Free for academic non-profit institutions. Other users need a Commercial license

Aliases for DHFR Gene

Aliases for DHFR Gene

  • Dihydrofolate Reductase 2 3 5
  • EC 1.5.1.3 4 61
  • DHFRP1 3
  • DYR 3

External Ids for DHFR Gene

Previous GeneCards Identifiers for DHFR Gene

  • GC05M078744
  • GC05M080160
  • GC05M079960
  • GC05M080006
  • GC05M079957
  • GC05M079922

Summaries for DHFR Gene

Entrez Gene Summary for DHFR Gene

  • Dihydrofolate reductase converts dihydrofolate into tetrahydrofolate, a methyl group shuttle required for the de novo synthesis of purines, thymidylic acid, and certain amino acids. While the functional dihydrofolate reductase gene has been mapped to chromosome 5, multiple intronless processed pseudogenes or dihydrofolate reductase-like genes have been identified on separate chromosomes. Dihydrofolate reductase deficiency has been linked to megaloblastic anemia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]

GeneCards Summary for DHFR Gene

DHFR (Dihydrofolate Reductase) is a Protein Coding gene. Diseases associated with DHFR include Megaloblastic Anemia Due To Dihydrofolate Reductase Deficiency and Plasmodium Falciparum Malaria. Among its related pathways are E2F mediated regulation of DNA replication and Mitotic G1-G1/S phases. GO annotations related to this gene include mRNA binding and NADP binding. An important paralog of this gene is DHFR2.

UniProtKB/Swiss-Prot for DHFR Gene

  • Key enzyme in folate metabolism. Contributes to the de novo mitochondrial thymidylate biosynthesis pathway. Catalyzes an essential reaction for de novo glycine and purine synthesis, and for DNA precursor synthesis. Binds its own mRNA and that of DHFRL1.

Tocris Summary for DHFR Gene

  • Dihydrofolate reductase (DHFR) is a member of the reductase family of enzymes that is ubiquitously expressed in all organisms. It catalyzes tetrahydrofolate regeneration by reduction of dihydrofolate, using NADPH as a cofactor. DHFR has a key role in cell growth and proliferation.

Gene Wiki entry for DHFR Gene

No data available for PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for DHFR Gene

Genomics for DHFR Gene

Regulatory Elements for DHFR Gene

Enhancers for DHFR Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH05F080654 1.1 ENCODE 68.6 +0.2 245 3.8 HDGF ATF1 ARID4B SIN3A DMAP1 ZNF48 YY1 ELK1 GATA2 ZNF143 DHFR MSH3
GH05F080667 1 Ensembl ENCODE 62.2 -13.5 -13466 1.2 TBP PKNOX1 ZNF644 DNMT3B RARA YY1 POLR2A HNF4G GATAD2A NFIA DHFR MSH3 ENSG00000248967
GH05F080754 1 Ensembl ENCODE 45.4 -101.6 -101578 3.9 PKNOX1 FEZF1 EBF1 POLR2A CBX5 EED ETV6 NR2F6 CREM MTA2 DHFR MSH3 ENSG00000248967 GC05P080808
GH05F080629 0.6 Ensembl 66.6 +25.4 25383 0.8 CTCF CBX8 RNF2 SMC3 PRDM1 RAD21 DHFR ENSG00000249655 LINC01337
GH05F080607 0.7 ENCODE 21.7 +46.9 46933 0.3 SOX13 ELF3 SAP130 ARID4B ZNF644 RARA MAFK HOMEZ CREM FOXA3 DHFR ANKRD34B DBIP2 GC05M080611
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around DHFR on UCSC Golden Path with GeneCards custom track

Promoters for DHFR Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00001284004 482 3000 HDGF ATF1 ARID4B SIN3A DMAP1 ZNF48 YY1 ELK1 GATA2 ZNF143

Genomic Location for DHFR Gene

Chromosome:
5
Start:
80,626,226 bp from pter
End:
80,654,983 bp from pter
Size:
28,758 bases
Orientation:
Minus strand

Genomic View for DHFR Gene

Genes around DHFR on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
DHFR Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for DHFR Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for DHFR Gene

Proteins for DHFR Gene

  • Protein details for DHFR Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P00374-DYR_HUMAN
    Recommended name:
    Dihydrofolate reductase
    Protein Accession:
    P00374
    Secondary Accessions:
    • B4DDD2
    • Q14130
    • Q6IRW8

    Protein attributes for DHFR Gene

    Size:
    187 amino acids
    Molecular mass:
    21453 Da
    Quaternary structure:
    • Homodimer.

    Three dimensional structures from OCA and Proteopedia for DHFR Gene

    Alternative splice isoforms for DHFR Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for DHFR Gene

Selected DME Specific Peptides for DHFR Gene

P00374:
  • QNMGIGK
  • KQNLVIMG
  • VLSRELKEPPQGAHFL

Post-translational modifications for DHFR Gene

  • Ubiquitination at Lys 19, Lys 81, Lys 133, Lys 158, Lys 179, and Lys 185
  • Modification sites at PhosphoSitePlus

Other Protein References for DHFR Gene

Domains & Families for DHFR Gene

Protein Domains for DHFR Gene

Graphical View of Domain Structure for InterPro Entry

P00374

UniProtKB/Swiss-Prot:

DYR_HUMAN :
  • Contains 1 DHFR (dihydrofolate reductase) domain.
  • Belongs to the dihydrofolate reductase family.
Domain:
  • Contains 1 DHFR (dihydrofolate reductase) domain.
Family:
  • Belongs to the dihydrofolate reductase family.
genes like me logo Genes that share domains with DHFR: view

No data available for Gene Families for DHFR Gene

Function for DHFR Gene

Molecular function for DHFR Gene

GENATLAS Biochemistry:
dihydrofolate reductase,putative up-regulated c-Myc target gene,DNA metabolism
UniProtKB/Swiss-Prot BiophysicochemicalProperties:
Kinetic parameters: KM=2.7 uM for dihydrofolate {ECO:0000269 PubMed:15039552, ECO:0000269 PubMed:19196009, ECO:0000269 PubMed:21876184}; KM=4.0 uM for NADPH {ECO:0000269 PubMed:15039552, ECO:0000269 PubMed:19196009, ECO:0000269 PubMed:21876184};
UniProtKB/Swiss-Prot CatalyticActivity:
5,6,7,8-tetrahydrofolate + NADP(+) = 7,8-dihydrofolate + NADPH.
UniProtKB/Swiss-Prot Function:
Key enzyme in folate metabolism. Contributes to the de novo mitochondrial thymidylate biosynthesis pathway. Catalyzes an essential reaction for de novo glycine and purine synthesis, and for DNA precursor synthesis. Binds its own mRNA and that of DHFRL1.

Enzyme Numbers (IUBMB) for DHFR Gene

Gene Ontology (GO) - Molecular Function for DHFR Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003723 RNA binding IEA --
GO:0003729 mRNA binding IDA 21876184
GO:0004146 dihydrofolate reductase activity NAS 6687716
GO:0005542 folic acid binding IDA 2303423
GO:0008144 drug binding IDA 12096917
genes like me logo Genes that share ontologies with DHFR: view
genes like me logo Genes that share phenotypes with DHFR: view

Human Phenotype Ontology for DHFR Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for DHFR Gene

MGI Knock Outs for DHFR:
  • Dhfr tm1b(EUCOMM)Wtsi

Animal Model Products

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for DHFR

Flow Cytometry Products

No data available for Transcription Factor Targets and HOMER Transcription for DHFR Gene

Localization for DHFR Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for DHFR gene
Compartment Confidence
mitochondrion 5
nucleus 5
cytosol 5
plasma membrane 1
peroxisome 1
endoplasmic reticulum 1

Gene Ontology (GO) - Cellular Components for DHFR Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005575 cellular_component ND --
GO:0005654 nucleoplasm TAS --
GO:0005829 cytosol TAS --
genes like me logo Genes that share ontologies with DHFR: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for DHFR Gene

Pathways & Interactions for DHFR Gene

genes like me logo Genes that share pathways with DHFR: view

UniProtKB/Swiss-Prot P00374-DYR_HUMAN

  • Pathway: Cofactor biosynthesis; tetrahydrofolate biosynthesis; 5,6,7,8-tetrahydrofolate from 7,8-dihydrofolate: step 1/1.

Gene Ontology (GO) - Biological Process for DHFR Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000082 G1/S transition of mitotic cell cycle TAS --
GO:0000083 regulation of transcription involved in G1/S transition of mitotic cell cycle TAS --
GO:0006545 glycine biosynthetic process IEA --
GO:0006729 tetrahydrobiopterin biosynthetic process ISS --
GO:0006730 one-carbon metabolic process IEA --
genes like me logo Genes that share ontologies with DHFR: view

No data available for SIGNOR curated interactions for DHFR Gene

Drugs & Compounds for DHFR Gene

(96) Drugs for DHFR Gene - From: DrugBank, PharmGKB, ApexBio, DGIdb, FDA Approved Drugs, HMDB, Tocris, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Methotrexate Approved Pharma Target, Enzyme, inhibitor, substrate Folate antagonist,inhibits DFHR 1518
Pemetrexed Approved, Investigational Pharma inhibitor, Biomarker, Target TS, DHFR,GARFT and AICARFT inhibitor, DHFR and Thymidylate synthase inhibitor, Anti-Folates 617
Pyrimethamine Approved, Vet_approved Pharma Inhibition, Inhibitor, Target, inhibitor DHFR inhibitor 152
Trimetrexate Approved, Investigational Pharma inhibitor, Target 17
Pralatrexate Approved Pharma inhibitor, Target Antifolate,a folate analog, RFC-1 targeted DHFR inhibitor 0

(68) Additional Compounds for DHFR Gene - From: Novoseek and HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
nadph
  • 2'-(Dihydrogen phosphate) 5'-(trihydrogen pyrophosphate) Adenosine 5'-ester with 1,4-dihydro-1-b-D-ribofuranosylnicotinamide
  • 2'-(Dihydrogen phosphate) 5'-(trihydrogen pyrophosphate) Adenosine 5'-ester with 1,4-dihydro-1-beta-delta-ribofuranosylnicotinamide
  • Adenosine 5'-(trihydrogen diphosphate) 2'-(dihydrogen phosphate) P'-5'-ester with 1,4-dihydro-1-beta-D-ribofuranosyl-3-pyridinecarboxamide
  • Adenosine 5'-(trihydrogen diphosphate) 2'-(dihydrogen phosphate) P'-5'-ester with 1,4-dihydro-1-beta-delta-ribofuranosyl-3-pyridinecarboxamide
  • b-NADPH
53-57-6
Hydrogen Ion
  • Hydrogen cation
  • Hydron
  • Proton
NADP
  • Adenine-nicotinamide dinucleotide phosphate
  • b-NADP
  • b-Nicotinamide adenine dinucleotide phosphate
  • b-TPN
  • beta-NADP
53-59-8

(1) Tocris Compounds for DHFR Gene

Compound Action Cas Number
CI 898 trihydrochloride Dihydrofolate reductase inhibitor 1658520-97-8

(5) ApexBio Compounds for DHFR Gene

Compound Action Cas Number
CI 898 trihydrochloride 82952-64-5
Methotrexate Folate antagonist,inhibits DFHR 1959-05-2
Pemetrexed TS, DHFR,GARFT and AICARFT inhibitor 150399-23-8
Pralatrexate Antifolate,a folate analog 146464-95-1
Pyrimethamine DHFR inhibitor 58-14-0
genes like me logo Genes that share compounds with DHFR: view

Transcripts for DHFR Gene

Unigene Clusters for DHFR Gene

Dihydrofolate reductase:
Representative Sequences:

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for DHFR

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for DHFR Gene

No ASD Table

Relevant External Links for DHFR Gene

GeneLoc Exon Structure for
DHFR
ECgene alternative splicing isoforms for
DHFR

Expression for DHFR Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for DHFR Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for DHFR Gene

This gene is overexpressed in Tonsil (14.2), Fetal Liver (7.4), Fetal testis (6.7), Fetal ovary (6.5), and Fetal Brain (6.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for DHFR Gene



NURSA nuclear receptor signaling pathways regulating expression of DHFR Gene:

DHFR

SOURCE GeneReport for Unigene cluster for DHFR Gene:

Hs.592364

mRNA Expression by UniProt/SwissProt for DHFR Gene:

P00374-DYR_HUMAN
Tissue specificity: Widely expressed in fetal and adult tissues, including throughout the fetal and adult brains and whole blood. Expression is higher in the adult brain than in the fetal brain.
genes like me logo Genes that share expression patterns with DHFR: view

No data available for mRNA differential expression in normal tissues and Protein tissue co-expression partners for DHFR Gene

Orthologs for DHFR Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for DHFR Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia DHFR 34 35
  • 99.82 (n)
dog
(Canis familiaris)
Mammalia -- 35
  • 94 (a)
ManyToMany
DHFR 34
  • 91.85 (n)
-- 35
  • 91 (a)
ManyToMany
cow
(Bos Taurus)
Mammalia DHFR 34 35
  • 89.84 (n)
rat
(Rattus norvegicus)
Mammalia Dhfr 34
  • 89.3 (n)
mouse
(Mus musculus)
Mammalia Dhfr 34 16 35
  • 88.41 (n)
oppossum
(Monodelphis domestica)
Mammalia -- 35
  • 81 (a)
OneToMany
platypus
(Ornithorhynchus anatinus)
Mammalia -- 35
  • 62 (a)
OneToMany
chicken
(Gallus gallus)
Aves DHFR 34 35
  • 78.14 (n)
lizard
(Anolis carolinensis)
Reptilia -- 35
  • 75 (a)
OneToMany
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100486206 34
  • 68.69 (n)
Str.3499 34
African clawed frog
(Xenopus laevis)
Amphibia Xl.7616 34
zebrafish
(Danio rerio)
Actinopterygii dhfr 34 35
  • 66.3 (n)
fruit fly
(Drosophila melanogaster)
Insecta Dhfr 36 34 35
  • 53.22 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP010278 34
  • 51.48 (n)
worm
(Caenorhabditis elegans)
Secernentea dhfr-1 34 35
  • 47.43 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes DFR1 35
  • 29 (a)
OneToMany
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes dfr1 34
  • 49.27 (n)
Species where no ortholog for DHFR was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for DHFR Gene

ENSEMBL:
Gene Tree for DHFR (if available)
TreeFam:
Gene Tree for DHFR (if available)

Paralogs for DHFR Gene

Paralogs for DHFR Gene

(2) SIMAP similar genes for DHFR Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with DHFR: view

Variants for DHFR Gene

Sequence variations from dbSNP and Humsavar for DHFR Gene

SNP ID Clin Chr 05 pos Sequence Context AA Info Type
rs121913223 Megaloblastic anemia due to dihydrofolate reductase deficiency (DHFRD) [MIM:613839], Pathogenic 80,633,904(-) AATTG(A/T)TTTGG intron-variant, nc-transcript-variant, reference, missense
rs387906619 Megaloblastic anemia due to dihydrofolate reductase deficiency (DHFRD) [MIM:613839], Pathogenic 80,649,393(-) GAGAA(C/T)TCAAG nc-transcript-variant, reference, missense
rs70991108 Uncertain significance 80,654,344(+) CGGCC(-/TGGCGCGTCCCGCCCAGGT)ACCCC intron-variant, upstream-variant-2KB
rs747419370 Uncertain significance 80,654,908(+) GGCCG(-/CAGCGCCCC/CAGCGCCCCCAGCGCCCC/CAGCGCCCCCAGCGCCCCCAGCGCCCC/CGCCCCCAGCGCCCC)CAGCG nc-transcript-variant, cds-indel, utr-variant-5-prime
rs10052238 -- 80,644,492(+) AGGGC(C/T)GGGGT intron-variant

Structural Variations from Database of Genomic Variants (DGV) for DHFR Gene

Variant ID Type Subtype PubMed ID
nsv964903 CNV duplication 23825009
nsv4895 CNV insertion 18451855
nsv483112 CNV loss 15286789
nsv1137013 CNV deletion 24896259
nsv10709 CNV loss 18304495
esv3605581 CNV gain 21293372
esv23281 CNV gain+loss 19812545
esv23209 CNV loss 19812545

Variation tolerance for DHFR Gene

Residual Variation Intolerance Score: 61.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.39; 8.50% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for DHFR Gene

Human Gene Mutation Database (HGMD)
DHFR
SNPedia medical, phenotypic, and genealogical associations of SNPs for
DHFR

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for DHFR Gene

Disorders for DHFR Gene

MalaCards: The human disease database

(19) MalaCards diseases for DHFR Gene - From: OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
megaloblastic anemia due to dihydrofolate reductase deficiency
  • constitutional megaloblastic anemia with severe neurologic disease
plasmodium falciparum malaria
  • falciparum malaria
cerebral folate deficiency
  • neurodegeneration due to cerebral folate transport deficiency
tetrahydrobiopterin deficiency
  • bh4 deficiency
plasmodium malariae malaria
  • malaria by plasmodium malariae
- elite association - COSMIC cancer census association via MalaCards
Search DHFR in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

DYR_HUMAN
  • Megaloblastic anemia due to dihydrofolate reductase deficiency (DHFRD) [MIM:613839]: An inborn error of metabolism, characterized by megaloblastic anemia and/or pancytopenia, severe cerebral folate deficiency, and cerebral tetrahydrobiopterin deficiency. Clinical features include variable neurologic symptoms, ranging from severe developmental delay and generalized seizures in infancy, to childhood absence epilepsy with learning difficulties, to lack of symptoms. {ECO:0000269 PubMed:21310276, ECO:0000269 PubMed:21310277}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Genatlas disease for DHFR Gene

anemia,megaloblastic

Relevant External Links for DHFR

Genetic Association Database (GAD)
DHFR
Human Genome Epidemiology (HuGE) Navigator
DHFR
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
DHFR
genes like me logo Genes that share disorders with DHFR: view

Publications for DHFR Gene

  1. Genetic association study of putative functional single nucleotide polymorphisms of genes in folate metabolism and spina bifida. (PMID: 19683694) Martinez C.A. … Au K.S. (Am. J. Obstet. Gynecol. 2009) 3 22 46 64
  2. Correlations of inhibitor kinetics for Pneumocystis jirovecii and human dihydrofolate reductase with structural data for human active site mutant enzyme complexes. (PMID: 19196009) Cody V. … Rosowsky A. (Biochemistry 2009) 3 4 22 64
  3. A 19-base pair deletion polymorphism in dihydrofolate reductase is associated with increased unmetabolized folic acid in plasma and decreased red blood cell folate. (PMID: 19022952) Kalmbach R.D. … Selhub J. (J. Nutr. 2008) 3 22 46 64
  4. Molecular genetic analysis of the human dihydrofolate reductase gene: relation with plasma total homocysteine, serum and red blood cell folate levels. (PMID: 16969375) Gellekink H. … den Heijer M. (Eur. J. Hum. Genet. 2007) 3 22 46 64
  5. Genetic polymorphisms in one-carbon metabolism: associations with CpG island methylator phenotype (CIMP) in colon cancer and the modifying effects of diet. (PMID: 17449906) Curtin K. … Samowitz W.S. (Carcinogenesis 2007) 3 22 46 64

Products for DHFR Gene

Sources for DHFR Gene

Content
Loading form....