Free for academic non-profit institutions. Other users need a Commercial license

Aliases for DDOST Gene

Aliases for DDOST Gene

  • Dolichyl-Diphosphooligosaccharide--Protein Glycosyltransferase Non-Catalytic Subunit 2 3 5
  • Advanced Glycation End-Product Receptor 1 2 3
  • Oligosaccharyl Transferase 48 KDa Subunit 3 4
  • Oligosaccharyltransferase Subunit 48 2 3
  • OST48 3 4
  • Dolichyl-Diphosphooligosaccharide--Protein Glycosyltransferase Subunit (Non-Catalytic) 3
  • Dolichyl-Diphosphooligosaccharide--Protein Glycosyltransferase 48 KDa Subunit 3
  • Dolichyl-Diphosphooligosaccharide-Protein Glycosyltransferase 2
  • Dolichyl-Diphosphooligosaccharide-Protein Glycotransferase 3
  • Advanced Glycation Endproduct Receptor 1 3
  • Oligosaccharyltransferase 48 KDa Subunit 3
  • DDOST 48 KDa Subunit 4
  • EC 2.4.1.119 61
  • OKSWcl45 3
  • KIAA0115 4
  • AGER1 3
  • CDG1R 3
  • GATD6 3
  • WBP1 3
  • OST 3

External Ids for DDOST Gene

Previous GeneCards Identifiers for DDOST Gene

  • GC01M020548
  • GC01M020013
  • GC01M020124
  • GC01M020447
  • GC01M020723
  • GC01M020841
  • GC01M020978
  • GC01M019224

Summaries for DDOST Gene

Entrez Gene Summary for DDOST Gene

  • This gene encodes a component of the oligosaccharyltransferase complex which catalyzes the transfer of high-mannose oligosaccharides to asparagine residues on nascent polypeptides in the lumen of the rough endoplasmic reticulum. The protein complex co-purifies with ribosomes. The product of this gene is also implicated in the processing of advanced glycation endproducts (AGEs), which form from non-enzymatic reactions between sugars and proteins or lipids and are associated with aging and hyperglycemia. [provided by RefSeq, Jul 2008]

GeneCards Summary for DDOST Gene

DDOST (Dolichyl-Diphosphooligosaccharide--Protein Glycosyltransferase Non-Catalytic Subunit) is a Protein Coding gene. Diseases associated with DDOST include Congenital Disorder Of Glycosylation, Type Ir. Among its related pathways are Advanced glycosylation endproduct receptor signaling and Innate Immune System. GO annotations related to this gene include dolichyl-diphosphooligosaccharide-protein glycotransferase activity and oligosaccharyl transferase activity.

UniProtKB/Swiss-Prot for DDOST Gene

  • Essential subunit of the N-oligosaccharyl transferase (OST) complex which catalyzes the transfer of a high mannose oligosaccharide from a lipid-linked oligosaccharide donor to an asparagine residue within an Asn-X-Ser/Thr consensus motif in nascent polypeptide chains. Required for the assembly of both SST3A- and SS3B-containing OST complexes. Required for efficient N-glycosylation.

Gene Wiki entry for DDOST Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for DDOST Gene

Genomics for DDOST Gene

Regulatory Elements for DDOST Gene

Enhancers for DDOST Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH01G020474 2 FANTOM5 Ensembl ENCODE dbSUPER 12.2 +180.5 180463 13.8 HNRNPUL1 PKNOX1 FOXA2 MLX ARID4B DMAP1 ZNF2 ZBTB7B YY1 SLC30A9 MUL1 FAM43B DDOST CAMK2N1 LINC01141
GH01G021573 1.3 Ensembl ENCODE dbSUPER 10.9 -912.9 -912868 1.7 RB1 ARID4B RAD21 GTF3C2 GATA2 EGR1 ZNF366 FOS EGR2 SMARCA5 CDC42-IT1 ENSG00000271428 DDOST ALPL ZBTB40-IT1 LOC105376834 GC01P021552 GC01P021551
GH01G021439 1 ENCODE 12.1 -778.7 -778668 1.9 PKNOX1 ARID4B SIN3A ZNF48 YY1 GLIS2 REST ZNF579 ETV4 HMBOX1 NBPF3 NBPF2P CDC42-IT1 DDOST ENSG00000271428 PIR56533
GH01G021641 1 ENCODE dbSUPER 10.9 -980.6 -980562 1.6 BCOR HDGF ESRRA PTBP1 ZSCAN26 ZSCAN4 ZMYM3 NFXL1 SALL2 GTF3C2 RAP1GAP CDC42-IT1 ENSG00000271428 LOC105376834 DDOST ZBTB40-IT1 USP48 PIR35545
GH01G019863 0.8 ENCODE 10.9 +797.7 797655 1.7 TBP CBX3 TCF12 GTF3C2 ZNF766 POLR3A CEBPB MEF2D CEBPA IKZF1 OTUD3 EMC1 RNF186 ENSG00000235434 DDOST TMCO4 PIR53184 GC01M019829
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around DDOST on UCSC Golden Path with GeneCards custom track

Promoters for DDOST Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000002644 244 1801 HDGF PKNOX1 CREB3L1 ARNT WRNIP1 ARID4B SIN3A ZNF2 YY1 ZNF766

Genomic Location for DDOST Gene

Chromosome:
1
Start:
20,651,767 bp from pter
End:
20,661,544 bp from pter
Size:
9,778 bases
Orientation:
Minus strand

Genomic View for DDOST Gene

Genes around DDOST on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
DDOST Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for DDOST Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for DDOST Gene

Proteins for DDOST Gene

  • Protein details for DDOST Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P39656-OST48_HUMAN
    Recommended name:
    Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunit
    Protein Accession:
    P39656
    Secondary Accessions:
    • B2RDQ4
    • B4DJE3
    • B4DLI2
    • O43244
    • Q5VWA5
    • Q8NI93
    • Q9BUI2

    Protein attributes for DDOST Gene

    Size:
    456 amino acids
    Molecular mass:
    50801 Da
    Quaternary structure:
    • Component of the oligosaccharyltransferase (OST) complex. OST exists in two different complex forms which contain common core subunits RPN1, RPN2, OST48, OST4, DAD1 and TMEM258, either STT3A or STT3B as catalytic subunits, and form-specific accessory subunits. OST can form stable complexes with the Sec61 complex or with both the Sec61 and TRAP complexes (By similarity).
    SequenceCaution:
    • Sequence=BAB93478.1; Type=Erroneous initiation; Evidence={ECO:0000305};

    Alternative splice isoforms for DDOST Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for DDOST Gene

Selected DME Specific Peptides for DDOST Gene

P39656:
  • QLEFVRIDPFVR
  • VIDHHNYD
  • LSLIKYGEFLYDNLIIFSPS
  • QFKVDYNR
  • QVSVRPL
  • THSLFFRSL
  • HTQYERFI
  • AYTVTDLVEY
  • TLVLLDN
  • ALSRWVFKE
  • LQARNNARV
  • FSGSLDFFSD
  • HTLIVAD
  • GYTHLYS
  • VSHHRVGE
  • FIDGGGSVLVAASSDIGDPLRELGSECGIEFDE
  • ILTGSST
  • EDFGGNINVETI
  • FKLPDVYGVF

Post-translational modifications for DDOST Gene

  • Ubiquitination at isoforms=2, 3189 and Lys301
  • Modification sites at PhosphoSitePlus

Other Protein References for DDOST Gene

Domains & Families for DDOST Gene

Suggested Antigen Peptide Sequences for DDOST Gene

Graphical View of Domain Structure for InterPro Entry

P39656

UniProtKB/Swiss-Prot:

OST48_HUMAN :
  • Belongs to the DDOST 48 kDa subunit family.
Family:
  • Belongs to the DDOST 48 kDa subunit family.
genes like me logo Genes that share domains with DDOST: view

Function for DDOST Gene

Molecular function for DDOST Gene

GENATLAS Biochemistry:
dolichyl-diphosphooligosaccharide-protein glycosyltransferase,48kDa,complexing with RPN1 and RPN2,widely expressed
UniProtKB/Swiss-Prot Function:
Essential subunit of the N-oligosaccharyl transferase (OST) complex which catalyzes the transfer of a high mannose oligosaccharide from a lipid-linked oligosaccharide donor to an asparagine residue within an Asn-X-Ser/Thr consensus motif in nascent polypeptide chains. Required for the assembly of both SST3A- and SS3B-containing OST complexes. Required for efficient N-glycosylation.

Enzyme Numbers (IUBMB) for DDOST Gene

Gene Ontology (GO) - Molecular Function for DDOST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004576 contributes_to oligosaccharyl transferase activity ISS --
GO:0004579 contributes_to dolichyl-diphosphooligosaccharide-protein glycotransferase activity IDA 9642163
GO:0005515 protein binding IPI 21903422
GO:0016740 transferase activity IEA --
GO:0016757 transferase activity, transferring glycosyl groups IEA --
genes like me logo Genes that share ontologies with DDOST: view
genes like me logo Genes that share phenotypes with DDOST: view

Human Phenotype Ontology for DDOST Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for DDOST Gene

MGI Knock Outs for DDOST:

Animal Model Products

  • Taconic Biosciences Mouse Models for DDOST

CRISPR Products

Inhibitory RNA Products

Clone Products

No data available for Transcription Factor Targets and HOMER Transcription for DDOST Gene

Localization for DDOST Gene

Subcellular locations from UniProtKB/Swiss-Prot for DDOST Gene

Endoplasmic reticulum membrane; Single-pass type I membrane protein.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for DDOST gene
Compartment Confidence
plasma membrane 5
endoplasmic reticulum 5
lysosome 5
mitochondrion 1
cytosol 1

Gene Ontology (GO) - Cellular Components for DDOST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005783 endoplasmic reticulum IDA --
GO:0005789 endoplasmic reticulum membrane TAS --
GO:0005886 plasma membrane TAS --
GO:0008250 oligosaccharyltransferase complex TAS 15835887
GO:0016020 membrane IEA,IDA 19946888
genes like me logo Genes that share ontologies with DDOST: view

Pathways & Interactions for DDOST Gene

genes like me logo Genes that share pathways with DDOST: view

Pathways by source for DDOST Gene

UniProtKB/Swiss-Prot P39656-OST48_HUMAN

  • Pathway: Protein modification; protein glycosylation.

Gene Ontology (GO) - Biological Process for DDOST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006486 protein glycosylation ISS --
GO:0006487 protein N-linked glycosylation IDA 9642163
GO:0018279 protein N-linked glycosylation via asparagine TAS --
GO:0034097 response to cytokine IDA 9642163
GO:0042110 T cell activation IDA 9642163
genes like me logo Genes that share ontologies with DDOST: view

No data available for SIGNOR curated interactions for DDOST Gene

Drugs & Compounds for DDOST Gene

(1) Drugs for DDOST Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
L-Asparagine Approved Nutra 0

(2) Additional Compounds for DDOST Gene - From: HMDB and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
Dolichyl diphosphate
  • Dolichyl diphosphate
37247-98-6
genes like me logo Genes that share compounds with DDOST: view

Transcripts for DDOST Gene

Unigene Clusters for DDOST Gene

Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic):
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for DDOST Gene

No ASD Table

Relevant External Links for DDOST Gene

GeneLoc Exon Structure for
DDOST
ECgene alternative splicing isoforms for
DDOST

Expression for DDOST Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for DDOST Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for DDOST Gene

This gene is overexpressed in Bone (7.5) and Placenta (6.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for DDOST Gene



Protein tissue co-expression partners for DDOST Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of DDOST Gene:

DDOST

SOURCE GeneReport for Unigene cluster for DDOST Gene:

Hs.523145

Evidence on tissue expression from TISSUES for DDOST Gene

  • Nervous system(4.9)
  • Liver(4.5)
  • Blood(4.4)
  • Bone marrow(4.4)
  • Skin(4)
  • Intestine(3.8)
  • Lung(3.8)
  • Pancreas(3.1)
  • Kidney(3)
  • Eye(2.9)
  • Muscle(2.5)
  • Heart(2.2)
  • Thyroid gland(2.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for DDOST Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • nervous
  • skeletal muscle
Organs:
Head and neck:
  • cranial nerve
  • ear
  • eye
  • head
Thorax:
  • esophagus
  • heart
Abdomen:
  • intestine
  • large intestine
  • liver
  • stomach
Pelvis:
  • rectum
General:
  • blood vessel
  • peripheral nervous system
genes like me logo Genes that share expression patterns with DDOST: view

Primer Products

No data available for mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for DDOST Gene

Orthologs for DDOST Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for DDOST Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia DDOST 34 35
  • 99.56 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia DDOST 35
  • 94 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia DDOST 35
  • 91 (a)
OneToOne
dog
(Canis familiaris)
Mammalia DDOST 34 35
  • 90.9 (n)
cow
(Bos Taurus)
Mammalia DDOST 34 35
  • 89.68 (n)
mouse
(Mus musculus)
Mammalia Ddost 34 16 35
  • 88.11 (n)
rat
(Rattus norvegicus)
Mammalia Ddost 34
  • 87.42 (n)
chicken
(Gallus gallus)
Aves DDOST 34 35
  • 79.51 (n)
lizard
(Anolis carolinensis)
Reptilia DDOST 35
  • 83 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia ddost 34
  • 79.32 (n)
zebrafish
(Danio rerio)
Actinopterygii ddost 34 35
  • 76.58 (n)
wufa11d01 34
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP006383 34
  • 63.37 (n)
fruit fly
(Drosophila melanogaster)
Insecta Ost48 36 34 35
  • 62.79 (n)
worm
(Caenorhabditis elegans)
Secernentea ostb-1 34 35
  • 55.72 (n)
T09A5.11 36
  • 53 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes WBP1 35 37
  • 25 (a)
OneToOne
thale cress
(Arabidopsis thaliana)
eudicotyledons DGL1 34
  • 52.82 (n)
rice
(Oryza sativa)
Liliopsida Os07g0209000 34
  • 53.27 (n)
Os.10561 34
barley
(Hordeum vulgare)
Liliopsida Hv.2311 34
corn
(Zea mays)
Liliopsida Zm.4286 34
sea squirt
(Ciona savignyi)
Ascidiacea CSA.9640 35
  • 62 (a)
OneToOne
Species where no ortholog for DDOST was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for DDOST Gene

ENSEMBL:
Gene Tree for DDOST (if available)
TreeFam:
Gene Tree for DDOST (if available)

Paralogs for DDOST Gene

No data available for Paralogs for DDOST Gene

Variants for DDOST Gene

Sequence variations from dbSNP and Humsavar for DDOST Gene

SNP ID Clin Chr 01 pos Sequence Context AA Info Type
rs387906831 Pathogenic, Congenital disorder of glycosylation 1R (CDG1R) [MIM:614507] 20,654,660(-) GACGG(A/G)CTCTT reference, missense
rs587776874 Pathogenic 20,652,464(+) TGGCG(-/TAGTAGGGGTAGGCCGAGGGGA)TGAAG upstream-variant-2KB, reference, frameshift-variant
rs148433777 Likely benign 20,651,802(+) TTATT(-/TTTATTTATTTA)TTTAT nc-transcript-variant, downstream-variant-500B, utr-variant-3-prime
rs150466875 Likely benign 20,651,922(+) TTGGA(G/T)TCATG nc-transcript-variant, downstream-variant-500B, utr-variant-3-prime
rs200971370 Likely benign 20,652,002(+) TGTAC(-/TT)TTTTA nc-transcript-variant, downstream-variant-500B, utr-variant-3-prime

Structural Variations from Database of Genomic Variants (DGV) for DDOST Gene

Variant ID Type Subtype PubMed ID
nsv1003348 CNV gain 25217958
nsv545731 CNV gain 21841781
nsv834369 CNV loss 17160897

Variation tolerance for DDOST Gene

Residual Variation Intolerance Score: 20.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.12; 38.68% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for DDOST Gene

Human Gene Mutation Database (HGMD)
DDOST
SNPedia medical, phenotypic, and genealogical associations of SNPs for
DDOST

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for DDOST Gene

Disorders for DDOST Gene

MalaCards: The human disease database

(1) MalaCards diseases for DDOST Gene - From: OMIM, ClinVar, Orphanet, Swiss-Prot, and GeneCards

Disorder Aliases PubMed IDs
congenital disorder of glycosylation, type ir
  • ddost-cdg
- elite association - COSMIC cancer census association via MalaCards
Search DDOST in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

OST48_HUMAN
  • Congenital disorder of glycosylation 1R (CDG1R) [MIM:614507]: A form of congenital disorder of glycosylation, a multisystem disorder caused by a defect in glycoprotein biosynthesis and characterized by under-glycosylated serum glycoproteins. Congenital disorders of glycosylation result in a wide variety of clinical features, such as defects in the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. {ECO:0000269 PubMed:22305527}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for DDOST

Genetic Association Database (GAD)
DDOST
Human Genome Epidemiology (HuGE) Navigator
DDOST
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
DDOST
genes like me logo Genes that share disorders with DDOST: view

No data available for Genatlas for DDOST Gene

Publications for DDOST Gene

  1. Genome organization of human 48-kDa oligosaccharyltransferase (DDOST). (PMID: 9367678) Yamagata T. … Momoi T. (Genomics 1997) 2 3 4 22 64
  2. DDOST mutations identified by whole-exome sequencing are implicated in congenital disorders of glycosylation. (PMID: 22305527) Jones M.A. … Hegde M.R. (Am. J. Hum. Genet. 2012) 3 4 64
  3. DDOST, PRKCSH and LGALS3, which encode AGE-receptors 1, 2 and 3, respectively, are not associated with diabetic nephropathy in type 1 diabetes. (PMID: 20490454) Hoverfelt A. … Wessman M. (Diabetologia 2010) 3 46 64
  4. Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects. (PMID: 19343046) Saito A. … Kamatani N. (J. Hum. Genet. 2009) 3 46 64
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64

Products for DDOST Gene

Sources for DDOST Gene

Content
Loading form....