Free for academic non-profit institutions. Other users need a Commercial license

Aliases for DDIT4L Gene

Aliases for DDIT4L Gene

  • DNA Damage Inducible Transcript 4 Like 2 3 5
  • Protein Regulated In Development And DNA Damage Response 2 3 4
  • Regulated In Development And DNA Damage Response 2 2 3
  • HIF-1 Responsive Protein RTP801-Like 3 4
  • Rtp801L 3 4
  • REDD-2 3 4
  • REDD2 3 4
  • DNA Damage-Inducible Transcript 4-Like Protein 3
  • DNA-Damage-Inducible Transcript 4-Like 2
  • Similar To Smhs1 Protein 2
  • Homolog Of Mouse SMHS1 3

External Ids for DDIT4L Gene

Previous GeneCards Identifiers for DDIT4L Gene

  • GC00U914340
  • GC04M101567
  • GC04M101464
  • GC04M101326
  • GC04M101107
  • GC04M096845

Summaries for DDIT4L Gene

GeneCards Summary for DDIT4L Gene

DDIT4L (DNA Damage Inducible Transcript 4 Like) is a Protein Coding gene. Among its related pathways are mTOR signalling. An important paralog of this gene is DDIT4.

UniProtKB/Swiss-Prot for DDIT4L Gene

  • Inhibits cell growth by regulating the TOR signaling pathway upstream of the TSC1-TSC2 complex and downstream of AKT1.

Additional gene information for DDIT4L Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for DDIT4L Gene

Genomics for DDIT4L Gene

GeneHancer (GH) Regulatory Elements for DDIT4L Gene

Promoters and enhancers for DDIT4L Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH04I100189 Promoter/Enhancer 1.5 EPDnew Ensembl ENCODE 550.8 +0.7 681 1.4 ZNF335 GLIS2 POLR2A GLIS1 SCRT2 NFE2 EZH2 DDIT4L LOC101929353 DNAJB14 LOC256880
GH04I100190 Enhancer 0.4 Ensembl 550.8 +1.7 1681 0.2 GLIS1 EZH2 DDIT4L LOC101929353 DYNLL1P6 LOC256880
GH04I100191 Enhancer 0.4 ENCODE 550.8 -0.1 -97 0.2 NFE2 EZH2 LOC101929353 DDIT4L PIR53160 GC04P100245 LOC256880
GH04I100192 Enhancer 0.3 ENCODE 554.9 -0.8 -836 1 EZH2 DDIT4L LOC101929353 PIR53160 GC04P100245 LOC256880
GH04I100288 Enhancer 0.7 Ensembl ENCODE 6.5 -99.0 -98969 3 JUND JUN CEBPB FOS ATF2 DDIT4L PIR53160 GC04P100245 GC04M100396
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around DDIT4L on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the DDIT4L gene promoter:

Genomic Locations for DDIT4L Gene

Genomic Locations for DDIT4L Gene
chr4:100,185,110-100,190,782
(GRCh38/hg38)
Size:
5,673 bases
Orientation:
Minus strand
chr4:101,107,027-101,111,939
(GRCh37/hg19)

Genomic View for DDIT4L Gene

Genes around DDIT4L on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
DDIT4L Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for DDIT4L Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for DDIT4L Gene

Proteins for DDIT4L Gene

  • Protein details for DDIT4L Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96D03-DDT4L_HUMAN
    Recommended name:
    DNA damage-inducible transcript 4-like protein
    Protein Accession:
    Q96D03
    Secondary Accessions:
    • B2R7C3

    Protein attributes for DDIT4L Gene

    Size:
    193 amino acids
    Molecular mass:
    21740 Da
    Quaternary structure:
    No Data Available

neXtProt entry for DDIT4L Gene

Post-translational modifications for DDIT4L Gene

No Post-translational modifications

Other Protein References for DDIT4L Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for DDIT4L Gene

Domains & Families for DDIT4L Gene

Gene Families for DDIT4L Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for DDIT4L Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for DDIT4L Gene

Graphical View of Domain Structure for InterPro Entry

Q96D03

UniProtKB/Swiss-Prot:

DDT4L_HUMAN :
  • Belongs to the DDIT4 family.
Family:
  • Belongs to the DDIT4 family.
genes like me logo Genes that share domains with DDIT4L: view

Function for DDIT4L Gene

Molecular function for DDIT4L Gene

UniProtKB/Swiss-Prot Function:
Inhibits cell growth by regulating the TOR signaling pathway upstream of the TSC1-TSC2 complex and downstream of AKT1.
UniProtKB/Swiss-Prot Induction:
Up-regulated by oxidized LDL and hypoxia in macrophages.

Gene Ontology (GO) - Molecular Function for DDIT4L Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 16189514
genes like me logo Genes that share ontologies with DDIT4L: view

Phenotypes for DDIT4L Gene

genes like me logo Genes that share phenotypes with DDIT4L: view

Clone Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for DDIT4L Gene

Localization for DDIT4L Gene

Subcellular locations from UniProtKB/Swiss-Prot for DDIT4L Gene

Cytoplasm.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for DDIT4L gene
Compartment Confidence
nucleus 2
cytosol 2
extracellular 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Actin filaments (1)
  • Nucleoplasm (1)
  • Plasma membrane (1)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for DDIT4L Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm ISS,IEA --
genes like me logo Genes that share ontologies with DDIT4L: view

Pathways & Interactions for DDIT4L Gene

SuperPathways for DDIT4L Gene

SuperPathway Contained pathways
1 mTOR signalling
genes like me logo Genes that share pathways with DDIT4L: view

Pathways by source for DDIT4L Gene

1 GeneTex pathway for DDIT4L Gene
1 BioSystems pathway for DDIT4L Gene

Gene Ontology (GO) - Biological Process for DDIT4L Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0009968 negative regulation of signal transduction IEA --
genes like me logo Genes that share ontologies with DDIT4L: view

No data available for SIGNOR curated interactions for DDIT4L Gene

Drugs & Compounds for DDIT4L Gene

No Compound Related Data Available

Transcripts for DDIT4L Gene

mRNA/cDNA for DDIT4L Gene

Unigene Clusters for DDIT4L Gene

DNA-damage-inducible transcript 4-like:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for DDIT4L Gene

No ASD Table

Relevant External Links for DDIT4L Gene

GeneLoc Exon Structure for
DDIT4L
ECgene alternative splicing isoforms for
DDIT4L

Expression for DDIT4L Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for DDIT4L Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for DDIT4L Gene

This gene is overexpressed in Muscle - Skeletal (x33.1).

Protein differential expression in normal tissues from HIPED for DDIT4L Gene

This gene is overexpressed in Kidney (40.6), Heart (22.3), and Bone marrow mesenchymal stem cell (6.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for DDIT4L Gene



Protein tissue co-expression partners for DDIT4L Gene

NURSA nuclear receptor signaling pathways regulating expression of DDIT4L Gene:

DDIT4L

SOURCE GeneReport for Unigene cluster for DDIT4L Gene:

Hs.480378

mRNA Expression by UniProt/SwissProt for DDIT4L Gene:

Q96D03-DDT4L_HUMAN
Tissue specificity: Up-regulated in atherosclerotic plaques relative to healthy segments of the same artery.

Evidence on tissue expression from TISSUES for DDIT4L Gene

  • Nervous system(4.3)
  • Lung(4)
  • Lymph node(4)
  • Muscle(3)
genes like me logo Genes that share expression patterns with DDIT4L: view

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for DDIT4L Gene

Orthologs for DDIT4L Gene

This gene was present in the common ancestor of animals.

Orthologs for DDIT4L Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia DDIT4L 33 34
  • 99.31 (n)
dog
(Canis familiaris)
Mammalia DDIT4L 33 34
  • 90.58 (n)
cow
(Bos Taurus)
Mammalia DDIT4L 33 34
  • 90.4 (n)
mouse
(Mus musculus)
Mammalia Ddit4l 33 16 34
  • 89.88 (n)
rat
(Rattus norvegicus)
Mammalia LOC100363484 33
  • 88.13 (n)
oppossum
(Monodelphis domestica)
Mammalia DDIT4L 34
  • 67 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia DDIT4L 34
  • 66 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia DDIT4L 34
  • 71 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia ddit4l 33
  • 55.73 (n)
fruit fly
(Drosophila melanogaster)
Insecta chrb 34
  • 17 (a)
ManyToMany
scyl 34
  • 16 (a)
ManyToMany
Species where no ortholog for DDIT4L was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for DDIT4L Gene

ENSEMBL:
Gene Tree for DDIT4L (if available)
TreeFam:
Gene Tree for DDIT4L (if available)

Paralogs for DDIT4L Gene

Paralogs for DDIT4L Gene

(1) SIMAP similar genes for DDIT4L Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with DDIT4L: view

Variants for DDIT4L Gene

Sequence variations from dbSNP and Humsavar for DDIT4L Gene

SNP ID Clin Chr 04 pos Variation AA Info Type
rs1000058552 -- 100,190,533(-) GCACCGCCCCTCCCCGGCCAGCGC/GC upstream_transcript_variant
rs1000395053 -- 100,191,433(-) G/T upstream_transcript_variant
rs10007201 -- 100,187,175(-) C/T 3_prime_UTR_variant
rs1001404871 -- 100,185,509(-) T/G downstream_transcript_variant
rs1001431061 -- 100,190,513(-) C/G upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for DDIT4L Gene

Variant ID Type Subtype PubMed ID
nsv830019 CNV gain 17160897

Variation tolerance for DDIT4L Gene

Residual Variation Intolerance Score: 62.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.94; 74.54% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for DDIT4L Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
DDIT4L

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for DDIT4L Gene

Disorders for DDIT4L Gene

Additional Disease Information for DDIT4L

No disorders were found for DDIT4L Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for DDIT4L Gene

Publications for DDIT4L Gene

  1. The stress-inducted proteins RTP801 and RTP801L are negative regulators of the mammalian target of rapamycin pathway. (PMID: 15632201) Corradetti MN … Guan KL (The Journal of biological chemistry 2005) 3 4 22 58
  2. REDD2 gene is upregulated by modified LDL or hypoxia and mediates human macrophage cell death. (PMID: 15308555) Cuaz-Pérolin C … Rouis M (Arteriosclerosis, thrombosis, and vascular biology 2004) 3 4 22 58
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  4. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 2 3 58
  5. REDD1, a developmentally regulated transcriptional target of p63 and p53, links p63 to regulation of reactive oxygen species. (PMID: 12453409) Ellisen LW … Haber DA (Molecular cell 2002) 3 4 58

Products for DDIT4L Gene

Sources for DDIT4L Gene

Content
Loading form....