Free for academic non-profit institutions. Other users need a Commercial license

Aliases for DPEP3 Gene

Aliases for DPEP3 Gene

  • Dipeptidase 3 2 3 5
  • EC 3.4.13.19 4 61
  • Testis Secretory Sperm-Binding Protein Li 211a 3
  • Metallopeptidase (Family M19) 3
  • Membrane-Bound Dipeptidase 3 3
  • MBD3 3

External Ids for DPEP3 Gene

Previous GeneCards Identifiers for DPEP3 Gene

  • GC16M067745
  • GC16M067785
  • GC16M066567
  • GC16M068009
  • GC16M053885

Summaries for DPEP3 Gene

Entrez Gene Summary for DPEP3 Gene

  • This gene encodes a membrane-bound glycoprotein from the family of dipeptidases involved in hydrolytic metabolism of various dipeptides, including penem and carbapenem beta-lactam antibiotics. This gene is located on chromosome 16 in a cluster with another member of this family. Alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

GeneCards Summary for DPEP3 Gene

DPEP3 (Dipeptidase 3) is a Protein Coding gene. Among its related pathways are Metabolism and Cytochrome P450 - arranged by substrate type. GO annotations related to this gene include peptidase activity and metalloexopeptidase activity. An important paralog of this gene is DPEP2.

UniProtKB/Swiss-Prot for DPEP3 Gene

  • Probable metalloprotease which hydrolyzes cystinyl-bis-glycine. May be involved in meiosis (By similarity).

Gene Wiki entry for DPEP3 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for DPEP3 Gene

Genomics for DPEP3 Gene

Regulatory Elements for DPEP3 Gene

Enhancers for DPEP3 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH16F067939 1.1 Ensembl ENCODE 18.8 +40.6 40559 1.2 USF1 ZFP64 CEBPG ZFHX2 POLR2A SCRT2 EGR2 PAF1 USF2 ZNF781 DPEP3 RANBP10 KIAA0895L DUS2 RNU6-359P PSKH1 C16orf86 ENKD1 NRN1L CENPT
GH16F068015 0.6 FANTOM5 13.1 -35.1 -35090 0.3 ESRRA RFX1 CREM SLC12A4 TSNAXIP1 DPEP3 NFATC3 C16orf86 GC16M068017 LOC100131303 RNU6-359P
GH16F068004 1.1 FANTOM5 Ensembl ENCODE 11.7 -25.4 -25372 4.0 HDGF PKNOX1 ATF1 ARID4B ZNF121 ZNF143 DEK REST SSRP1 MYNN DPEP2 NFATC3 DUS2 DPEP3 PSMB10 PRMT7 ACD PARD6A LCAT DDX28
GH16F067942 0.2 ENCODE 11.7 +37.0 37011 3.3 HDGF PKNOX1 MLX ARID4B ZNF48 YY1 ZNF143 KLF13 PAF1 SP5 DUS2 DPEP3 RNU6-359P PSKH1 C16orf86 ENKD1 NRN1L CENPT THAP11 NFATC3
GH16F067934 1 ENCODE 11.7 +44.6 44563 4.0 HDGF PKNOX1 ARNT MLX CREB3L1 ZFP64 ARID4B SIN3A FEZF1 ZNF2 DPEP3 NRN1L PSKH1 EDC4 DUS2 LCAT NFATC3 RANBP10 DPEP2 HSD11B2
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around DPEP3 on UCSC Golden Path with GeneCards custom track

Genomic Location for DPEP3 Gene

Chromosome:
16
Start:
67,975,663 bp from pter
End:
67,980,829 bp from pter
Size:
5,167 bases
Orientation:
Minus strand

Genomic View for DPEP3 Gene

Genes around DPEP3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
DPEP3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for DPEP3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for DPEP3 Gene

Proteins for DPEP3 Gene

  • Protein details for DPEP3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9H4B8-DPEP3_HUMAN
    Recommended name:
    Dipeptidase 3
    Protein Accession:
    Q9H4B8
    Secondary Accessions:
    • B3KQ48
    • Q6PEZ5
    • Q6UXE4

    Protein attributes for DPEP3 Gene

    Size:
    488 amino acids
    Molecular mass:
    53687 Da
    Cofactor:
    Name=Zn(2+); Xref=ChEBI:CHEBI:29105;
    Quaternary structure:
    • Homodimer; disulfide-linked.
    SequenceCaution:
    • Sequence=AAH57789.1; Type=Erroneous initiation; Evidence={ECO:0000305}; Sequence=BAG51910.1; Type=Erroneous initiation; Evidence={ECO:0000305}; Sequence=CAC15385.1; Type=Erroneous initiation; Evidence={ECO:0000305}; Sequence=EAW83198.1; Type=Erroneous initiation; Evidence={ECO:0000305};

neXtProt entry for DPEP3 Gene

Post-translational modifications for DPEP3 Gene

  • Glycosylation at Asn 334
  • Modification sites at PhosphoSitePlus

Other Protein References for DPEP3 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • Abcam antibodies for DPEP3
  • Cloud-Clone Corp. Antibodies for DPEP3
  • Santa Cruz Biotechnology (SCBT) Antibodies for DPEP3

Domains & Families for DPEP3 Gene

Protein Domains for DPEP3 Gene

Suggested Antigen Peptide Sequences for DPEP3 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q9H4B8

UniProtKB/Swiss-Prot:

DPEP3_HUMAN :
  • Belongs to the peptidase M19 family.
Family:
  • Belongs to the peptidase M19 family.
genes like me logo Genes that share domains with DPEP3: view

No data available for Gene Families for DPEP3 Gene

Function for DPEP3 Gene

Molecular function for DPEP3 Gene

UniProtKB/Swiss-Prot CatalyticActivity:
Hydrolysis of dipeptides.
UniProtKB/Swiss-Prot EnzymeRegulation:
Inhibited by L-penicillamine.
UniProtKB/Swiss-Prot Function:
Probable metalloprotease which hydrolyzes cystinyl-bis-glycine. May be involved in meiosis (By similarity).

Enzyme Numbers (IUBMB) for DPEP3 Gene

Gene Ontology (GO) - Molecular Function for DPEP3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008233 peptidase activity IEA --
GO:0008235 metalloexopeptidase activity IEA --
GO:0008237 metallopeptidase activity IEA --
GO:0008239 dipeptidyl-peptidase activity IEA --
GO:0016787 hydrolase activity IEA --
genes like me logo Genes that share ontologies with DPEP3: view
genes like me logo Genes that share phenotypes with DPEP3: view

Animal Model Products

  • Taconic Biosciences Mouse Models for DPEP3

Inhibitory RNA Products

Flow Cytometry Products

No data available for Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for DPEP3 Gene

Localization for DPEP3 Gene

Subcellular locations from UniProtKB/Swiss-Prot for DPEP3 Gene

Membrane; Lipid-anchor, GPI-anchor.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for DPEP3 Gene COMPARTMENTS Subcellular localization image for DPEP3 gene
Compartment Confidence
plasma membrane 2
cytosol 1
extracellular 1
mitochondrion 1
nucleus 1
peroxisome 1

Gene Ontology (GO) - Cellular Components for DPEP3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016020 membrane IEA --
GO:0031225 anchored component of membrane IEA --
genes like me logo Genes that share ontologies with DPEP3: view

Pathways & Interactions for DPEP3 Gene

genes like me logo Genes that share pathways with DPEP3: view

Interacting Proteins for DPEP3 Gene

Gene Ontology (GO) - Biological Process for DPEP3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006508 proteolysis IEA --
GO:0007140 male meiosis IEA,ISS --
GO:0051321 meiotic cell cycle IEA --
genes like me logo Genes that share ontologies with DPEP3: view

No data available for SIGNOR curated interactions for DPEP3 Gene

Transcripts for DPEP3 Gene

mRNA/cDNA for DPEP3 Gene

Unigene Clusters for DPEP3 Gene

Dipeptidase 3:
Representative Sequences:

Inhibitory RNA Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for DPEP3 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10
SP1:
SP2:

Relevant External Links for DPEP3 Gene

GeneLoc Exon Structure for
DPEP3
ECgene alternative splicing isoforms for
DPEP3

Expression for DPEP3 Gene

mRNA expression in normal human tissues for DPEP3 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for DPEP3 Gene

This gene is overexpressed in Testis (x39.8) and Whole Blood (x7.4).

Protein differential expression in normal tissues from HIPED for DPEP3 Gene

This gene is overexpressed in Ovary (54.4) and Testis (10.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for DPEP3 Gene



Protein tissue co-expression partners for DPEP3 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of DPEP3 Gene:

DPEP3

SOURCE GeneReport for Unigene cluster for DPEP3 Gene:

Hs.302028
genes like me logo Genes that share expression patterns with DPEP3: view

Primer Products

No data available for mRNA Expression by UniProt/SwissProt for DPEP3 Gene

Orthologs for DPEP3 Gene

This gene was present in the common ancestor of animals.

Orthologs for DPEP3 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia DPEP3 34 35
  • 97.86 (n)
dog
(Canis familiaris)
Mammalia DPEP3 34 35
  • 85.16 (n)
cow
(Bos Taurus)
Mammalia DPEP3 34 35
  • 81.07 (n)
rat
(Rattus norvegicus)
Mammalia Dpep3 34
  • 80.18 (n)
mouse
(Mus musculus)
Mammalia Dpep3 34 16 35
  • 79.58 (n)
oppossum
(Monodelphis domestica)
Mammalia -- 35
  • 60 (a)
OneToMany
platypus
(Ornithorhynchus anatinus)
Mammalia -- 35
  • 52 (a)
OneToMany
chicken
(Gallus gallus)
Aves -- 35
  • 51 (a)
OneToMany
lizard
(Anolis carolinensis)
Reptilia -- 35
  • 56 (a)
OneToMany
zebrafish
(Danio rerio)
Actinopterygii LOC100534995 34
  • 57.52 (n)
DPEP3 35
  • 49 (a)
OneToMany
fruit fly
(Drosophila melanogaster)
Insecta CG34420 34 35
  • 52.84 (n)
CG6154 35
  • 39 (a)
ManyToMany
CG5282 35
  • 23 (a)
ManyToMany
CG42750 35
  • 16 (a)
ManyToMany
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 50 (a)
ManyToMany
-- 35
  • 46 (a)
ManyToMany
Species where no ortholog for DPEP3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for DPEP3 Gene

ENSEMBL:
Gene Tree for DPEP3 (if available)
TreeFam:
Gene Tree for DPEP3 (if available)

Paralogs for DPEP3 Gene

Paralogs for DPEP3 Gene

(2) SIMAP similar genes for DPEP3 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with DPEP3: view

Variants for DPEP3 Gene

Sequence variations from dbSNP and Humsavar for DPEP3 Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
rs10658278 -- 67,980,874(+) TCATT(-/TC/TCA/TCATTTCATT/TCATTTCATTTCATTTCATT/TCATTTCCTT/TCATTTGATT)ATTTC upstream-variant-2KB
rs111294537 -- 67,982,131(+) GCCCT(C/T)GCTCC upstream-variant-2KB
rs111716502 -- 67,975,440(+) CTCCA(C/T)GAAGG downstream-variant-500B
rs111871076 -- 67,980,981(+) CGGGT(A/T)CAAGC upstream-variant-2KB
rs112171888 -- 67,979,623(+) CCCTG(C/T)GTGTC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for DPEP3 Gene

Variant ID Type Subtype PubMed ID
nsv522852 CNV gain 19592680
nsv524363 CNV loss 19592680

Variation tolerance for DPEP3 Gene

Residual Variation Intolerance Score: 65.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.92; 74.39% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for DPEP3 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
DPEP3

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for DPEP3 Gene

Disorders for DPEP3 Gene

Relevant External Links for DPEP3

Genetic Association Database (GAD)
DPEP3
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
DPEP3

No disorders were found for DPEP3 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for DPEP3 Gene

Publications for DPEP3 Gene

  1. Genome-wide association analysis of metabolic traits in a birth cohort from a founder population. (PMID: 19060910) Sabatti C. … Peltonen L. (Nat. Genet. 2009) 3 46 64
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4 64
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
  4. The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. (PMID: 12975309) Clark H.F. … Gray A.M. (Genome Res. 2003) 3 4 64
  5. Biological insights from 108 schizophrenia-associated genetic loci. (PMID: 25056061) (Nature 2014) 3 64

Products for DPEP3 Gene

Sources for DPEP3 Gene

Content
Loading form....