Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

DMPK Gene

protein-coding   GIFtS: 68
GCID: GC19M046272

Dystrophia Myotonica-Protein Kinase

Microbiology & Infectious Diseases Congress
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
Dystrophia Myotonica-Protein Kinase1 2     MDPK2 3
DMK2 3 5     MT-PK2 3
DM Protein Kinase1 2     DM1 Protein Kinase2 3
Myotonic Dystrophy Associated Protein Kinase1 2     EC 2.7.11.13 8
Myotonin Protein Kinase A1 2     DM2 5
Thymopoietin Homolog1 2     Dystrophia Myotonica 11
Myotonic Dystrophy Protein Kinase2 3     DM12
DM-kinase2 3     Myotonin-Protein Kinase2
DM1PK2 3     

External Ids:    HGNC: 29331   Entrez Gene: 17602   Ensembl: ENSG000001049367   OMIM: 6053775   UniProtKB: Q090133   

Export aliases for DMPK gene to outside databases

Previous GC identifers: GC19M046916 GC19M046663 GC19M050949 GC19M050964 GC19M042701


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for DMPK Gene:
The protein encoded by this gene is a serine-threonine kinase that is closely related to other kinases that
interact with members of the Rho family of small GTPases. Substrates for this enzyme include myogenin, the
beta-subunit of the L-type calcium channels, and phospholemman. The 3' untranslated region of this gene contains
5-37 copies of a CTG trinucleotide repeat. Expansion of this unstable motif to 50-5,000 copies causes myotonic
dystrophy type I, which increases in severity with increasing repeat element copy number. Repeat expansion is
associated with condensation of local chromatin structure that disrupts the expression of genes in this region.
Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of
some of these variants has not been determined. (provided by RefSeq, Jul 2008)

GeneCards Summary for DMPK Gene: 
DMPK (dystrophia myotonica-protein kinase) is a protein-coding gene. Diseases associated with DMPK include myotonic dystrophy, and congenital myotonic dystrophy, and among its related super-pathways are Cytoskeleton remodeling CDC42 in cellular processes. GO annotations related to this gene include myosin phosphatase regulator activity and protein serine/threonine kinase activity. An important paralog of this gene is CDC42BPG.

UniProtKB/Swiss-Prot: DMPK_HUMAN, Q09013
Function: Non-receptor serine/threonine protein kinase which is necessary for the maintenance of skeletal muscle
structure and function. May play a role in myocyte differentiation and survival by regulating the integrity of
the nuclear envelope and the expression of muscle-specific genes. May also phosphorylate PPP1R12A and inhibit the
myosin phosphatase activity to regulate myosin phosphorylation. Also critical to the modulation of cardiac
contractility and to the maintenance of proper cardiac conduction activity probably through the regulation of
cellular calcium homeostasis. Phosphorylates PLN, a regulator of calcium pumps and may regulate sarcoplasmic
reticulum calcium uptake in myocytes. May also phosphorylate FXYD1/PLM which is able to induce chloride currents.
May also play a role in synaptic plasticity

Gene Wiki entry for DMPK (Myotonin-protein kinase) Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000019.9  NT_011109.16  NC_018930.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the DMPK gene promoter:
         SRF   SRF (504 AA)   Nkx2-5   NF-kappaB1   NF-kappaB   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidDMPK promoter sequence
   Search SABiosciences Chromatin IP Primers for DMPK

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat DMPK


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 19q13.3   Ensembl cytogenetic band:  19q13.32   HGNC cytogenetic band: 19q13.3

DMPK Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
DMPK gene location

GeneLoc information about chromosome 19         GeneLoc Exon Structure

GeneLoc location for GC19M046272:  view genomic region     (about GC identifiers)

Start:
46,272,975 bp from pter      End:
46,285,815 bp from pter
Size:
12,841 bases      Orientation:
minus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: DMPK_HUMAN, Q09013 (See protein sequence)
Recommended Name: Myotonin-protein kinase  
Size: 629 amino acids; 69385 Da
Cofactor: Magnesium
Subunit: Homodimer; homodimerization stimulates the kinase activity. Interacts with HSPB2; may enhance DMPK kinase
activity. Interacts with PLN; phosphorylates PLN. May interact with RAC1; may regulate DMPK kinase activity.
Interacts with LMNA; may regulate nuclear envelope stability
Subcellular location: Endoplasmic reticulum membrane; Single-pass type IV membrane protein; Cytoplasmic side (By
similarity). Nucleus outer membrane; Single-pass type IV membrane protein; Cytoplasmic side (Probable).
Mitochondrion outer membrane; Single-pass type IV membrane protein (Probable). Sarcoplasmic reticulum membrane
(By similarity). Cell membrane (By similarity). Cytoplasm, cytosol (By similarity). Note=Localizes to
sarcoplasmic reticulum membranes of cardiomyocytes (By similarity)
Subcellular location: Isoform 1: Mitochondrion membrane
Subcellular location: Isoform 3: Mitochondrion membrane
Sequence caution: Sequence=AAA64884.1; Type=Frameshift; Positions=56, 555, 568; Sequence=AAA87583.1;
Type=Miscellaneous discrepancy; Note=Probable cloning artifact;
2 PDB 3D structures from and Proteopedia for DMPK:
1WT6 (3D)        2VD5 (3D)    
Secondary accessions: Q16205 Q6P5Z6
Alternative splicing: 12 isoforms:  Q09013-9   Q09013-11   Q09013-16   Q09013-15   Q09013-10   Q09013-12   Q09013-1   Q09013-2   
Q09013-5   Q09013-6   Q09013-7   Q09013-8   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for DMPK: NX_Q09013

Explore proteomics data for DMPK at MOPED 

Post-translational modifications:

  • UniProtKB: Phosphorylated. Autophosphorylates. Phosphorylation by RAF1 may result in activation of DMPK
  • UniProtKB: Proteolytic processing of the C-terminus may remove the transmembrane domain and release the kinase from membranes
    stimulating its activity
  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_Q09013

  • 4/7 DME Specific Peptides for DMPK (Q09013) (see all 7)
     RIPAEMA  DIKPDNI  KVIGRGAF  HRDIKPDN 

    DMPK Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    DMPK Protein Expression
    REFSEQ proteins (4 alternative transcripts): 
    NP_001075029.1  NP_001075031.1  NP_001075032.1  NP_004400.4  

    ENSEMBL proteins: 
     ENSP00000291270   ENSP00000468013   ENSP00000472965   ENSP00000345997   ENSP00000413417  
     ENSP00000401753   ENSP00000346168   ENSP00000469220   ENSP00000471832   ENSP00000470192  

    Human Recombinant Protein Products for DMPK: 
    EMD Millipore Purified and/or Recombinant DMPK Protein
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Proteins for DMPK
    OriGene Protein Over-expression Lysate for DMPK
    OriGene MassSpec for DMPK 
    OriGene Custom Protein Services for DMPK
    GenScript Custom Purified and Recombinant Proteins Services for DMPK
    Novus Biologicals DMPK Protein
    Novus Biologicals DMPK Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for DMPK 

    Gene Ontology (GO): 5/7 cellular component terms (GO ID links to tree view) (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005640nuclear outer membrane IEA--
    GO:0005789endoplasmic reticulum membrane ISS--
    GO:0005829cytosol ISS--
    GO:0005886plasma membrane ISS--
    GO:0031307integral to mitochondrial outer membrane IDA15684391

    DMPK for ontologies           About GeneDecksing



    DMPK Antibody Products: 
    EMD Millipore Mono- and Polyclonal Antibodies for the study of DMPK
    R&D Systems Antibodies for DMPK
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for DMPK
    GenScript Custom Superior Antibodies Services for DMPK
    Novus Biologicals DMPK Antibodies
    Abcam antibodies for DMPK
    Cloud-Clone Corp. Antibodies for DMPK 
    Search ThermoFisher Antibodies for DMPK
    LSBio Antibodies in human, mouse, rat for DMPK 

    Assay Products for DMPK: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for DMPK
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for DMPK
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for DMPK 
    Cloud-Clone Corp. CLIAs for DMPK


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    IUPHAR Guide to PHARMACOLOGY protein family classification: dystrophia myotonica-protein kinase 
    GEK subfamily
    Other AGC kinases

    5/7 InterPro protein domains (see all 7):
     IPR017441 Protein_kinase_ATP_BS
     IPR002290 Ser/Thr_dual-sp_kinase_dom
     IPR014930 Myotonic_dystrophy_kinase_coil
     IPR011009 Kinase-like_dom
     IPR008271 Ser/Thr_kinase_AS

    Graphical View of Domain Structure for InterPro Entry Q09013

    ProtoNet protein and cluster: Q09013

    1 Blocks protein domain: IPB000961 Protein kinase C-terminal domain

    UniProtKB/Swiss-Prot: DMPK_HUMAN, Q09013
    Domain: The coiled coil domain is required for homodimerization and regulates the enzymatic activity
    Similarity: Belongs to the protein kinase superfamily. AGC Ser/Thr protein kinase family. DMPK subfamily
    Similarity: Contains 1 AGC-kinase C-terminal domain
    Similarity: Contains 1 protein kinase domain


    DMPK for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: DMPK_HUMAN, Q09013
    Function: Non-receptor serine/threonine protein kinase which is necessary for the maintenance of skeletal muscle
    structure and function. May play a role in myocyte differentiation and survival by regulating the integrity of
    the nuclear envelope and the expression of muscle-specific genes. May also phosphorylate PPP1R12A and inhibit the
    myosin phosphatase activity to regulate myosin phosphorylation. Also critical to the modulation of cardiac
    contractility and to the maintenance of proper cardiac conduction activity probably through the regulation of
    cellular calcium homeostasis. Phosphorylates PLN, a regulator of calcium pumps and may regulate sarcoplasmic
    reticulum calcium uptake in myocytes. May also phosphorylate FXYD1/PLM which is able to induce chloride currents.
    May also play a role in synaptic plasticity
    Catalytic activity: ATP + a protein = ADP + a phosphoprotein
    Enzyme regulation: Coiled-coil-mediated oligomerization enhances the catalytic activity. Proteolytic processing of
    the C-terminus may release the protein from membranes and constitute a mean to regulate the enzyme. May be
    regulated by HSPB2, RAC1, RAF1 and G-protein second messengers

         Genatlas biochemistry entry for DMPK:
    myotonin protein kinase,72kDa (DMR-B15 homolog) modulator of the Ca++ homeostasis in skeletal muscle cells
    presenting a replication discrepancy between the normal and the mutant allele in cells with the CTG repeat
    expansion,involved in the organization of sarcoplasmic reticulum in skeletal muscle,binding and activated by
    HSPB2

         Enzyme Number (IUBMB): EC 2.7.11.11 2

         Gene Ontology (GO): 5/8 molecular function terms (GO ID links to tree view) (see all 8):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004672protein kinase activity ----
    GO:0004674protein serine/threonine kinase activity IDA10913253
    GO:0004713protein tyrosine kinase activity ----
    GO:0005515protein binding IPI15598648
    GO:0005524ATP binding IDA10913253
         
    DMPK for ontologies           About GeneDecksing


    Phenotypes:
         6 GenomeRNAi human phenotypes for DMPK:
     Decreased focal adhesion (FA)   Decreased substrate adherent c  Decreased telomerase activity  Decreased viability 
     Lamellipodia and high actin ra  Weaker migration 

         4 MGI mutant phenotypes (inferred from 3 alleles(MGI details for Dmpk):
     cardiovascular system  homeostasis/metabolism  muscle  normal 

    DMPK for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-outs for DMPK: Dmpktm1Rdd Dmpktm1Bew

       inGenious Targeting Laboratory - Custom generated mouse model solutions for DMPK 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for DMPK

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for DMPK 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for DMPK 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat DMPK
    8/12 QIAGEN miScript miRNA Assays for microRNAs that regulate DMPK (see all 12):
    hsa-miR-4264 hsa-miR-206 hsa-miR-615-5p hsa-miR-148b hsa-miR-1 hsa-miR-152 hsa-miR-214* hsa-miR-491-5p
    SwitchGear 3'UTR luciferase reporter plasmidDMPK 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for DMPK
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat DMPK

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for DMPK
    Sirion Biotech Customized adenovirus for overexpression of DMPK

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for DMPK (see all 23)
    OriGene ORF clones in mouse, rat for DMPK
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 4): DMPK (NM_004409)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for DMPK
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat DMPK
    Sirion Biotech Customized lentivirus for stable overexpression of DMPK 
                         Customized lentivirus expression plasmids for stable overexpression of DMPK 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for DMPK
    Search LifeMap BioReagents cell lines for DMPK
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for DMPK


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for DMPK About                                                                                                See pathways by source

    SuperPathContained pathways About
    1Cytoskeleton remodeling CDC42 in cellular processes
    G-protein signaling RAC1 in cellular process0.37

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    1 EMD Millipore Pathway for DMPK
        G-protein signaling RAC1 in cellular process


    1 GeneGo (Thomson Reuters) Pathway for DMPK
        G-protein signaling RAC1 in cellular process



    DMPK for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for DMPK

    STRING Interaction Network Preview (showing 5 interactants - click image to see 14)

    5/21 Interacting proteins for DMPK (Q090131, 2, 3 ENSP000003459974) via UniProtKB, MINT, STRING, and/or I2D (see all 21)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    PPP1R12AO149742, 3, ENSP000002612074MINT-15299 MINT-8150223 I2D: score=4 STRING: ENSP00000261207
    ATXN1P542532, 3, ENSP000002447694MINT-2858053 MINT-2858072 I2D: score=3 STRING: ENSP00000244769
    PLNP266781, 3, ENSP000003501324EBI-692774,EBI-692836 I2D: score=2 STRING: ENSP00000350132
    SMN1Q166372, 3MINT-8271047 I2D: score=2 
    SMN2Q166372, 3MINT-8271047 I2D: score=2 
    About this table

    Gene Ontology (GO): 5/11 biological process terms (GO ID links to tree view) (see all 11):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0002028regulation of sodium ion transport IEA--
    GO:0006468protein phosphorylation IDA10913253
    GO:0006874cellular calcium ion homeostasis ISS--
    GO:0006998nuclear envelope organization IMP--
    GO:0008016regulation of heart contraction IDA15598648

    DMPK for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    DMPK for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for DMPK

    3 HMDB Compounds for DMPK    About this table
    CompoundSynonyms CAS #PubMed Ids
    ADPadenosindiphosphorsaeure (see all 8)58-64-0--
    Adenosine triphosphate5'-(tetrahydrogen triphosphate) Adenosine (see all 24)56-65-5--
    MagnesiumMagnesium (see all 2)7439-95-4--

    1 DrugBank Compound for DMPK    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    3-[1-(3-Aminopropyl)-1h-Indol-3-Yl]-4-(1-Methyl-1h-Indol-3-Yl)-1h-Pyrrole-2,5-Dione-- --target--10592235

    10/18 Novoseek inferred chemical compound relationships for DMPK gene (see all 18)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    threonine 44.9 11 8281152 (1), 9092543 (1), 14502294 (1), 7726160 (1) (see all 10)
    serine 31.9 11 8281152 (1), 9092543 (1), 14502294 (1), 7726160 (1) (see all 10)
    hinfi 31.6 3 11216395 (2), 9589858 (1)
    chloride 17.8 4 7826272 (1), 8784800 (1), 9436436 (1), 18213585 (1)
    agarose 11.3 1 18925718 (1)
    zinc 9.79 7 20458885 (1), 19909263 (1), 15652222 (1)
    ryanodine 5.23 1 15598648 (1)
    glucose 4.91 4 17987120 (1), 12704419 (1)
    thymine 4.49 1 7826272 (1)
    oligonucleotide 0 3 9225761 (1), 8630033 (1)

    Search CenterWatch for drugs/clinical trials and news about DMPK

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for DMPK gene (4 alternative transcripts): 
    NM_001081560.1  NM_001081562.1  NM_001081563.1  NM_004409.3  

    Unigene Cluster for DMPK:

    Dystrophia myotonica-protein kinase
    Hs.631596  [show with all ESTs]
    Unigene Representative Sequence: AB209363
    18/19 Ensembl transcripts including schematic representations, and UCSC links where relevant (see all 19):
    ENST00000291270(uc010xxs.1 uc002pdf.1 uc002pdi.1) ENST00000588522
    ENST00000596686 ENST00000600757 ENST00000343373(uc002pdd.1 uc002pde.1 uc010xxu.1)
    ENST00000447742(uc021uwb.1 uc002pdh.1) ENST00000458663(uc002pdg.1 uc010xxt.1)
    ENST00000598272 ENST00000354227 ENST00000593574 ENST00000597660 ENST00000600370
    ENST00000595361 ENST00000599002 ENST00000598191 ENST00000596920 ENST00000598180
    ENST00000596067
    Congresses - knowledge worth sharing:  
    European Congress of Clinical Microbiology and Infectious Diseases (ECCMID) 10 - 13 May 2014

    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat DMPK
    8/12 QIAGEN miScript miRNA Assays for microRNAs that regulate DMPK (see all 12):
    hsa-miR-4264 hsa-miR-206 hsa-miR-615-5p hsa-miR-148b hsa-miR-1 hsa-miR-152 hsa-miR-214* hsa-miR-491-5p
    SwitchGear 3'UTR luciferase reporter plasmidDMPK 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for DMPK
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat DMPK
    Clone
    Products:
         
    OriGene clones in human, mouse for DMPK (see all 23)
    OriGene ORF clones in mouse, rat for DMPK
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 4): DMPK (NM_004409)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for DMPK
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat DMPK
    Sirion Biotech Customized lentivirus for stable overexpression of DMPK 
                         Customized lentivirus expression plasmids for stable overexpression of DMPK 
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for DMPK
    OriGene qSTAR qPCR primer pairs in human, mouse for DMPK
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat DMPK
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat DMPK
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat DMPK

    Additional mRNA sequence: 

    AB209363.1 AK297299.1 AK302874.1 AK304749.1 BC026328.1 BC062553.1 L19268.1 M87312.1 
    M87313.1 M94203.1 S72883.1 S86455.1 U46546.1 

    18 DOTS entries:

    DT.455347  DT.100747111  DT.102833828  DT.92433916  DT.100821277  DT.92433917  DT.91740962  DT.95308838 
    DT.100821286  DT.121497746  DT.75134000  DT.75109007  DT.92433919  DT.100821287  DT.91708539  DT.121497739 
    DT.91997205  DT.97839664 

    24/311 AceView cDNA sequences (see all 311):

    CD106470 AI123378 AW295677 BX419830 AL047391 BQ188269 BQ878344 BM709254 
    BM966765 BX420052 U46546 BC041034 BM665068 AI637944 BM677303 AU122224 
    BF724333 BM737690 BM696765 BM893545 BQ185710 AI751790 CF136022 BI770992 

    GeneLoc Exon Structure

    5/10 Alternative Splicing Database (ASD) splice patterns (SP) for DMPK (see all 10)    About this scheme

    ExUns: 1a · 1b · 1c ^ 2a · 2b · 2c ^ 3 ^ 4a · 4b ^ 5a · 5b ^ 6a · 6b ^ 7 ^ 8a · 8b ^ 9a · 9b ^ 10a · 10b ^ 11a · 11b ^ 12a · 12b ^ 13 ^ 14 ^
    SP1:                    -     -                 -                 -     -                                         -                                             
    SP2:                    -     -     -           -                 -     -                                   -     -                                             
    SP3:                    -     -     -           -                 -     -                                         -                                             
    SP4:                    -     -     -           -                 -     -                                   -     -                                             
    SP5:                                            -                 -     -                                   -     -                                             

    ExUns: 15 ^ 16a · 16b
    SP1:                  
    SP2:                  
    SP3:                  
    SP4:                  
    SP5:                  


    ECgene alternative splicing isoforms for DMPK

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    DMPK expression in normal human tissues (normalized intensities)      DMPK embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: ACGCCCTGCT
    DMPK Expression
    About this image


    DMPK expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/7 selected tissues (see all 7) fully expand
     
     Eye (Sensory Organs)    fully expand to see all 3 entries
             retinal progenitor cell e12.5   
     
     Skeletal Muscle (Muscoskeletal System)    fully expand to see all 2 entries
             skeletal muscle ; myocytes   
             pectoral girdle and thoracic body wall/skeletal muscle   
     
     Smooth Muscle (Muscoskeletal System)
             smooth muscle ; smooth muscle cells   
     
     Blood (Hematopoietic System)
             Granulocytes Peripheral Blood
     
     Fibroblast
             Human Dermal Fibroblasts-adult (HDF-a)   

    See DMPK Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for DMPK

    SOURCE GeneReport for Unigene cluster: Hs.631596

    UniProtKB/Swiss-Prot: DMPK_HUMAN, Q09013
    Tissue specificity: Most isoforms are expressed in many tissues including heart, skeletal muscle, liver and brain,
    except for isoform 2 which is only found in the heart and skeletal muscle, and isoform 14 which is only found in
    the brain, with high levels in the striatum, cerebellar cortex and pons

        SABiosciences Expression via Pathway-Focused PCR Array including DMPK: 
              Skeletal Muscle: Myogenesis & Myopathy in human mouse rat

    Primer
    Products:
    OriGene qPCR primer pairs and template standards for DMPK
    OriGene qSTAR qPCR primer pairs in human, mouse for DMPK
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat DMPK
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat DMPK
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat DMPK
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for DMPK

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals and fungi.

    Orthologs for DMPK gene from 6/12 species (see all 12)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Dmpk1 , 5 dystrophia myotonica-protein kinase1, 5 86.55(n)1
    87.08(a)1
      7 (9.46 cM)5
    134001  NM_032418.21  NP_115794.11 
     190838495 
    lizard
    (Anolis carolinensis)
    Reptilia DMPK6
    Uncharacterized protein
    63(a)
    1 ↔ 1
    GL343962.1(77395-105178)
    zebrafish
    (Danio rerio)
    Actinopterygii DMPK6
    dystrophia myotonica-protein kinase
    74(a)
    1 ↔ 1
    10(366481-368914)
    fruit fly
    (Drosophila melanogaster)
    Insecta gek6
    genghis khan
    14(a)
    1 → many
    2R(19979600-19986157)
    worm
    (Caenorhabditis elegans)
    Secernentea mrck-16
    Protein MRCK-1
    15(a)
    1 → many
    V(6257401-6267191)
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes CBK16
    Serine/threonine protein kinase of the the RAM sig...
    20(a)
    1 → many
    XIV(332597-334867)


    ENSEMBL Gene Tree for DMPK (if available)
    TreeFam Gene Tree for DMPK (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for DMPK gene
    CDC42BPG2  LATS12  CDC42BPB2  STK38L2  STK382  MASTL2  CIT2  ROCK12  
    CDC42BPA2  LATS22  ROCK22  
    18/38 SIMAP similar genes for DMPK using alignment to 10 protein entries:     DMPK_HUMAN (see all proteins) (see all similar genes):
    PRKCZ    CIT    SGK3    CDC42BPA    CDC42BPB    STK38L
    CDC42BPG    PRKCE    KIN27    ROCK2    RPS6KA3    PDPK1
    RPS6KA2    ROCK1    RPS6KA1    STK32A    PRKACB    STK32C

    DMPK for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/400 SNPs in DMPK are shown (see all 400)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 19 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0404524
    A lung small cell carcinoma sample4--see VAR_0404522 L V mis40--------
    rs1441316941,2
    C--46273463(+) CCCCC-/CAGCAGCAGCAGCAGCAGCAG
    CAGCAGCAGCAGCAGCAGCAGCAG
    CAGCA
    4 -- cds10--------
    rs612903351,2
    C--46273524(+) CAGCA-/GCAGCAGCAGCAGCAGCA/GCAGCAGCAGCA
    GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
    TTCCC
    8 -- cds11NA 2
    rs1885986891,2
    C--46274551(+) CCAGGA/GAGGGG 4 -- int10--------
    rs1126935901,2
    C,F--46274553(+) AGGGAG/AGGGAT 4 -- int12Minor allele frequency- A:0.03NA EU 381
    rs2020711191,2
    C--46274593(+) GGGAAA/GGAGAG 4 -- int10--------
    rs1466802401,2
    C,F--46274624(+) GATCCG/ATGGCC 8 /T /M mis12Minor allele frequency- A:0.01NA EU 5093
    rs1402313031,2
    C--46274650(+) CCCGTA/GACAGC 8 V syn10--------
    rs2013388911,2
    --46274701(+) AAGGAA/GGGCGG 4 -- int10--------
    rs1931298991,2
    --46274739(+) CTTCCC/TTCCTC 4 -- int10--------

    HapMap Linkage Disequilibrium report for DMPK (46272975 - 46285815 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 10/15 variations for DMPK (see all 15):    About this table     
    Variant IDTypeSubtypePubMed ID
    esv2718637CNV Deletion23290073
    esv2718636CNV Deletion23290073
    esv2718638CNV Deletion23290073
    esv2718635CNV Deletion23290073
    esv2718639CNV Deletion23290073
    esv2465515CNV Deletion19546169
    esv2718641CNV Deletion23290073
    dgv3957n71CNV Loss21882294
    nsv912166CNV Loss21882294
    dgv3956n71CNV Loss21882294


    Human Gene Mutation Database (HGMD): DMPK
    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing DMPK
    DNA2.0 Custom Variant and Variant Library Synthesis for DMPK

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 605377   
    OMIM disorders: 160900  
    UniProtKB/Swiss-Prot: DMPK_HUMAN, Q09013
  • Dystrophia myotonica 1 (DM1) [MIM:160900]: A muscular disorder characterized by myotonia, muscle wasting
    in the distal extremities, cataract, hypogonadism, defective endocrine functions, male baldness and cardiac
    arrhythmias. Note=The disease is caused by mutations affecting the gene represented in this entry. The causative
    mutation is a CTG expansion in the 3'-UTR of the DMPK gene. A length exceeding 50 CTG repeats is pathogenic,
    while normal individuals have 5 to 37 repeats. Intermediate alleles with 35-49 triplets are not disease-causing
    but show instability in intergenerational transmissions. Disease severity varies with the number of repeats:
    mildly affected persons have 50 to 150 repeats, patients with classic DM have 100 to 1,000 repeats, and those
    with congenital onset can have more than 2,000 repeats

  • 20/33 diseases for DMPK (see all 33):    About MalaCards
    myotonic dystrophy    congenital myotonic dystrophy    myotonic dystrophy type 1    3-methylglutaconic aciduria type 3
    myotonic dystrophy type 2    3-methylglutaconic aciduria    myotonia    spinal-bulbar muscular atrophy
    optic atrophy    neuromuscular disease    hypogonadism    craniosynostosis
    mitochondrial disorders    myasthenia gravis    hypertrophic cardiomyopathy    thymoma
    peripheral neuropathy    muscular atrophy    cataract    muscular dystrophy

    2 diseases from the University of Copenhagen DISEASES database for DMPK:
    Myotonic dystrophy     Neuropathy

    DMPK for disorders           About GeneDecksing

    10/22 Novoseek inferred disease relationships for DMPK gene (see all 22)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    myotonic dystrophy 98.5 614 9607721 (9), 9535904 (5), 9276336 (5), 9811941 (4) (see all 99)
    promm 85.6 10 7826272 (4), 8784800 (1), 10665666 (1)
    myotonic disorders 84.1 5 7826272 (1), 9207101 (1), 9829272 (1), 15317754 (1)
    myotonic dystrophy congenital 80.6 3 11807903 (1), 8930628 (1), 12598332 (1)
    myotonic muscular dystrophy 80.1 6 7825566 (1), 7738201 (1), 10811636 (1)
    muscular dystrophies 78 11 9094985 (1), 18213585 (1), 11260612 (1), 19127114 (1) (see all 5)
    neuromuscular diseases 77.7 25 10970838 (1), 10480373 (1), 12150945 (1), 17549748 (1) (see all 17)
    defect conduction 69.5 4 11726559 (1), 8784800 (1), 10802667 (1), 10936001 (1)
    cataract 58 12 8784800 (2), 10802667 (2), 7826272 (1), 12630069 (1) (see all 8)
    conduction abnormalities 57.1 4 8784800 (1), 10021468 (1), 10802667 (1), 12397222 (1)

    GeneTests: DMPK
    GeneReviews: DMPK
    Genetic Association Database (GAD): DMPK
    Human Genome Epidemiology (HuGE) Navigator: DMPK (26 documents)

    Export disorders for DMPK gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for DMPK gene, integrated from 9 sources (see all 298):
    (articles sorted by number of sources associating them with DMPK)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. An unstable triplet repeat in a gene related to myotonic muscular dystrophy. (PubMed id 1546326)1, 2, 3 Fu Y.H....de Jong P. (1992)
    2. Phospholemman is a substrate for myotonic dystrophy protein kinase. (PubMed id 10811636)1, 2, 9 Mounsey J.P....Moorman J.R. (2000)
    3. Myotonic dystrophy protein kinase domains mediate localization, oligomerization, novel catalytic activity, and autoinhibition. (PubMed id 10913253)1, 2, 9 Bush E.W.... Perryman M.B. (2000)
    4. Homodimerization through coiled-coil regions enhances activity of the myotonic dystrophy protein kinase. (PubMed id 12832055)1, 2, 9 Zhang R. and Epstein H.F. (2003)
    5. Rac-1 and Raf-1 kinases, components of distinct signaling pathways, activate myotonic dystrophy protein kinase. (PubMed id 10869570)1, 2, 9 Shimizu M....Epstein H.F. (2000)
    6. Myotonic dystrophy protein kinase phosphorylates phospholamban and regulates calcium uptake in cardiomyocyte sarcoplasmic reticulum. (PubMed id 15598648)1, 2, 9 Kaliman P.... Ruiz-Lozano P. (2005)
    7. Divergent mitochondrial and endoplasmic reticulum association of DMPK splice isoforms depends on unique sequence arrangements in tail anchors. (PubMed id 15684391)1, 2, 9 van Herpen R.E....Wansink D.G. (2005)
    8. Myotonic dystrophy protein kinase phosphorylates the myosin phosphatase targeting subunit and inhibits myosin phosphatase activity. (PubMed id 11287000)1, 2, 9 Muranyi A....Hartshorne D.J. (2001)
    9. MKBP, a novel member of the small heat shock protein family, binds and activates the myotonic dystrophy protein kinase. (PubMed id 9490724)1, 2, 9 Suzuki A....Ohno S. (1998)
    10. Structure of dystrophia myotonica protein kinase. (PubMed id 19309729)1, 2, 9 Elkins J.M....Knapp S. (2009)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 1760 HGNC: 2933 AceView: DMPKandSIX5andDMWD Ensembl:ENSG00000104936 euGenes: HUgn1760
    ECgene: DMPK H-InvDB: DMPK

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for DMPK Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for DMPK Genetics and Cytogenetics in Oncology and Haematology
    GeneReviewshttp://www.ncbi.nlm.nih.gov/sites/GeneTests/lab/gene/DMPK

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for DMPK gene:
    Search GeneIP for patents involving DMPK

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     EMD Millipore Purified and/or Recombinant DMPK Protein
     Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     Browse Small Molecules at EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of DMPK
     Browse for Gene Knock-down Tools from EMD Millipore
     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Antibodies for DMPK (DMPK)   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for DMPK  
     OriGene qPCR primer pairs and template standards for DMPK   OriGene Protein Over-expression Lysate for DMPK  
     OriGene MassSpec something-or-other for DMPK   OriGene clones in human, mouse for DMPK  
     OriGene qSTAR qPCR primer pairs in human, mouse for DMPK   OriGene Purified Protein for DMPK  
     OriGene ORF clones in mouse, rat for DMPK   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for DMPK   OriGene Custom Protein Services for DMPK  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat DMPK
     QIAGEN SeqTarget long-range PCR primers for resequencing DMPK
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat DMPK
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat DMPK
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat DMPK
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat DMPK
     GenScript Custom Purified and Recombinant Proteins Services for DMPK GenScript cDNA clones with any tag delivered in your preferred vector for DMPK
     GenScript Custom Assay Services for DMPK GenScript Custom Superior Antibodies Services for DMPK
     GenScript Custom overexpressing Cell Line Services for DMPK CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in DMPK promoter
     Search Chromatin IP Primers for DMPK
     RT2 qPCR Primer Assay in human, mouse, rat DMPK
     GNC Network for DMPK
     SABiosciences PCR Arrays including human, mouse, rat DMPK
     Search Tocris compounds for DMPK
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     DMPK antibodies
     DMPK proteins
     DMPK lysates
     Antibodies for DMPK
     See all of Abcam's Antibodies, Kits and Proteins for DMPK
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Proteins for DMPK
     Antibodies for DMPK
     ELISAs for DMPK
     CLIAs for DMPK
     Search LifeMap BioReagents cell lines for DMPK
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for DMPK
     SwitchGear 3'UTR luciferase reporter plasmids for DMPK
     SwitchGear Promoter luciferase reporter plasmids for DMPK
     Search ThermoFisher Antibodies for DMPK
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat DMPK
     inGenious Targeting Laboratory - Custom generated mouse model solutions for DMPK
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for DMPK
    Customized:
     lentivirus for stable overexpression of DMPK
     lentivirus expression plasmids for stable overexpression of DMPK
     adenovirus for overexpression of DMPK
     LSBio Antibodies in human, mouse, rat for DMPK
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      DMPK gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4