Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



DGCR5 Gene

RNA gene   GIFtS: 27
GCID: GC22P018958          (predicted)

DiGeorge Syndrome Critical Region Gene 5 (Non-Protein Coding)

  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Subcategory (RNA class): non-coding RNA

Quality score for this RNA gene is 3

Aliases
DiGeorge Syndrome Critical Region Gene 5 (Non-Protein Coding)1 2
Long Intergenic Non-Protein Coding RNA 371
Non-Protein Coding RNA 371
LINC000372
NCRNA000372

External Ids:    HGNC: 167571   Entrez Gene: 262202   Ensembl: ENSG000002375177   

Export aliases for DGCR5 gene to outside databases

Previous GC identifers: GC22U990094 GC22P015899 GC22P017332 GC22P017347 GC22P002579


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

GeneCards Summary for DGCR5 Gene:
DGCR5 (DiGeorge syndrome critical region gene 5 (non-protein coding)) is an RNA gene, and is affiliated with the non-coding RNA class. Diseases associated with DGCR5 include digeorge syndrome, and parkinson's disease.

Gene Wiki entry for DGCR5 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000022.11  NT_011520.13  NC_018933.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the DGCR5 gene promoter:
         p53   Pax-5   AML1a   Egr-1   Egr-4   HNF-4alpha1   CREB   deltaCREB   
         Other transcription factors

Browse SwitchGear Promoter luciferase reporter plasmids
   Search Chromatin IP Primers for DGCR5

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat DGCR5


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 22q11   Ensembl cytogenetic band:  22q11.21   HGNC cytogenetic band: 22q11

DGCR5 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
DGCR5 gene location

GeneLoc information about chromosome 22         GeneLoc Exon Structure

GeneLoc location for GC22P018958:  view genomic region     (about GC identifiers)

Start:
18,958,027 bp from pter      End:
19,018,755 bp from pter
Size:
60,729 bases      Orientation:
plus strand
ORGUL member locations:
Legend (see complete legend)

ORGUL Member Locations for DGCR5

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB: --


(According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

TryGeneCards Plus
HGNC Gene Families:
LNCRNA: Long non-coding RNAs

  --

(According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
About This Section

TryGeneCards Plus

Animal Models:
   inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for DGCR5
   inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for DGCR5

   genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for DGCR5
   genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for DGCR5

miRNA
Products:
    
Block miRNA regulation of human, mouse, rat DGCR5 using miScript Target Protectors
Search for qRT-PCR Assays for microRNAs that regulate DGCR5
Browse SwitchGear 3'UTR luciferase reporter plasmids
Inhib. RNA
Products:
    
OriGene RNAi products in human, mouse, rat for DGCR5
Predesigned siRNA for gene silencing in human, mouse, rat DGCR5

Gene Editing
Products:
DNA2.0 Custom Protein Engineering Service for DGCR5

Clone
Products:
     
Browse OriGene untagged/tagged cDNA clones in CMV expression vector
OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript Custom all cDNA clones Services for DGCR5
Browse Sino Biological Human cDNA Clones
DNA2.0 Custom Codon Optimized Gene Synthesis Service for DGCR5
Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat DGCR5

Cell Line
Products:
     
GenScript Custom overexpressing Cell Line Services for DGCR5
Browse ESI BIO Cell Lines and PureStem Progenitors for DGCR5 
In Situ Assay
Products:
   

 
Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for DGCR5


(According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
About This Section

TryGeneCards Plus
  --

(SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
About This Section

TryGeneCards Plus



    Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for DGCR5
Interactions:

    Search GeneGlobe Interaction Network for DGCR5

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
About This Section

TryGeneCards Plus
Browse Small Molecules at EMD Millipore
   Browse drugs & compounds from Enzo Life Sciences
  Browse compounds at ApexBio 

Browse Tocris compounds for DGCR5



(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
About This Section

TryGeneCards Plus

Unigene Cluster for DGCR5:

DiGeorge syndrome critical region gene 5 (non-protein coding)
Hs.646438  [show with all ESTs]
Unigene Representative Sequence: NR_002733
7 Ensembl transcripts including schematic representations, and UCSC links where relevant:
ENST00000438934(antisense) ENST00000440005(antisense) ENST00000421572(antisense) ENST00000424407(antisense) ENST00000399539(antisense)
ENST00000537283(antisense) ENST00000540720(antisense)
miRNA
Products:
     
Block miRNA regulation of human, mouse, rat DGCR5 using miScript Target Protectors
Search for qRT-PCR Assays for microRNAs that regulate DGCR5
Browse SwitchGear 3'UTR luciferase reporter plasmids
Inhib. RNA
Products:
     
OriGene RNAi products in human, mouse, rat for DGCR5
Predesigned siRNA for gene silencing in human, mouse, rat DGCR5
Clone
Products:
     
Browse OriGene untagged/tagged cDNA clones in CMV expression vector
OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript Custom all cDNA clones Services for DGCR5
DNA2.0 Custom Codon Optimized Gene Synthesis Service for DGCR5
Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat DGCR5
Primer
Products:
    
OriGene qSTAR qPCR primer pairs in human, mouse for DGCR5
Search Pre-validated RT2 qPCR Primer Assays in human, mouse, rat DGCR5
  Search QuantiTect SYBR Green Assays in human, mouse, rat DGCR5
  QuantiFast Probe-based Assays in human, mouse, rat DGCR5

Additional mRNA sequence: 

AK124980.1 AK302666.1 BC035092.1 NR_002733.2 NR_045121.1 U84528.1 XR_109699.2 XR_133279.2 
XR_172361.1 

8 DOTS entries:

DT.95264276  DT.100023122  DT.101964241  DT.40192859  DT.91757216  DT.95264275  DT.75173775  DT.99987654 

Selected AceView cDNA sequences (see all 80):

BU585163 AL041213 CA776305 AW204048 CR606945 AA757817 CR623368 AI027934 
BC033112 BG163946 BU585176 AI760934 AI566862 AA827400 BI964887 BQ067304 
BX105198 BC035092 AI813361 BM040664 BU584564 BV184327 CK903475 AB051434 

GeneLoc Exon Structure


(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

TryGeneCards Plus

Expression evidence for DGCR5:none

DGCR5 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS <intensity>2/3
CGAP TAG: --
DGCR5 Expression
About this image

DGCR5 Protein expression data from MOPED1, PaxDb2 and MaxQB3 --

SOURCE GeneReport for Unigene cluster: Hs.646438
    Custom PCR Arrays for DGCR5
Primer
Products:
OriGene qSTAR qPCR primer pairs in human, mouse for DGCR5
Search Pre-validated RT2 qPCR Primer Assays in human, mouse, rat DGCR5
Search QuantiTect SYBR Green Assays in human, mouse, rat DGCR5
QuantiFast Probe-based Assays in human, mouse, rat DGCR5
In Situ
Assay Products:
 

 
Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for DGCR5

(Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

TryGeneCards Plus
  --

ENSEMBL Gene Tree for DGCR5 (if available)
TreeFam Gene Tree for DGCR5 (if available)

(Paralogs according to 1HomoloGene,
2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
About This Section

TryGeneCards Plus
  --

(SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
About This Section

TryGeneCards Plus

Selected SNPs for DGCR5 (see all 538)    About this table    
Genomic DataTranscription Related DataAllele Frequencies
SNP IDValidClinical
significance
Chr 22 posSequence#AA
Chg
TypeMore#Allele
freq
PopTotal
sample
More
----------
rs711847881,2
C--2921017(-) GCTTA-/AACATGAATGTATCTGATGCAGTTTTGAGGT
CTGGCCCCTCCAAATCTCATGTTGAAATGTGATC
AGGGT
2 -- int11Minor allele frequency- AACATGAATGTATCTGATGCAGTTTTGAGGTCTGGCCCCTCCAAATCTCATGTTGAAATGTGATC:0.00NA 2
rs1418917861,2
C--18956067(+) TTCCC-/CCCA  
 TGCCCAT
CCCAT
2 -- us2k10--------
rs568849811,2
C,F--18956101(+) CACTTT/CGGCTG 2 -- us2k11Minor allele frequency- C:0.03EA 120
rs573584981,2
C--18956108(+) GCTGCG/TGCAGG 2 -- us2k10--------
rs20772001,2
C,F,A,H--18956203(+) ATTGAG/AGAGAC 2 -- us2k128Minor allele frequency- A:0.49NS EA NA WA CSA 2728
rs1159083121,2
F--18956208(+) AGAGAC/TGCCTG 2 -- us2k11Minor allele frequency- T:0.01WA 118
rs1872482641,2
--18956313(+) TGATGA/GTCAGT 2 -- us2k10--------
rs1918683941,2
--18956362(+) TGAGAG/TCTCAG 2 -- us2k10--------
rs25188071,2
C,F,A,H--18956532(+) AGCCAG/CCTCAG 2 -- us2k14Minor allele frequency- C:0.50NA WA CSA 8
rs615104511,2
C--18956671(+) TGGCTA/GGGAAT 2 -- us2k10--------

HapMap Linkage Disequilibrium report for DGCR5 (18958027 - 19018755 bp)

Structural Variations
     Database of Genomic Variants (DGV) Selected variations for DGCR5 (see all 45):    About this table    
Variant IDTypeSubtypePubMed ID
esv1669610CNV Deletion17803354
esv2723975CNV Deletion23290073
esv2723974CNV Deletion23290073
esv2081719CNV Deletion18987734
nsv435744CNV Deletion17901297
dgv4827n71CNV Loss21882294
dgv4832n71CNV Loss21882294
dgv4833n71CNV Loss21882294
nsv914227CNV Loss21882294
nsv914244CNV Loss21882294

Human Gene Mutation Database (HGMD): DGCR5
Site Specific Mutation Identification with PCR Assays
Search QIAGEN SeqTarget long-range PCR primers for resequencing DGCR5
DNA2.0 Custom Variant and Variant Library Synthesis for DGCR5

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

TryGeneCards Plus
2 diseases for DGCR5:    
About MalaCards
digeorge syndrome    parkinson's disease


DGCR5 for disorders           About GeneDecksing

Genetic Association Database (GAD): DGCR5

Export disorders for DGCR5 gene to outside databases

(in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
About This Section

TryGeneCards Plus

PubMed articles for DGCR5 gene integrated from 10 sources:
(articles sorted by number of sources associating them with DGCR5)
    Utopia: connect your pdf to the dynamic
world of online information

  1. Human metabolic individuality in biomedical and pharmaceutical research. (PubMed id 21886157)1, 4 Suhre K....Gieger C. (Nature 2011)
  2. Identification of a novel transcript disrupted by a balanced translocation associated with DiGeorge syndrome. (PubMed id 8659529)1, 3 Sutherland H.F....Scambler P.J. (Am. J. Hum. Genet. 1996)
  3. Long non-coding RNAs in Huntington's disease neurodegeneration. (PubMed id 22202438)1 Johnson R. (Neurobiol. Dis. 2012)
  4. Regulation of neural macroRNAs by the transcriptional repressor REST. (PubMed id 19050060)1 Johnson R....Lipovich L. (RNA 2009)
  5. A genome-wide association study for blood lipid phenotypes in the Framingham Heart Study. (PubMed id 17903299)4 Kathiresan S....Cupples L.A. (BMC Med. Genet. 2007)
  6. Genome-wide association to body mass index and waist circumference: the Framingham Heart Study 100K project. (PubMed id 17903300)4 Fox C.S....Atwood L.D. (BMC Med. Genet. 2007)
  7. Genome-wide association and linkage analyses of hemostatic factors and hematological phenotypes in the Framingham Heart Study. (PubMed id 17903294)4 Yang Q....O'Donnell C.J. (BMC Med. Genet. 2007)
  8. High-resolution whole-genome association study of Parkinson disease. (PubMed id 16252231)4 Maraganore D.M....Ballinger D.G. (Am. J. Hum. Genet. 2005)
  9. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002)
  10. Identification of novel transcribed sequences on human chromosome 22 by expressed sequence tag mapping. (PubMed id 11258795)1 Hirosawa M.... Ohara O. (DNA Res. 2001)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

TryGeneCards Plus
 ANDOR
Aliases
Free Text  

  Query String
PubMed
OMIM
NCBI Bookshelf
  (Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

TryGeneCards Plus
Entrez Gene: 26220 HGNC: 16757 AceView: DGCR5 Ensembl:ENSG00000237517 euGenes: HUgn26220
ECgene: DGCR5 H-InvDB: DGCR5

(According to HUGE)
About This Section

TryGeneCards Plus
  --

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
About This Section

TryGeneCards Plus
NameDescription
PharmGKB entry for DGCR5 Pharmacogenomics, SNPs, Pathways

(Patent information from GeneIP,
Licensable technologies from WIS Yeda, Salk, Tufts,
IP news from LifeMap Sciences, Inc.)
About This Section

TryGeneCards Plus
Patent Information for DGCR5 gene:
Search GeneIP for patents involving DGCR5

GeneCards and IP:
Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
About This Section

TryGeneCards Plus

 
 EMD Millipore genomic analysis products

  
 Browse Antibodies   Browse Cell Culture Products  
 Browse ELISAs   Browse Flow Cytometry Kits  
 Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
 Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
 Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
 Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
 Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
 Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
 Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
 Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for DGCR5  
 Browse OriGene qPCR primer pairs and template standards   Browse OriGene Protein Over-expression Lysates  
 OriGene Custom Mass Spec   Browse OriGene clones  
 OriGene qSTAR qPCR primer pairs in human, mouse for DGCR5   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
 Browse OriGene ORF clones   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
 OriGene Custom Antibody Services for DGCR5   OriGene Custom Protein Services for DGCR5  

 
 
 Block miRNA regulation of human, mouse, rat DGCR5 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing DGCR5
 DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat DGCR5 Predesigned siRNA for gene silencing in human, mouse, rat DGCR5
 QuantiFast Probe-based Assays in human, mouse, rat DGCR5 Search QuantiTect SYBR Green Assays in human, mouse, rat DGCR5
 Custom PCR Arrays for DGCR5 Search Chromatin IP Primers for DGCR5
 Search Pre-validated RT2 qPCR Primer Assays in human, mouse, rat DGCR5 Search GeneGlobe Interaction Network for DGCR5
 Regulatory tfbs in DGCR5 promoter
 GenScript Custom Purified and Recombinant Proteins Services for DGCR5 GenScript Custom cDNA clones with any tag delivered in your preferred vector Services for DGCR5
 GenScript Custom Assay Services for DGCR5 GenScript Custom overexpressing Cell Line Services for DGCR5
 CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
 Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
 Plasmid Preparation Custom Peptide Services
 Search for Antibodies & Assays

 Search Tocris compounds for DGCR5
 Browse Sino Biological Proteins
 Browse Sino Biological Cell Lysates
 Browse Sino Biological cDNA Clones
 4000+ Proteins
 Search Sino Biological for antibodies, proteins & pathways
 Protein Production Services
 Transfection Reagents
 Protein A/G/L resins
 Isotyping reagents
 Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

 Novus Biologicals
 Novus Tissue Slides
 Search for Antibodies for DGCR5 at Abcam
 See all of Abcam's Antibodies, Kits and Proteins for DGCR5
 Custom Antibody / Protein Production Service
 Bulk Purchasing
 Advantages of Rabbit Monoclonal antibodies
 Abcam protocols and scientific support
 Browse ProSpec Recombinant Proteins
 Browse Proteins at Cloud-Clone Corp.
 Browse Antibodies at Cloud-Clone Corp.
 Browse ELISAs at Cloud-Clone Corp.
 Browse CLIAs at Cloud-Clone Corp.



 Browse ESI BIO Cell Lines and PureStem Progenitors for DGCR5
 Gene Synthesis
 Protein Engineering
 Variant Library Synthesis
 Codon Optimization
 Protein Production and Purification
 Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for DGCR5
 Browse SwitchGear 3'UTR luciferase reporter plasmids for DGCR5
 Browse SwitchGear Promoter luciferase reporter plasmids for DGCR5
 Search ThermoFisher Antibodies for DGCR5
 Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat DGCR5
 inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for DGCR5
 inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for DGCR5
 Search LSBio for Antibodies for DGCR5
Customized transgenic rodents for:
 Humanization
 Biomarker expression
 Off-target effect monitoring
 Translational medicine
 Tissue-specific gene expresssion
 Time-controlled gene expresssion
 Browse compounds at ApexBio
       
GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

View Random Gene

Category
(GIFtS: )
GIFtS Group
The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes      Disease genes      DGCR5 gene at Home site.
Version: 3.12.162 20 Aug 2014
hostname: 356977-web1.xennexinc.com index build: 126 solr: 1.4