Free for academic non-profit institutions. Other users need a Commercial license

Aliases for DCAF15 Gene

Aliases for DCAF15 Gene

  • DDB1 And CUL4 Associated Factor 15 2 3
  • C19orf72 3 4
  • Chromosome 19 Open Reading Frame 72 2
  • DDB1- And CUL4-Associated Factor 15 3

External Ids for DCAF15 Gene

Previous HGNC Symbols for DCAF15 Gene

  • C19orf72

Previous GeneCards Identifiers for DCAF15 Gene

  • GC19P014063
  • GC19P013634

Summaries for DCAF15 Gene

GeneCards Summary for DCAF15 Gene

DCAF15 (DDB1 And CUL4 Associated Factor 15) is a Protein Coding gene.

UniProtKB/Swiss-Prot for DCAF15 Gene

  • May be involved in ubiquitination and degradation through a DBB1-CUL4 E3 protein-ubiquitin ligase.

No data available for Entrez Gene Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for DCAF15 Gene

Genomics for DCAF15 Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for DCAF15 Gene

13,952,492 bp from pter
13,961,449 bp from pter
8,958 bases
Plus strand

Genomic View for DCAF15 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for DCAF15 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for DCAF15 Gene

No data available for Regulatory Elements for DCAF15 Gene

Proteins for DCAF15 Gene

  • Protein details for DCAF15 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    DDB1- and CUL4-associated factor 15
    Protein Accession:
    Secondary Accessions:
    • B3KS86
    • Q96DW0
    • Q9BU31

    Protein attributes for DCAF15 Gene

    600 amino acids
    Molecular mass:
    66463 Da
    Quaternary structure:
    • Interacts with DDB1 and CUL4A.
    • Sequence=AAH13280.2; Type=Frameshift; Positions=89; Evidence={ECO:0000305};

neXtProt entry for DCAF15 Gene

Proteomics data for DCAF15 Gene at MOPED

Post-translational modifications for DCAF15 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for DCAF15 Gene

No data available for DME Specific Peptides for DCAF15 Gene

Domains for DCAF15 Gene

Gene Families for DCAF15 Gene

  • DCAF :DDB1 and CUL4 associated factors

Protein Domains for DCAF15 Gene


Suggested Antigen Peptide Sequences for DCAF15 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with DCAF15: view

No data available for UniProtKB/Swiss-Prot for DCAF15 Gene

Function for DCAF15 Gene

Molecular function for DCAF15 Gene

UniProtKB/Swiss-Prot Function:
May be involved in ubiquitination and degradation through a DBB1-CUL4 E3 protein-ubiquitin ligase.

Animal Model Products

CRISPR Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Animal Models , miRNA , Transcription Factor Targeting and HOMER Transcription for DCAF15 Gene

Localization for DCAF15 Gene

Subcellular locations from

Jensen Localization Image for DCAF15 Gene COMPARTMENTS Subcellular localization image for DCAF15 gene
Compartment Confidence
cytosol 2
nucleus 2
peroxisome 2

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for DCAF15 Gene

Pathways for DCAF15 Gene

SuperPathways for DCAF15 Gene

No Data Available

UniProtKB/Swiss-Prot Q66K64-DCA15_HUMAN

  • Pathway: Protein modification; protein ubiquitination

Interacting Proteins for DCAF15 Gene

STRING Interaction Network Preview (showing 3 interactants - click image to see details)
Selected Interacting proteins: ENSP00000254337 Q66K64-DCA15_HUMAN for DCAF15 Gene via STRING I2D

Gene Ontology (GO) - Biological Process for DCAF15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016567 protein ubiquitination IEA --
genes like me logo Genes that share ontologies with DCAF15: view

No data available for Pathways by source for DCAF15 Gene

Transcripts for DCAF15 Gene

Unigene Clusters for DCAF15 Gene

DDB1 and CUL4 associated factor 15:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for DCAF15

Primer Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for DCAF15 Gene

ExUns: 1 ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6a · 6b · 6c ^ 7 ^ 8 ^ 9a · 9b ^ 10a · 10b ^ 11a · 11b ^ 12a · 12b ^ 13a · 13b ^ 14a · 14b · 14c
SP1: - - - - - -
SP2: - -
SP5: - -
SP6: -

Relevant External Links for DCAF15 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for DCAF15 Gene

mRNA expression in normal human tissues for DCAF15 Gene

Protein differential expression in normal tissues for DCAF15 Gene

This gene is overexpressed in Bone (61.4) and Pancreatic juice (6.4).

Integrated Proteomics: protein expression from ProteomicsDB, PaxDb, MOPED, and MaxQB for DCAF15 Gene

SOURCE GeneReport for Unigene cluster for DCAF15 Gene Hs.443636

genes like me logo Genes that share expressions with DCAF15: view

Expression partners for DCAF15 Gene

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for DCAF15 Gene

Orthologs for DCAF15 Gene

This gene was present in the common ancestor of animals.

Orthologs for DCAF15 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia DCAF15 35
  • 90.06 (n)
  • 94 (a)
DCAF15 36
  • 94 (a)
(Canis familiaris)
Mammalia DCAF15 35
  • 89.61 (n)
  • 94.17 (a)
DCAF15 36
  • 94 (a)
(Mus musculus)
Mammalia Dcaf15 35
  • 86.06 (n)
  • 90.83 (a)
Dcaf15 16
Dcaf15 36
  • 85 (a)
(Pan troglodytes)
Mammalia DCAF15 35
  • 99.44 (n)
  • 99.58 (a)
DCAF15 36
  • 99 (a)
(Rattus norvegicus)
Mammalia Dcaf15 35
  • 85.98 (n)
  • 90.98 (a)
(Monodelphis domestica)
Mammalia -- 36
  • 81 (a)
-- 36
  • 70 (a)
(Ornithorhynchus anatinus)
Mammalia DCAF15 36
  • 70 (a)
(Anolis carolinensis)
Reptilia DCAF15 36
  • 78 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia dcaf15 35
  • 67.63 (n)
  • 70.83 (a)
Str.2483 35
(Danio rerio)
Actinopterygii dcaf15 35
  • 62.82 (n)
  • 61.03 (a)
dcaf15 36
  • 55 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG6325 36
  • 12 (a)
Species with no ortholog for DCAF15:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for DCAF15 Gene

Gene Tree for DCAF15 (if available)
Gene Tree for DCAF15 (if available)

Paralogs for DCAF15 Gene

No data available for Paralogs for DCAF15 Gene

Variants for DCAF15 Gene

Sequence variations from dbSNP and Humsavar for DCAF15 Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type MAF
rs3217681 -- 13,959,896(-) GCCCA(-/CCCTGCCCGCCCTGGGCCCACCCTGCCCGCCCTGGGCCCA)CCTCC splice-donor-variant
rs4926322 -- 13,958,271(+) GCTGC(C/T)GACAC intron-variant
rs7245761 -- 13,959,273(+) CGGGG(C/T)CCCTG missense, reference
rs7256511 -- 13,958,598(+) GTGCC(C/T)GCAGT intron-variant
rs7260382 -- 13,958,756(+) AGTGT(C/T)GTCTC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for DCAF15 Gene

Variant ID Type Subtype PubMed ID
nsv911098 CNV Loss 21882294
dgv3738n71 CNV Loss 21882294
nsv911102 CNV Loss 21882294
dgv3739n71 CNV Loss 21882294
dgv3740n71 CNV Loss 21882294
dgv3741n71 CNV Loss 21882294
nsv828451 CNV Loss 20364138
dgv3742n71 CNV Loss 21882294
nsv820186 CNV Loss 19587683

Relevant External Links for DCAF15 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for DCAF15 Gene

Disorders for DCAF15 Gene

No disorders were found for DCAF15 Gene.

No data available for MalaCards , OMIM , UniProtKB/Swiss-Prot , University of Copenhagen DISEASES , Novoseek inferred disease relationships , Genatlas and External Links for DCAF15 Gene

Publications for DCAF15 Gene

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4
  2. A family of diverse Cul4-Ddb1-interacting proteins includes Cdt2, which is required for S phase destruction of the replication factor Cdt1. (PMID: 16949367) Jin J. … Walter J.C. (Mol. Cell 2006) 3 4
  3. An interaction network of the mammalian COP9 signalosome identifies Dda1 as a core subunit of multiple Cul4-based E3 ligases. (PMID: 19295130) Olma M.H. … Pintard L. (J. Cell. Sci. 2009) 3
  4. Systematic analysis of human protein complexes identifies chromosome segregation proteins. (PMID: 20360068) Hutchins J.R. … Peters J.M. (Science 2010) 3
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 4

Products for DCAF15 Gene

Sources for DCAF15 Gene

Back to Top