Free for academic non-profit institutions. Other users need a Commercial license

Aliases for DCAF15 Gene

Aliases for DCAF15 Gene

  • DDB1 And CUL4 Associated Factor 15 2 3 5
  • C19orf72 3 4
  • Chromosome 19 Open Reading Frame 72 2
  • DDB1- And CUL4-Associated Factor 15 3

External Ids for DCAF15 Gene

Previous HGNC Symbols for DCAF15 Gene

  • C19orf72

Previous GeneCards Identifiers for DCAF15 Gene

  • GC19P014063
  • GC19P013634

Summaries for DCAF15 Gene

GeneCards Summary for DCAF15 Gene

DCAF15 (DDB1 And CUL4 Associated Factor 15) is a Protein Coding gene.

UniProtKB/Swiss-Prot for DCAF15 Gene

  • May be involved in ubiquitination and degradation through a DBB1-CUL4 E3 protein-ubiquitin ligase.

No data available for Entrez Gene Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for DCAF15 Gene

Genomics for DCAF15 Gene

Regulatory Elements for DCAF15 Gene

Enhancers for DCAF15 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
- Elite enhancer/Elite enhancer-gene association

Enhancers around DCAF15 on UCSC Golden Path with GeneCards custom track

Promoters for DCAF15 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

Genomic Location for DCAF15 Gene

Chromosome:
19
Start:
13,952,492 bp from pter
End:
13,961,449 bp from pter
Size:
8,958 bases
Orientation:
Plus strand

Genomic View for DCAF15 Gene

Genes around DCAF15 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
DCAF15 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for DCAF15 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for DCAF15 Gene

Proteins for DCAF15 Gene

  • Protein details for DCAF15 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q66K64-DCA15_HUMAN
    Recommended name:
    DDB1- and CUL4-associated factor 15
    Protein Accession:
    Q66K64
    Secondary Accessions:
    • B3KS86
    • Q96DW0
    • Q9BU31

    Protein attributes for DCAF15 Gene

    Size:
    600 amino acids
    Molecular mass:
    66463 Da
    Quaternary structure:
    • Interacts with DDB1 and CUL4A.
    SequenceCaution:
    • Sequence=AAH13280.2; Type=Frameshift; Positions=89; Evidence={ECO:0000305};

neXtProt entry for DCAF15 Gene

Post-translational modifications for DCAF15 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for DCAF15 Gene

No data available for DME Specific Peptides for DCAF15 Gene

Domains & Families for DCAF15 Gene

Gene Families for DCAF15 Gene

Protein Domains for DCAF15 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for DCAF15 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with DCAF15: view

No data available for UniProtKB/Swiss-Prot for DCAF15 Gene

Function for DCAF15 Gene

Molecular function for DCAF15 Gene

UniProtKB/Swiss-Prot Function:
May be involved in ubiquitination and degradation through a DBB1-CUL4 E3 protein-ubiquitin ligase.

Phenotypes for DCAF15 Gene

genes like me logo Genes that share phenotypes with DCAF15: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for DCAF15 Gene

Localization for DCAF15 Gene

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for DCAF15 Gene COMPARTMENTS Subcellular localization image for DCAF15 gene
Compartment Confidence
nucleus 3
cytosol 2
peroxisome 2

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for DCAF15 Gene

Pathways & Interactions for DCAF15 Gene

SuperPathways for DCAF15 Gene

No Data Available

UniProtKB/Swiss-Prot Q66K64-DCA15_HUMAN

  • Pathway: Protein modification; protein ubiquitination.

Interacting Proteins for DCAF15 Gene

Gene Ontology (GO) - Biological Process for DCAF15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016567 protein ubiquitination IEA --
genes like me logo Genes that share ontologies with DCAF15: view

No data available for Pathways by source and SIGNOR curated interactions for DCAF15 Gene

Drugs & Compounds for DCAF15 Gene

No Compound Related Data Available

Transcripts for DCAF15 Gene

Unigene Clusters for DCAF15 Gene

DDB1 and CUL4 associated factor 15:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for DCAF15 Gene

ExUns: 1 ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6a · 6b · 6c ^ 7 ^ 8 ^ 9a · 9b ^ 10a · 10b ^ 11a · 11b ^ 12a · 12b ^ 13a · 13b ^ 14a · 14b · 14c
SP1: - - - - - -
SP2: - -
SP3:
SP4:
SP5: - -
SP6: -
SP7:

Relevant External Links for DCAF15 Gene

GeneLoc Exon Structure for
DCAF15
ECgene alternative splicing isoforms for
DCAF15

Expression for DCAF15 Gene

mRNA expression in normal human tissues for DCAF15 Gene

Protein differential expression in normal tissues from HIPED for DCAF15 Gene

This gene is overexpressed in Bone (61.4) and Pancreatic juice (6.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for DCAF15 Gene



Protein tissue co-expression partners for DCAF15 Gene

NURSA nuclear receptor signaling pathways regulating expression of DCAF15 Gene:

DCAF15

SOURCE GeneReport for Unigene cluster for DCAF15 Gene:

Hs.443636
genes like me logo Genes that share expression patterns with DCAF15: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for DCAF15 Gene

Orthologs for DCAF15 Gene

This gene was present in the common ancestor of animals.

Orthologs for DCAF15 Gene

Organism Taxonomy Gene Similarity Type Details
cow
(Bos Taurus)
Mammalia DCAF15 34
  • 90.06 (n)
  • 94 (a)
DCAF15 35
  • 94 (a)
OneToOne
dog
(Canis familiaris)
Mammalia DCAF15 34
  • 89.61 (n)
  • 94.17 (a)
DCAF15 35
  • 94 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Dcaf15 34
  • 86.06 (n)
  • 90.83 (a)
Dcaf15 16
Dcaf15 35
  • 85 (a)
OneToOne
chimpanzee
(Pan troglodytes)
Mammalia DCAF15 34
  • 99.44 (n)
  • 99.58 (a)
DCAF15 35
  • 99 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Dcaf15 34
  • 85.98 (n)
  • 90.98 (a)
oppossum
(Monodelphis domestica)
Mammalia -- 35
  • 81 (a)
OneToMany
-- 35
  • 70 (a)
OneToMany
platypus
(Ornithorhynchus anatinus)
Mammalia DCAF15 35
  • 70 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia DCAF15 35
  • 78 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia dcaf15 34
  • 67.63 (n)
  • 70.83 (a)
Str.2483 34
zebrafish
(Danio rerio)
Actinopterygii dcaf15 34
  • 62.82 (n)
  • 61.03 (a)
dcaf15 35
  • 55 (a)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta CG6325 35
  • 12 (a)
OneToOne
Species where no ortholog for DCAF15 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for DCAF15 Gene

ENSEMBL:
Gene Tree for DCAF15 (if available)
TreeFam:
Gene Tree for DCAF15 (if available)

Paralogs for DCAF15 Gene

No data available for Paralogs for DCAF15 Gene

Variants for DCAF15 Gene

Sequence variations from dbSNP and Humsavar for DCAF15 Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type
rs3217681 -- 13,959,896(-) GCCCA(-/CCCTGCCCGCCCTGGGCCCACCCTGCCCGCCCTGGGCCCA)CCTCC splice-donor-variant
rs10425669 -- 13,959,526(+) GGCCA(A/G)CCCAG intron-variant
rs10426021 -- 13,958,460(+) GGGCT(C/T)GGAGG intron-variant
rs10426215 -- 13,958,519(+) GGTTC(C/T)CCATG intron-variant
rs10426418 -- 13,958,603(+) CGCAG(C/T)GGTCT intron-variant

Structural Variations from Database of Genomic Variants (DGV) for DCAF15 Gene

Variant ID Type Subtype PubMed ID
nsv820186 CNV loss 19587683
nsv828451 CNV loss 20364138
nsv953979 CNV deletion 24416366

Variation tolerance for DCAF15 Gene

Residual Variation Intolerance Score: 10.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.50; 71.80% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for DCAF15 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
DCAF15

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for DCAF15 Gene

Disorders for DCAF15 Gene

Relevant External Links for DCAF15

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
DCAF15

No disorders were found for DCAF15 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for DCAF15 Gene

Publications for DCAF15 Gene

  1. A family of diverse Cul4-Ddb1-interacting proteins includes Cdt2, which is required for S phase destruction of the replication factor Cdt1. (PMID: 16949367) Jin J. … Walter J.C. (Mol. Cell 2006) 2 3 4 65
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4 65
  3. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin E.L. … Gygi S.P. (Cell 2015) 3 65
  4. A human interactome in three quantitative dimensions organized by stoichiometries and abundances. (PMID: 26496610) Hein M.Y. … Mann M. (Cell 2015) 3 65
  5. Toward a comprehensive characterization of a human cancer cell phosphoproteome. (PMID: 23186163) Zhou H. … Mohammed S. (J. Proteome Res. 2013) 4 65

Products for DCAF15 Gene

Sources for DCAF15 Gene

Content
Loading form....