Free for academic non-profit institutions. Other users need a Commercial license

Aliases for DHRS9 Gene

Aliases for DHRS9 Gene

  • Dehydrogenase/Reductase 9 2 3 5
  • NADP-Dependent Retinol Dehydrogenase/Reductase 2 3 4
  • 3-Alpha Hydroxysteroid Dehydrogenase 2 3 4
  • Tracheobronchial Epithelial Cell-Specific Retinol Dehydrogenase 3 4
  • Short Chain Dehydrogenase/Reductase Family 9C Member 4 3 4
  • Dehydrogenase/Reductase (SDR Family) Member 9 2 3
  • Short-Chain Dehydrogenase/Reductase RetSDR8 3 4
  • Retinol Dehydrogenase Homolog 2 3
  • Retinol Dehydrogenase 15 3 4
  • 3-Alpha-HSD 3 4
  • RDH-TBE 3 4
  • RDH-E2 3 4
  • SDR9C4 3 4
  • RDH15 3 4
  • RDHL 3 4
  • Short Chain Dehydrogenase/Reductase Family 9C, Member 4 2
  • Dehydrogenase/Reductase SDR Family Member 9 3
  • EC 56
  • 3ALPHA-HSD 3
  • EC 1.1.-.- 4
  • EC 1.1.1 56
  • RETSDR8 3
  • RDHTBE 3

External Ids for DHRS9 Gene

Previous GeneCards Identifiers for DHRS9 Gene

  • GC02P170123
  • GC02P169746
  • GC02P169629
  • GC02P169921
  • GC02P161819

Summaries for DHRS9 Gene

Entrez Gene Summary for DHRS9 Gene

  • This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. This protein demonstrates oxidoreductase activity toward hydroxysteroids and is able to convert 3-alpha-tetrahydroprogesterone to dihydroxyprogesterone and 3-alpha-androstanediol to dihydroxyprogesterone in the cytoplasm, and may additionally function as a transcriptional repressor in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

GeneCards Summary for DHRS9 Gene

DHRS9 (Dehydrogenase/Reductase 9) is a Protein Coding gene. Among its related pathways are the visual cycle I (vertebrates) and Metabolism. Gene Ontology (GO) annotations related to this gene include oxidoreductase activity and alcohol dehydrogenase (NAD) activity. An important paralog of this gene is RDH16.

UniProtKB/Swiss-Prot for DHRS9 Gene

  • 3-alpha-hydroxysteroid dehydrogenase that converts 3-alpha-tetrahydroprogesterone (allopregnanolone) to dihydroxyprogesterone and 3-alpha-androstanediol to dihydroxyprogesterone. May play a role in the biosynthesis of retinoic acid from retinaldehyde, but seems to have low activity with retinoids. Can utilize both NADH and NADPH.

Gene Wiki entry for DHRS9 Gene

Additional gene information for DHRS9 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for DHRS9 Gene

Genomics for DHRS9 Gene

GeneHancer (GH) Regulatory Elements for DHRS9 Gene

Promoters and enhancers for DHRS9 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH02I169069 Promoter/Enhancer 1.9 EPDnew FANTOM5 Ensembl ENCODE 581.9 +7.3 7271 5.7 HDGF ATF1 PKNOX1 FOXA2 ARNT YY1 TCF12 ZNF766 ATF7 FOS DHRS9 PPIG ENSG00000235321 ABCB11 PHOSPHO2
GH02I169066 Promoter/Enhancer 1 EPDnew Ensembl 557.4 +2.7 2694 1.4 ATF4 CEBPG ZBTB33 KLF4 ATF2 FOXA1 DHRS9 ENSG00000235321 ABCB11
GH02I169037 Enhancer 1.2 FANTOM5 Ensembl ENCODE 25 -26.4 -26375 0.8 HDAC1 PKNOX1 ZBTB40 BATF CHAMP1 TCF12 RXRA ZNF184 SMARCA4 GMEB1 DHRS9 ABCB11
GH02I169036 Enhancer 0.7 FANTOM5 Ensembl 39.5 -27.7 -27703 0.6 HMBOX1 EGR2 DHRS9 ABCB11
GH02I169105 Enhancer 0.9 Ensembl ENCODE 26.6 +42.1 42121 3.2 HDAC1 PKNOX1 TEAD4 CEBPG FEZF1 POLR2A ZSCAN29 ATF7 NFE2 RUNX3 DHRS9 UBE2V1P6 ENSG00000235321
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around DHRS9 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the DHRS9 gene promoter:

Genomic Locations for DHRS9 Gene

Genomic Locations for DHRS9 Gene
31,379 bases
Plus strand

Genomic View for DHRS9 Gene

Genes around DHRS9 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
DHRS9 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for DHRS9 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for DHRS9 Gene

Proteins for DHRS9 Gene

  • Protein details for DHRS9 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Dehydrogenase/reductase SDR family member 9
    Protein Accession:
    Secondary Accessions:
    • B7Z416
    • D3DPC1
    • Q5RKX1
    • Q9NRA9
    • Q9NRB0

    Protein attributes for DHRS9 Gene

    319 amino acids
    Molecular mass:
    35227 Da
    Quaternary structure:
    • Homotetramer.

    Alternative splice isoforms for DHRS9 Gene


neXtProt entry for DHRS9 Gene

Selected DME Specific Peptides for DHRS9 Gene


Post-translational modifications for DHRS9 Gene

No Post-translational modifications

Domains & Families for DHRS9 Gene

Gene Families for DHRS9 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins
  • Predicted membrane proteins
  • Predicted secreted proteins

Protein Domains for DHRS9 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the short-chain dehydrogenases/reductases (SDR) family.
  • Belongs to the short-chain dehydrogenases/reductases (SDR) family.
genes like me logo Genes that share domains with DHRS9: view

Function for DHRS9 Gene

Molecular function for DHRS9 Gene

UniProtKB/Swiss-Prot BiophysicochemicalProperties:
Kinetic parameters: KM=9 uM for NADH {ECO:0000269 PubMed:11294878}; KM=72 uM for NAD {ECO:0000269 PubMed:11294878}; KM=5 uM for allopregnanolone {ECO:0000269 PubMed:11294878}; KM=7.5 uM for 3-alpha-androstanediol {ECO:0000269 PubMed:11294878}; KM=24 uM for androsterone {ECO:0000269 PubMed:11294878}; KM=12 uM for dihydrotestosterone {ECO:0000269 PubMed:11294878};
UniProtKB/Swiss-Prot Function:
3-alpha-hydroxysteroid dehydrogenase that converts 3-alpha-tetrahydroprogesterone (allopregnanolone) to dihydroxyprogesterone and 3-alpha-androstanediol to dihydroxyprogesterone. May play a role in the biosynthesis of retinoic acid from retinaldehyde, but seems to have low activity with retinoids. Can utilize both NADH and NADPH.

Enzyme Numbers (IUBMB) for DHRS9 Gene

Phenotypes From GWAS Catalog for DHRS9 Gene

Gene Ontology (GO) - Molecular Function for DHRS9 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004022 alcohol dehydrogenase (NAD) activity IDA 11304534
GO:0004745 retinol dehydrogenase activity IEA,TAS --
GO:0016491 oxidoreductase activity IEA --
GO:0016854 racemase and epimerase activity NAS 11294878
GO:0047035 testosterone dehydrogenase (NAD+) activity IDA 11294878
genes like me logo Genes that share ontologies with DHRS9: view
genes like me logo Genes that share phenotypes with DHRS9: view

Animal Models for DHRS9 Gene

MGI Knock Outs for DHRS9:

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

No data available for Human Phenotype Ontology , miRNA , Transcription Factor Targets and HOMER Transcription for DHRS9 Gene

Localization for DHRS9 Gene

Subcellular locations from UniProtKB/Swiss-Prot for DHRS9 Gene

Microsome membrane. Endoplasmic reticulum membrane. Note=Associated with microsomal membranes.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for DHRS9 gene
Compartment Confidence
endoplasmic reticulum 5
extracellular 2
nucleus 2
cytosol 2
mitochondrion 1

Gene Ontology (GO) - Cellular Components for DHRS9 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005783 endoplasmic reticulum IEA --
GO:0005789 endoplasmic reticulum membrane TAS --
GO:0016020 membrane IEA --
GO:0030176 integral component of endoplasmic reticulum membrane IDA 11294878
GO:0031090 organelle membrane IEA --
genes like me logo Genes that share ontologies with DHRS9: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for DHRS9 Gene

Pathways & Interactions for DHRS9 Gene

genes like me logo Genes that share pathways with DHRS9: view

Interacting Proteins for DHRS9 Gene

Gene Ontology (GO) - Biological Process for DHRS9 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008209 androgen metabolic process IDA 11294878
GO:0030855 epithelial cell differentiation NAS 11304534
GO:0042448 progesterone metabolic process IDA 11294878
GO:0042572 retinol metabolic process NAS 11304534
GO:0042904 9-cis-retinoic acid biosynthetic process IDA 11304534
genes like me logo Genes that share ontologies with DHRS9: view

No data available for SIGNOR curated interactions for DHRS9 Gene

Drugs & Compounds for DHRS9 Gene

(21) Drugs for DHRS9 Gene - From: HMDB and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
NADH Approved Nutra 0

(28) Additional Compounds for DHRS9 Gene - From: Novoseek and HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • 2'-(Dihydrogen phosphate) 5'-(trihydrogen pyrophosphate) Adenosine 5'-ester with 1,4-dihydro-1-b-D-ribofuranosylnicotinamide
  • 2'-(Dihydrogen phosphate) 5'-(trihydrogen pyrophosphate) Adenosine 5'-ester with 1,4-dihydro-1-beta-delta-ribofuranosylnicotinamide
  • Adenosine 5'-(trihydrogen diphosphate) 2'-(dihydrogen phosphate) P'-5'-ester with 1,4-dihydro-1-beta-D-ribofuranosyl-3-pyridinecarboxamide
  • Adenosine 5'-(trihydrogen diphosphate) 2'-(dihydrogen phosphate) P'-5'-ester with 1,4-dihydro-1-beta-delta-ribofuranosyl-3-pyridinecarboxamide
  • b-NADPH
  • (3alpha,5alpha)-3-hydroxy-Androstan-17-one
  • (3R,5S,8R,9S,10S,13S,14S)-3-hydroxy-10,13-dimethyl-1,2,3,4,5,6,7,8,9,11,12,14,15,16-tetradecahydrocyclopenta[a]phenanthren-17-one
  • 3-alpha-Hydroxy-17-androstanone
  • 3-alpha-Hydroxy-5-alpha-androstan-17-one
  • 3-alpha-Hydroxy-5-alpha-androstane-17-one
  • Adenine-nicotinamide dinucleotide phosphate
  • b-NADP
  • b-Nicotinamide adenine dinucleotide phosphate
  • b-TPN
  • beta-NADP
genes like me logo Genes that share compounds with DHRS9: view

Transcripts for DHRS9 Gene

Unigene Clusters for DHRS9 Gene

Dehydrogenase/reductase (SDR family) member 9:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for DHRS9 Gene

ExUns: 1a · 1b ^ 2a · 2b · 2c ^ 3 ^ 4a · 4b ^ 5a · 5b ^ 6a · 6b ^ 7a · 7b · 7c · 7d ^ 8a · 8b · 8c ^ 9a · 9b ^ 10a · 10b
SP1: - -
SP2: - - - - - - -
SP3: - - - - -
SP5: -
SP6: - - -
SP7: - - - - -
SP8: - - - - - -
SP9: - -
SP10: - - - - - - - -

Relevant External Links for DHRS9 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for DHRS9 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for DHRS9 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for DHRS9 Gene

This gene is overexpressed in Whole Blood (x15.8), Colon - Transverse (x11.3), and Heart - Atrial Appendage (x5.8).

Protein differential expression in normal tissues from HIPED for DHRS9 Gene

This gene is overexpressed in Nasal epithelium (61.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for DHRS9 Gene

NURSA nuclear receptor signaling pathways regulating expression of DHRS9 Gene:


SOURCE GeneReport for Unigene cluster for DHRS9 Gene:


mRNA Expression by UniProt/SwissProt for DHRS9 Gene:

Tissue specificity: Highly expressed in trachea and epidermis. Detected at lower levels in spinal cord, bone marrow, brain, tongue, esophagus, heart, colon, testis, placenta, lung, skeletal muscle and lymph node.

Evidence on tissue expression from TISSUES for DHRS9 Gene

  • Liver(4.5)
  • Intestine(4.4)
  • Lung(4.4)
  • Skin(4.4)
  • Nervous system(4.4)
  • Heart(4.2)
  • Eye(4)
  • Kidney(2.3)
genes like me logo Genes that share expression patterns with DHRS9: view

Primer Products

No data available for Protein tissue co-expression partners and Phenotype-based relationships between genes and organs from Gene ORGANizer for DHRS9 Gene

Orthologs for DHRS9 Gene

This gene was present in the common ancestor of chordates.

Orthologs for DHRS9 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia DHRS9 33 34
  • 99.58 (n)
(Canis familiaris)
Mammalia DHRS9 33 34
  • 88.92 (n)
(Bos Taurus)
Mammalia DHRS9 33 34
  • 88.31 (n)
(Rattus norvegicus)
Mammalia Dhrs9 33
  • 86.62 (n)
(Mus musculus)
Mammalia Dhrs9 33 16 34
  • 86 (n)
(Monodelphis domestica)
Mammalia DHRS9 34
  • 77 (a)
(Ornithorhynchus anatinus)
Mammalia DHRS9 34
  • 72 (a)
(Gallus gallus)
Aves RDH5 33
  • 66.13 (n)
DHRS9 34
  • 56 (a)
(Anolis carolinensis)
Reptilia DHRS9 34
  • 56 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia dhrs9 33
  • 62.49 (n)
African clawed frog
(Xenopus laevis)
Amphibia rdhl-prov 33
(Danio rerio)
Actinopterygii rdh1 34
  • 44 (a)
Species where no ortholog for DHRS9 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for DHRS9 Gene

Gene Tree for DHRS9 (if available)
Gene Tree for DHRS9 (if available)

Paralogs for DHRS9 Gene

Paralogs for DHRS9 Gene

(8) SIMAP similar genes for DHRS9 Gene using alignment to 4 proteins:

genes like me logo Genes that share paralogs with DHRS9: view

Variants for DHRS9 Gene

Sequence variations from dbSNP and Humsavar for DHRS9 Gene

SNP ID Clin Chr 02 pos Variation AA Info Type
rs1000154418 -- 169,087,703(+) TAATGAATTTTGCTAGGACTAAT/TAAT intron_variant
rs1000237067 -- 169,088,087(+) G/T intron_variant
rs1000253814 -- 169,069,907(+) C/T genic_upstream_transcript_variant, intron_variant
rs1000332330 -- 169,082,476(+) T/A intron_variant
rs1000392200 -- 169,085,543(+) C/T intron_variant

Structural Variations from Database of Genomic Variants (DGV) for DHRS9 Gene

Variant ID Type Subtype PubMed ID
esv2762961 CNV gain 21179565
nsv528457 CNV gain 19592680

Variation tolerance for DHRS9 Gene

Residual Variation Intolerance Score: 81.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.45; 54.81% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for DHRS9 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for DHRS9 Gene

Disorders for DHRS9 Gene

Additional Disease Information for DHRS9

No disorders were found for DHRS9 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for DHRS9 Gene

Publications for DHRS9 Gene

  1. Characterization of a novel type of human microsomal 3alpha -hydroxysteroid dehydrogenase: unique tissue distribution and catalytic properties. (PMID: 11294878) Chetyrkin SV … Kedishvili NY (The Journal of biological chemistry 2001) 2 3 4 22 58
  2. Characterization of a novel airway epithelial cell-specific short chain alcohol dehydrogenase/reductase gene whose expression is up-regulated by retinoids and is involved in the metabolism of retinol. (PMID: 11304534) Soref CM … Wu R (The Journal of biological chemistry 2001) 2 3 4 58
  3. The SDR (short-chain dehydrogenase/reductase and related enzymes) nomenclature initiative. (PMID: 19027726) Persson B … Oppermann U (Chemico-biological interactions 2009) 2 3 58
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  5. The tumor suppressor adenomatous polyposis coli and caudal related homeodomain protein regulate expression of retinol dehydrogenase L. (PMID: 15190067) Jette C … Jones DA (The Journal of biological chemistry 2004) 3 22 58

Products for DHRS9 Gene

Sources for DHRS9 Gene

Loading form....