Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

DOCK2 Gene

protein-coding   GIFtS: 66
GCID: GC05P169064

Dedicator Of Cytokinesis 2

(Previous name: dedicator of cyto-kinesis 2)
Microbiology & Infectious Diseases Congress
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
Dedicator Of Cytokinesis 21 2
Dedicator Of Cyto-Kinesis 21 2
Dedicator Of Cytokinesis Protein 22
KIAA02093

External Ids:    HGNC: 29881   Entrez Gene: 17942   Ensembl: ENSG000001345167   OMIM: 6031225   UniProtKB: Q926083   

Export aliases for DOCK2 gene to outside databases

Previous GC identifers: GC05P169299 GC05P169767 GC05P168999 GC05P169045 GC05P168996 GC05P164162


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for DOCK2 Gene:
The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic
cells, predominantly in the peripheral blood leukocytes, and is involved in remodeling of the actin cytoskeleton
required for lymphocyte migration, through the activation of RAC. Mice lacking this gene show a severe impairment
in the migration and homing of lymphocytes. These mutant mice also exhibited long-term survival of allografts,
suggesting that this gene may be a target for controlling transplant rejection. (provided by RefSeq, Oct 2011)

GeneCards Summary for DOCK2 Gene: 
DOCK2 (dedicator of cytokinesis 2) is a protein-coding gene. Diseases associated with DOCK2 include b-cell lymphomas, and alzheimer's disease, and among its related super-pathways are HIV Infection and Development HGF signaling pathway. GO annotations related to this gene include Rac GTPase activator activity and electron carrier activity. An important paralog of this gene is DOCK4.

UniProtKB/Swiss-Prot: DOCK2_HUMAN, Q92608
Function: Involved in cytoskeletal rearrangements required for lymphocyte migration in response of chemokines.
Activates RAC1 and RAC2, but not CDC42, by functioning as a guanine nucleotide exchange factor (GEF), which
exchanges bound GDP for free GTP. May also participate in IL2 transcriptional activation via the activation of
RAC2

Gene Wiki entry for DOCK2 (Dock2) Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000005.9  NT_023133.13  NC_018916.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the DOCK2 gene promoter:
         USF1   AML1a   NRSF form 1   USF2   USF-1:USF-2   NRSF form 2   E2F-1   USF-1   c-Myb   ZIC2/Zic2   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidDOCK2 promoter sequence
   Search SABiosciences Chromatin IP Primers for DOCK2

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat DOCK2


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 5q35.1   Ensembl cytogenetic band:  5q35.1   HGNC cytogenetic band: 5q35.1

DOCK2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
DOCK2 gene location

GeneLoc information about chromosome 5         GeneLoc Exon Structure

GeneLoc location for GC05P169064:  view genomic region     (about GC identifiers)

Start:
169,064,251 bp from pter      End:
169,510,386 bp from pter
Size:
446,136 bases      Orientation:
plus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: DOCK2_HUMAN, Q92608 (See protein sequence)
Recommended Name: Dedicator of cytokinesis protein 2  
Size: 1830 amino acids; 211948 Da
Subunit: Homodimer (Probable). Interacts with RAC1 and RAC2. Interacts with CRKL and VAV. Interacts with CD3Z
Subcellular location: Endomembrane system; Peripheral membrane protein. Cytoplasm, cytoskeleton. Note=Colocalizes
with F-actin
Sequence caution: Sequence=BAA13200.1; Type=Erroneous initiation;
4 PDB 3D structures from and Proteopedia for DOCK2:
2RQR (3D)        2YIN (3D)        3A98 (3D)        3B13 (3D)    
Secondary accessions: Q2M3I0 Q96AK7
Alternative splicing: 2 isoforms:  Q92608-1   Q92608-2   (Splicing donor and acceptor sites between exon 6 and exon 7 are not canonical. No experimental confirmation available)

Explore the universe of human proteins at neXtProt for DOCK2: NX_Q92608

Explore proteomics data for DOCK2 at MOPED 

Post-translational modifications:

  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_Q92608

  • DOCK2 Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    DOCK2 Protein Expression
    REFSEQ proteins: NP_004937.1  
    ENSEMBL proteins: 
     ENSP00000256935   ENSP00000428850   ENSP00000429283   ENSP00000428841   ENSP00000393451  
     ENSP00000438827  
    Reactome Protein details: Q92608
    Human Recombinant Protein Products for DOCK2: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom MassSpec 
    OriGene Custom Protein Services for DOCK2
    GenScript Custom Purified and Recombinant Proteins Services for DOCK2
    Novus Biologicals DOCK2 Protein
    Novus Biologicals DOCK2 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for DOCK2 

    Gene Ontology (GO): 4 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005829cytosol TAS--
    GO:0005856cytoskeleton IEA--
    GO:0012505endomembrane system IEA--
    GO:0016020membrane IEA--

    DOCK2 for ontologies           About GeneDecksing



    DOCK2 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    R&D Systems Antibodies for DOCK2
    OriGene Antibodies for DOCK2
    OriGene Custom Antibody Services for DOCK2
    GenScript Custom Superior Antibodies Services for DOCK2
    Novus Biologicals DOCK2 Antibodies
    Abcam antibodies for DOCK2
    Cloud-Clone Corp. Antibodies for DOCK2 
    Search ThermoFisher Antibodies for DOCK2
    LSBio Antibodies in human, mouse, rat for DOCK2 

    Assay Products for DOCK2: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for DOCK2
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for DOCK2
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for DOCK2 
    Cloud-Clone Corp. CLIAs for DOCK2


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    5/8 InterPro protein domains (see all 8):
     IPR011511 SH3_2
     IPR027007 DHR-1_domain
     IPR026791 DOCK
     IPR026799 DOCK_A
     IPR001452 SH3_domain

    Graphical View of Domain Structure for InterPro Entry Q92608

    ProtoNet protein and cluster: Q92608

    3 Blocks protein domains:
    IPB001452 SH3 domain signature
    IPB010703 Dedicator of cytokinesis
    IPB011511 Variant SH3


    UniProtKB/Swiss-Prot: DOCK2_HUMAN, Q92608
    Domain: The DHR-2 domain may mediate the GEF activity (By similarity)
    Similarity: Belongs to the DOCK family
    Similarity: Contains 1 DHR-1 domain
    Similarity: Contains 1 DHR-2 domain
    Similarity: Contains 1 SH3 domain


    DOCK2 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: DOCK2_HUMAN, Q92608
    Function: Involved in cytoskeletal rearrangements required for lymphocyte migration in response of chemokines.
    Activates RAC1 and RAC2, but not CDC42, by functioning as a guanine nucleotide exchange factor (GEF), which
    exchanges bound GDP for free GTP. May also participate in IL2 transcriptional activation via the activation of
    RAC2

         Gene Ontology (GO): 5/10 molecular function terms (GO ID links to tree view) (see all 10):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005085guanyl-nucleotide exchange factor activity ----
    GO:0005488binding ----
    GO:0005515protein binding IPI12134158
    GO:0009055electron carrier activity ----
    GO:0016491oxidoreductase activity ----
         
    DOCK2 for ontologies           About GeneDecksing


    Phenotypes:
         1 GenomeRNAi human phenotype for DOCK2:
     Decreased mitotic index 

         6 MGI mutant phenotypes (inferred from 6 alleles(MGI details for Dock2):
     cellular  hematopoietic system  homeostasis/metabolism  immune system  mortality/aging 
     no phenotypic analysis 

    DOCK2 for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-out Dock2tm1Tsas for DOCK2

       inGenious Targeting Laboratory - Custom generated mouse model solutions for DOCK2 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for DOCK2

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for DOCK2 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for DOCK2 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat DOCK2
    8/17 QIAGEN miScript miRNA Assays for microRNAs that regulate DOCK2 (see all 17):
    hsa-miR-548j hsa-miR-548w hsa-miR-3163 hsa-miR-4291 hsa-miR-559 hsa-miR-3135 hsa-miR-548i hsa-miR-548h
    SwitchGear 3'UTR luciferase reporter plasmidDOCK2 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for DOCK2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat DOCK2

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for DOCK2
    Sirion Biotech Customized adenovirus for overexpression of DOCK2

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for DOCK2 (see all 5)
    OriGene ORF clones in mouse, rat for DOCK2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: DOCK2 (NM_004946)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for DOCK2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat DOCK2

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for DOCK2
    Search LifeMap BioReagents cell lines for DOCK2
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for DOCK2


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for DOCK2 About   (see all 10)                                                                                              See pathways by source

    SuperPathContained pathways About
    1HIV Life Cycle
    HIV Infection0.61
    Host Interactions of HIV factors0.60
    2Development HGF signaling pathway
    Development HGF signaling pathway0.78
    3Nef-mediates down modulation of cell surface receptors by recruiting them to clathrin adapters
    The role of Nef in HIV-1 replication and disease pathogenesis0.75
    4Platelet activation, signaling and aggregation
    Hemostasis0.43
    5Chemokine Signaling
    Chemokine signaling pathway0.33

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    1 EMD Millipore Pathway for DOCK2
        Development HGF signaling pathway


    1 GeneGo (Thomson Reuters) Pathway for DOCK2
        Development HGF signaling pathway

    1 BioSystems Pathway for DOCK2
        Regulation of RAC1 activity

    5/7        Reactome Pathways for DOCK2 (see all 7)
        Hemostasis
    Nef and signal transduction
    HIV Infection
    Factors involved in megakaryocyte development and platelet production
    The role of Nef in HIV-1 replication and disease pathogenesis


    2         Kegg Pathways  (Kegg details for DOCK2):
        Chemokine signaling pathway
    Fc gamma R-mediated phagocytosis


    DOCK2 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for DOCK2

    STRING Interaction Network Preview (showing 5 interactants - click image to see 16)

    5/601 Interacting proteins for DOCK2 (Q926082, 3 ENSP000002569354) via UniProtKB, MINT, STRING, and/or I2D (see all 601)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    RAC1P630002, 3, ENSP000003484614MINT-7306003 MINT-7305987 I2D: score=5 STRING: ENSP00000348461
    ELMO1Q925562, 3, ENSP000003121854MINT-7306003 I2D: score=2 STRING: ENSP00000312185
    CRKLP461093, ENSP000003463004I2D: score=3 STRING: ENSP00000346300
    RAC2P151533, ENSP000002490714I2D: score=3 STRING: ENSP00000249071
    VAV1P154983, ENSP000003022694I2D: score=3 STRING: ENSP00000302269
    About this table

    Gene Ontology (GO): 5/20 biological process terms (GO ID links to tree view) (see all 20):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0001766membrane raft polarization IEA--
    GO:0001768establishment of T cell polarity IEA--
    GO:0001771immunological synapse formation IEA--
    GO:0002277myeloid dendritic cell activation involved in immune response ISS--
    GO:0006935chemotaxis IEA--

    DOCK2 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for DOCK2

    3 HMDB Compounds for DOCK2    About this table
    CompoundSynonyms CAS #PubMed Ids
    Guanosine diphosphate5'-GDP (see all 10)146-91-8--
    Guanosine monophosphate5'-GMP (see all 14)85-32-5--
    Guanosine triphosphate5'-GTP (see all 10)86-01-1--

    Search CenterWatch for drugs/clinical trials and news about DOCK2

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for DOCK2 gene: 
    NM_004946.2  

    Unigene Cluster for DOCK2:

    Dedicator of cytokinesis 2
    Hs.586174  [show with all ESTs]
    Unigene Representative Sequence: NM_004946
    17 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000256935(uc003maf.3 uc011der.2) ENST00000522138 ENST00000524185(uc010jjl.1)
    ENST00000523684 ENST00000519734 ENST00000519223 ENST00000520908(uc010jjm.3)
    ENST00000520836 ENST00000520181 ENST00000519628 ENST00000523351 ENST00000522994
    ENST00000433448 ENST00000518056 ENST00000520450(uc003mah.3) ENST00000519868
    ENST00000540750
    Congresses - knowledge worth sharing:  
    European Congress of Clinical Microbiology and Infectious Diseases (ECCMID) 10 - 13 May 2014

    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat DOCK2
    8/17 QIAGEN miScript miRNA Assays for microRNAs that regulate DOCK2 (see all 17):
    hsa-miR-548j hsa-miR-548w hsa-miR-3163 hsa-miR-4291 hsa-miR-559 hsa-miR-3135 hsa-miR-548i hsa-miR-548h
    SwitchGear 3'UTR luciferase reporter plasmidDOCK2 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for DOCK2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat DOCK2
    Clone
    Products:
         
    OriGene clones in human, mouse for DOCK2 (see all 5)
    OriGene ORF clones in mouse, rat for DOCK2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: DOCK2 (NM_004946)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for DOCK2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat DOCK2
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for DOCK2
    OriGene qSTAR qPCR primer pairs in human, mouse for DOCK2
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat DOCK2
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat DOCK2
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat DOCK2

    Additional mRNA sequence: 

    AK128107.1 BC016996.1 BC035613.1 BC084556.1 BC104900.1 BC113457.1 BC143358.1 D86964.1 

    8 DOTS entries:

    DT.445570  DT.86837400  DT.99969909  DT.120870237  DT.40112931  DT.86841153  DT.91977500  DT.99999258 

    24/123 AceView cDNA sequences (see all 123):

    BM720910 CD689721 AI660773 BM452581 AA812175 AA311420 AA360867 BQ059375 
    AA748841 AI660796 BC016996 AK128449 D86964 AK128107 AL560031 BC035613 
    BU624362 AI904057 BQ063157 BX484435 BQ214354 BG036603 BM676997 BQ055414 

    GeneLoc Exon Structure

    5/6 Alternative Splicing Database (ASD) splice patterns (SP) for DOCK2 (see all 6)    About this scheme

    ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15 ^ 16 ^ 17 ^ 18 ^ 19 ^ 20 ^ 21 ^ 22 ^ 23 ^ 24 ^ 25 ^ 26a ·
    SP1:                                                                                      -                                                                 -   
    SP2:                                                                                                        -                                               -   
    SP3:                                                                                                                                                            
    SP4:                                                                                                                                                            
    SP5:                                                                                                                                                            

    ExUns: 26b ^ 27 ^ 28a · 28b ^ 29a · 29b ^ 30 ^ 31 ^ 32 ^ 33 ^ 34 ^ 35 ^ 36 ^ 37 ^ 38 ^ 39a · 39b ^ 40a · 40b ^ 41 ^ 42 ^ 43 ^ 44 ^ 45a · 45b ^ 46 ^
    SP1:                                                  -                                         -                                               -               
    SP2:                    -                             -                                         -                                               -               
    SP3:                                                                                                                                                            
    SP4:                                                                                                                                                            
    SP5:                                                                                                                                                            

    ExUns: 47 ^ 48 ^ 49 ^ 50 ^ 51 ^ 52 ^ 53 ^ 54
    SP1:                                                
    SP2:                                                
    SP3:                                                
    SP4:                                                
    SP5:                                                


    ECgene alternative splicing isoforms for DOCK2

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    DOCK2 expression in normal human tissues (normalized intensities)      DOCK2 embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: GTGGATGAGG
    DOCK2 Expression
    About this image


    DOCK2 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/17 selected tissues (see all 17) fully expand
     
     Blood (Hematopoietic System)    fully expand to see all 9 entries
             Hematopoietic Stem Cells Hematopoietic Bone Marrow
             Fetal Liver CD36+ Cells   
     
     Lymph (Hematopoietic System)    fully expand to see all 3 entries
             lymph node ; non-germinal center cells   
             Lymphnode   
     
     Tonsil (Hematopoietic System)    fully expand to see all 3 entries
             tonsil ; squamous epithelial cells   
     
     Epithelium (Uncategorized)    fully expand to see all 3 entries
             vagina ; squamous epithelial cells   
     
     Testis (Reproductive System)    fully expand to see all 2 entries
             seminal vesicle ; glandular cells   

    See DOCK2 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for DOCK2

    SOURCE GeneReport for Unigene cluster: Hs.586174

    UniProtKB/Swiss-Prot: DOCK2_HUMAN, Q92608
    Tissue specificity: Specifically expressed in hematopoietic cells. Highly expressed in peripheral blood
    leukocytes, and expressed at intermediate level in thymus and spleen. Expressed at very low level in the small
    intestine and colon

        SABiosciences Expression via Pathway-Focused PCR Array including DOCK2: 
              Inflammatory Response & Autoimmunity 384HT in human mouse rat

    Primer
    Products:
    OriGene qPCR primer pairs and template standards for DOCK2
    OriGene qSTAR qPCR primer pairs in human, mouse for DOCK2
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat DOCK2
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat DOCK2
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat DOCK2
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for DOCK2

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals and fungi.

    Orthologs for DOCK2 gene from 7/15 species (see all 15)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Dock21 , 5 dedicator of cyto-kinesis 21, 5 89.66(n)1
    95.19(a)1
      11 (19.68 cM)5
    941761  NM_033374.21  NP_203538.21 
     342268155 
    chicken
    (Gallus gallus)
    Aves DOCK21 dedicator of cytokinesis 2 76.71(n)
    86.32(a)
      427612  XM_425184.3  XP_425184.3 
    lizard
    (Anolis carolinensis)
    Reptilia DOCK26
    dedicator of cytokinesis 2
    83(a)
    1 ↔ 1
    2(120131201-120505507)
    zebrafish
    (Danio rerio)
    Actinopterygii DOCK26
    Uncharacterized protein
    65(a)
    1 ↔ 1
    14(1444373-1582759)
    fruit fly
    (Drosophila melanogaster)
    Insecta mbc3 larval visceral muscle development 40(a)     --
    worm
    (Caenorhabditis elegans)
    Secernentea ced-56
    Protein CED-5
    23(a)
    1 → many
    IV(10484110-10492952)
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes YLR422W6
    Protein of unknown function with similarity to hum...
    13(a)
    1 → many
    XII(965897-971695)


    ENSEMBL Gene Tree for DOCK2 (if available)
    TreeFam Gene Tree for DOCK2 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for DOCK2 gene
    DOCK42  DOCK32  DOCK12  DOCK52  
    7 SIMAP similar genes for DOCK2 using alignment to 7 protein entries:     DOCK2_HUMAN (see all proteins):
    DKFZp779M164    DKFZp781J211    DOCK1    DOCK5    DOCK3    SORBS3
    DOCK4

    DOCK2 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/7068 SNPs in DOCK2 are shown (see all 7068)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 5 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1893675201,2
    --169062321(+) TTTTGC/TTTTCT 1 -- us2k10--------
    rs1806950941,2
    --169062599(+) ATTAGC/TTGACA 1 -- us2k10--------
    rs720970011,2
    C--169062762(+) ATGTG-/TATATAT 1 -- us2k10--------
    rs1506131871,2
    C--169062765(+) GTATA-/TATATATATATATA
    TGCATATATGTATGTG
    TATAT
    1 -- cds10--------
    rs1455364501,2
    C--169062797(+) ATGTG-/TATATA
            
    TATAT
    1 -- cds10--------
    rs681823501,2
    C--169062798(+) TGTGT-/TA/   
      TATATA
    ATATA
    2 -- us2k1 cds10--------
    rs595946401,2
    C--169062802(+) TATAT-/ATATAT/ATATATATATGCA
    TATATGTATGTGTATATATATAT
    GCATA
    2 -- cds10--------
    rs356371581,2
    C--169062838(+) TATGT-/ATG   
      T
    /TATG
    GTATA
    1 -- us2k10--------
    rs1872177951,2
    --169062860(+) ATGCAC/TATATG 1 -- us2k10--------
    rs721136281,2
    C--169062874(+) GTATG-/TATGTGT 1 -- us2k10--------

    HapMap Linkage Disequilibrium report for DOCK2 (169064251 - 169314251 bp, first 250kb of DOCK2)

    Structural Variations
         Database of Genomic Variants (DGV) 10/17 variations for DOCK2 (see all 17):    About this table     
    Variant IDTypeSubtypePubMed ID
    esv2731056CNV Deletion23290073
    esv2731060CNV Deletion23290073
    dgv1055e199CNV Deletion23128226
    esv2678882CNV Deletion23128226
    esv2731058CNV Deletion23290073
    esv2731059CNV Deletion23290073
    esv2731057CNV Deletion23290073
    esv988430CNV Insertion20482838
    esv273090CNV Insertion20981092
    nsv328128CNV Loss16902084

    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing DOCK2
    DNA2.0 Custom Variant and Variant Library Synthesis for DOCK2

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 603122    OMIM disorders: --

    5 diseases for DOCK2:    About MalaCards
    b-cell lymphomas    alzheimer's disease    prostate cancer    prostatitis
    leukemia


    DOCK2 for disorders           About GeneDecksing


    Congresses - knowledge worth sharing:  
    Alzheimer's & Parkinson's Diseases Congress (ADPD) 18 - 22 March 2015
    Genetic Association Database (GAD): DOCK2
    Human Genome Epidemiology (HuGE) Navigator: DOCK2 (5 documents)

    Export disorders for DOCK2 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for DOCK2 gene, integrated from 9 sources (see all 47):
    (articles sorted by number of sources associating them with DOCK2)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. DOCK2 associates with CrkL and regulates Rac1 in human leukemia cell lines. (PubMed id 12393632)1, 2, 9 Nishihara H....Tanaka S. (2002)
    2. Non-adherent cell-specific expression of DOCK2, a member of the human CDM-family proteins. (PubMed id 10559471)1, 2, 9 Nishihara H.... Matsuda M. (1999)
    3. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PubMed id 20379614)1, 4 Rose J.E....Uhl G.R. (2010)
    4. Human Variation in Alcohol Response Is Influenced by Variation in Neuronal Signaling Genes. (PubMed id 20201926)1, 4 Joslyn G....White R.L. (2010)
    5. Variation at the NFATC2 locus increases the risk of t hiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipr il and rosiglitazone Medication (DREAM) study. (PubMed id 20628086)1, 4 Bailey S.D....Anand S. (2010)
    6. A genome-wide association study identifies protein quantitative trait loci (pQTLs). (PubMed id 18464913)1, 4 Melzer D....Ferrucci L. (2008)
    7. Robust phosphoproteomic profiling of tyrosine phosphorylation sites from human T cells using immobilized metal affinity chromatography and tandem mass spectrometry. (PubMed id 15144186)1, 2 Brill L.M....Peters E.C. (2004)
    8. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    9. Identification of an evolutionarily conserved superfamily of DOCK180- related proteins with guanine nucleotide exchange activity. (PubMed id 12432077)1, 2 Cote J.-F. and Vuori K. (2002)
    10. DOCK2 mediates T cell receptor-induced activation of Rac2 and IL-2 transcription. (PubMed id 12176041)1, 2 Nishihara H....Tanaka S. (2002)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 1794 HGNC: 2988 AceView: DOCK2 Ensembl:ENSG00000134516 euGenes: HUgn1794
    ECgene: DOCK2 Kegg: 1794 H-InvDB: DOCK2

    (According to HUGE)
    About This Section
    HUGE: KIAA0209

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for DOCK2 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for DOCK2 gene:
    Search GeneIP for patents involving DOCK2

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Antibodies for DOCK2 (DOCK2)   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for DOCK2   OriGene RNAi products in human, mouse, rat for DOCK2  
     OriGene qPCR primer pairs and template standards for DOCK2   Browse OriGene Protein Over-expression Lysates  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for DOCK2  
     OriGene qSTAR qPCR primer pairs in human, mouse for DOCK2   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for DOCK2   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for DOCK2   OriGene Custom Protein Services for DOCK2  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat DOCK2
     QIAGEN SeqTarget long-range PCR primers for resequencing DOCK2
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat DOCK2
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat DOCK2
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat DOCK2
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat DOCK2
     GenScript Custom Purified and Recombinant Proteins Services for DOCK2 GenScript cDNA clones with any tag delivered in your preferred vector for DOCK2
     GenScript Custom Assay Services for DOCK2 GenScript Custom Superior Antibodies Services for DOCK2
     GenScript Custom overexpressing Cell Line Services for DOCK2 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in DOCK2 promoter
     Search Chromatin IP Primers for DOCK2
     RT2 qPCR Primer Assay in human, mouse, rat DOCK2
     GNC Network for DOCK2
     SABiosciences PCR Arrays including human, mouse, rat DOCK2
     Search Tocris compounds for DOCK2
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     DOCK2 antibodies
     DOCK2 proteins
     DOCK2 lysates
     Antibodies for DOCK2
     See all of Abcam's Antibodies, Kits and Proteins for DOCK2
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Proteins for DOCK2
     Antibodies for DOCK2
     ELISAs for DOCK2
     CLIAs for DOCK2
     Search LifeMap BioReagents cell lines for DOCK2
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for DOCK2
     SwitchGear 3'UTR luciferase reporter plasmids for DOCK2
     SwitchGear Promoter luciferase reporter plasmids for DOCK2
     Search ThermoFisher Antibodies for DOCK2
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat DOCK2
     inGenious Targeting Laboratory - Custom generated mouse model solutions for DOCK2
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for DOCK2
    Customized:
     lentivirus for stable overexpression
     lentivirus expression plasmids for stable overexpression
     adenovirus for overexpression of DOCK2
     LSBio Antibodies in human, mouse, rat for DOCK2
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      DOCK2 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4