellular locations from UniProtKB/Swiss-Prot for DVL1 Gene
- Cell membrane; Peripheral membrane protein; Cytoplasmic side. Cytoplasm, cytosol. Cytoplasmic vesicle. Note=Localizes at the cell membrane upon interaction with frizzled family members. {ECO:0000250}.
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0005622 | intracellular | IEA | -- |
GO:0005737 | cytoplasm | IEA | -- |
GO:0005829 | cytosol | TAS,IBA | -- |
GO:0005874 | microtubule | IEA | -- |
GO:0005886 | plasma membrane | IEA | -- |
No data available for Subcellular locations from the Human Protein Atlas (HPA) for DVL1 Gene
Pathways & Interactions for DVL1 Gene
SuperPathway | Contained pathways | ||
---|---|---|---|
1 | Gastric cancer |
.62
.62
|
|
2 | Transcription Androgen Receptor nuclear signaling |
.31
|
|
3 | Wnt Signaling Pathway and Pluripotency | ||
4 | CDK-mediated phosphorylation and removal of Cdc6 |
.70
|
|
5 | Wnt Signaling Pathways: beta-Catenin-dependent Wnt Signaling |
Pathways by source for DVL1 Gene
2 GeneTex pathways for DVL1 Gene
12 BioSystems pathways for DVL1 Gene
12 Reactome pathways for DVL1 Gene
13 KEGG pathways for DVL1 Gene
2 GeneGo (Thomson Reuters) pathways for DVL1 Gene
2 R&D Systems pathways for DVL1 Gene
Interacting Proteins for DVL1 Gene
SIGNOR curated interactions for DVL1 Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0001505 | regulation of neurotransmitter levels | ISS | -- |
GO:0001932 | regulation of protein phosphorylation | IEA | -- |
GO:0001933 | negative regulation of protein phosphorylation | IEA | -- |
GO:0001934 | positive regulation of protein phosphorylation | IEA | -- |
GO:0006366 | transcription by RNA polymerase II | IDA | 11742073 |
Transcripts for DVL1 Gene
mRNA/cDNA for DVL1 Gene
- (7) REFSEQ mRNAs :
- (8) Additional mRNA sequences :
- (204) Selected AceView cDNA sequences:
- (8) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for DVL1 Gene
CRISPR Products
-
OriGene CRISPR knockouts for DVL1
- genomics-online: gRNA clones - Search results for 93 available DVL1 gene related products
- Overview of 93 available DVL1 gene related products
- Applied Biological Materials CRISPR for DVL1
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for DVL1
- GenScript: Design CRISPR guide RNA sequences for DVL1
miRNA Products
- Search ViGene Biosciences for DVL1
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for DVL1
- Browse OriGene Inhibitory RNA Products For DVL1
- genomics-online: shRNA clones - Search results for 93 available DVL1 gene related products
- Overview of 93 available DVL1 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for DVL1 gene
Clone Products
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for DVL1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for DVL1
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for DVL1
- Applied Biological Materials Clones for DVL1
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
ExUns: | 1 | ^ | 2 | ^ | 3 | ^ | 4a | · | 4b | ^ | 5 | ^ | 6 | ^ | 7 | ^ | 8a | · | 8b | · | 8c | ^ | 9a | · | 9b | ^ | 10a | · | 10b | ^ | 11a | · | 11b | ^ | 12a | · | 12b | · | 12c | ^ | 13 | ^ | 14a | · | 14b | · | 14c | ^ | 15a | · | 15b | ^ |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
SP1: | - | - | - | - | ||||||||||||||||||||||||||||||||||||||||||||||||
SP2: | - | |||||||||||||||||||||||||||||||||||||||||||||||||||
SP3: | - | |||||||||||||||||||||||||||||||||||||||||||||||||||
SP4: | - | |||||||||||||||||||||||||||||||||||||||||||||||||||
SP5: | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | ||||||||||||||||||||||||||||||||||||
SP6: | - | |||||||||||||||||||||||||||||||||||||||||||||||||||
SP7: | - | |||||||||||||||||||||||||||||||||||||||||||||||||||
SP8: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
SP9: | - | - | ||||||||||||||||||||||||||||||||||||||||||||||||||
SP10: |
ExUns: | 16 | ^ | 17a | · | 17b |
---|---|---|---|---|---|
SP1: | - | ||||
SP2: | |||||
SP3: | - | ||||
SP4: | |||||
SP5: | - | ||||
SP6: | |||||
SP7: | |||||
SP8: | |||||
SP9: | |||||
SP10: |
Expression for DVL1 Gene
mRNA differential expression in normal tissues according to GTEx for DVL1 Gene
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for DVL1 Gene
NURSA nuclear receptor signaling pathways regulating expression of DVL1 Gene:
DVL1SOURCE GeneReport for Unigene cluster for DVL1 Gene:
Hs.731450Evidence on tissue expression from TISSUES for DVL1 Gene
- Nervous system(4.2)
- Lung(3.3)
- Intestine(2.7)
- Muscle(2.6)
- Kidney(2.2)
- Pancreas(2.2)
- Skin(2)
Phenotype-based relationships between genes and organs from Gene ORGANizer for DVL1 Gene
- ectoderm
- endoderm
- mesoderm
- cardiovascular
- digestive
- integumentary
- nervous
- reproductive
- skeletal muscle
- skeleton
- urinary
- brain
- cheek
- chin
- ear
- eye
- eyelid
- face
- forehead
- head
- jaw
- lip
- mandible
- maxilla
- mouth
- neck
- nose
- outer ear
- skull
- tongue
- tooth
- chest wall
- clavicle
- heart
- heart valve
- rib
- rib cage
- scapula
- sternum
- abdominal wall
- intestine
- kidney
- pelvis
- penis
- testicle
- ureter
- vagina
- vulva
- ankle
- arm
- digit
- elbow
- femur
- fibula
- finger
- foot
- forearm
- hand
- hip
- humerus
- knee
- lower limb
- radius
- shin
- shoulder
- thigh
- tibia
- toe
- ulna
- upper limb
- wrist
- hair
- skin
- spinal column
- vertebrae
Primer Products
-
OriGene qPCR primer pairs for DVL1
-
OriGene qPCR primer pairs and template standards for DVL1
- genomics-online: primer clones - Search results for 93 available DVL1 gene related products
- Overview of 93 available DVL1 gene related products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for DVL1 Gene
Orthologs for DVL1 Gene
This gene was present in the common ancestor of animals.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
chimpanzee (Pan troglodytes) |
Mammalia | DVL1 33 34 |
|
||
cow (Bos Taurus) |
Mammalia | DVL1 33 34 |
|
||
dog (Canis familiaris) |
Mammalia | DVL1 33 34 |
|
||
rat (Rattus norvegicus) |
Mammalia | Dvl1 33 |
|
||
mouse (Mus musculus) |
Mammalia | Dvl1 33 16 34 |
|
||
platypus (Ornithorhynchus anatinus) |
Mammalia | DVL1 34 |
|
OneToOne | |
oppossum (Monodelphis domestica) |
Mammalia | DVL1 34 |
|
OneToOne | |
chicken (Gallus gallus) |
Aves | GGA.16412 34 |
|
OneToOne | |
DVL1 33 |
|
||||
lizard (Anolis carolinensis) |
Reptilia | DVL1 34 |
|
OneToOne | |
tropical clawed frog (Silurana tropicalis) |
Amphibia | dvl1 33 |
|
||
zebrafish (Danio rerio) |
Actinopterygii | DVL1 (3 of 3) 34 |
|
OneToMany | |
dvl1b 33 34 |
|
||||
DVL1 (1 of 3) 34 |
|
OneToMany | |||
fruit fly (Drosophila melanogaster) |
Insecta | dsh 35 34 |
|
||
worm (Caenorhabditis elegans) |
Secernentea | T05C12.6c 35 |
|
|
|
dsh-2 34 |
|
ManyToMany | |||
mig-5 34 |
|
ManyToMany | |||
dsh-1 34 |
|
ManyToMany |
- Species where no ortholog for DVL1 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Paralogs for DVL1 Gene
(5) SIMAP similar genes for DVL1 Gene using alignment to 3 proteins:
Variants for DVL1 Gene
SNP ID | Clin | Chr 01 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs797044833 | pathogenic, Robinow syndrome, autosomal dominant 2 | 1,338,045(-) | AA/G | coding_sequence_variant, frameshift | |
rs797044834 | pathogenic, Robinow syndrome, autosomal dominant 2 | 1,338,099(-) | GGGGCAGCCGGGTGGGGCAGC/GGGGCAGC | coding_sequence_variant, frameshift | |
rs797044835 | pathogenic, Robinow syndrome, autosomal dominant 2 | 1,338,097(-) | A/ | coding_sequence_variant, frameshift | |
rs797044836 | pathogenic, Robinow syndrome, autosomal dominant 2 | 1,338,108(-) | GGG/GG | coding_sequence_variant, frameshift | |
rs797044837 | pathogenic, Robinow syndrome, autosomal dominant 2 | 1,338,001(-) | T/ | coding_sequence_variant, frameshift |
Variant ID | Type | Subtype | PubMed ID |
---|---|---|---|
dgv11n106 | CNV | deletion | 24896259 |
dgv26n54 | CNV | loss | 21841781 |
dgv27n54 | CNV | gain | 21841781 |
dgv28n54 | CNV | gain | 21841781 |
dgv29n54 | CNV | loss | 21841781 |
dgv2n67 | CNV | gain | 20364138 |
dgv30n54 | CNV | gain | 21841781 |
dgv6n100 | CNV | gain+loss | 25217958 |
dgv7n100 | CNV | loss | 25217958 |
esv2758912 | CNV | loss | 17122850 |
esv3890636 | CNV | loss | 25118596 |
nsv1000169 | CNV | gain | 25217958 |
nsv1009541 | CNV | gain | 25217958 |
nsv10161 | CNV | gain+loss | 18304495 |
nsv1074439 | CNV | deletion | 25765185 |
nsv1160788 | CNV | deletion | 26073780 |
nsv470680 | CNV | loss | 18288195 |
nsv482937 | CNV | loss | 15286789 |
nsv544969 | CNV | loss | 21841781 |
nsv544971 | CNV | loss | 21841781 |
nsv544972 | CNV | loss | 21841781 |
nsv544977 | CNV | gain+loss | 21841781 |
nsv544991 | CNV | loss | 21841781 |
nsv950452 | CNV | deletion | 24416366 |
nsv997291 | CNV | gain | 25217958 |
Additional Variant Information for DVL1 Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for DVL1 Gene
Disorders for DVL1 Gene

(7) MalaCards diseases for DVL1 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards
Disorder | Aliases | PubMed IDs |
---|---|---|
robinow syndrome, autosomal dominant 2 |
|
|
autosomal dominant robinow syndrome |
|
|
robinow syndrome |
|
|
charcot-marie-tooth disease type 2a |
|
|
neural tube defects |
|
|
UniProtKB/Swiss-Prot
DVL1_HUMAN- Robinow syndrome, autosomal dominant 2 (DRS2) [MIM:616331]: A rare skeletal dysplasia syndrome characterized by dysmorphic features resembling a fetal face, mesomelic limb shortening, hypoplastic external genitalia in males, costovertebral segmentation defects, and renal anomalies. {ECO:0000269 PubMed:25817014, ECO:0000269 PubMed:25817016}. Note=The disease is caused by mutations affecting the gene represented in this entry.
Additional Disease Information for DVL1
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for Genatlas for DVL1 Gene
Publications for DVL1 Gene
- Identification of genomic organisation, sequence variants and analysis of the role of the human dishevelled 1 gene in late onset Alzheimer's disease. (PMID: 11803455) Russ C … Powell JF (Molecular psychiatry 2002) 3 22 44 58
- beta-Arrestin1 modulates lymphoid enhancer factor transcriptional activity through interaction with phosphorylated dishevelled proteins. (PMID: 11742073) Chen W … Miller WE (Proceedings of the National Academy of Sciences of the United States of America 2001) 3 4 22 58
- DVL1 frameshift mutations clustering in the penultimate exon cause autosomal-dominant Robinow syndrome. (PMID: 25817016) White J … Carvalho CM (American journal of human genetics 2015) 3 4 58
- Mutations in DVL1 cause an osteosclerotic form of Robinow syndrome. (PMID: 25817014) Bunn KJ … Robertson SP (American journal of human genetics 2015) 3 4 58
- DCDC2 mutations cause a renal-hepatic ciliopathy by disrupting Wnt signaling. (PMID: 25557784) Schueler M … Hildebrandt F (American journal of human genetics 2015) 3 4 58
Products for DVL1 Gene
- R&D Systems Antibodies for DVL1 (Dishevelled-1)
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for DVL1
- Search Origene for MassSpec and Protein Over-expression Lysates for DVL1
- Origene Custom Protein Services for DVL1
- Origene shrna, sirna, and RNAi products in human, mouse, rat for DVL1
- Browse OriGene Inhibitory RNA Products For DVL1
- OriGene qPCR primer pairs and template standards for DVL1
- OriGene qPCR primer pairs for DVL1
- OriGene CRISPR knockouts for DVL1
- OriGene ORF clones in human for DVL1
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For DVL1
- GenScript: Next-day shipping of latest version cDNA ORF clones for DVL1 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for DVL1
- GenScript Custom Assay Services for DVL1
- GenScript Custom overexpressing Cell Line Services for DVL1
- GenScript: Design CRISPR guide RNA sequences for DVL1
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for DVL1
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for DVL1
- Novus Biologicals lysates and proteins for DVL1
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Abcam antibodies for DVL1
- Abcam proteins for DVL1
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Cloud-Clone Corp. Antibodies for DVL1
- Cloud-Clone Corp. Proteins for DVL1
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Invitrogen Antibodies for DVL1
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- Cyagen custom Knockout/knockin (KOKI) mouse models for DVL1
- VectorBuilder custom plasmid, inducible vectors for DVL1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for DVL1
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for DVL1
- antibodies-online: Search results for 88 available DVL1 Antibodies ranked by validation data
- Compare Top DVL1 Antibodies
- antibodies-online: Search results for 7 available DVL1 Elisa Kits ranked by validation data
- Compare Top DVL1 Elisa Kits
- antibodies-online: Search results for 9 available DVL1 Proteins ranked by validation data
- Compare Top DVL1 Proteins
- GeneTex DVL1 antibody for DVL1
- Search GeneTex for Proteins for DVL1
- ViGene Biosciences adenoviral particle packaged cDNA for DVL1 gene
- ViGene Biosciences lentiviral particle packaged cDNA for DVL1 gene
- ViGene Biosciences ready-to-package AAV shRNAs for DVL1 gene
- Search ViGene Biosciences for DVL1
- Santa Cruz Biotechnology (SCBT) Antibodies for DVL1
- Search Santa Cruz Biotechnology (SCBT) for DVL1 siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for DVL1
- Horizon Cell Lines for DVL1
- genomics-online: cdna clones - Search results for 93 available DVL1 gene related products
- Overview of 93 available DVL1 gene related products
- orf clones - Search results for 93 available DVL1 gene related products
- Overview of 93 available DVL1 gene related products
- genomics-online: gRNA clones - Search results for 93 available DVL1 gene related products
- Overview of 93 available DVL1 gene related products
- genomics-online: primer clones - Search results for 93 available DVL1 gene related products
- Overview of 93 available DVL1 gene related products
- genomics-online: shRNA clones - Search results for 93 available DVL1 gene related products
- Overview of 93 available DVL1 gene related products
Sources for DVL1 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew