Free for academic non-profit institutions. Other users need a Commercial license

Aliases for DBN1 Gene

Aliases for DBN1 Gene

  • Drebrin 1 2 3 5
  • Developmentally-Regulated Brain Protein 3 4
  • D0S117E 3 4
  • Drebrin E2 3
  • Drebrin E 3
  • Drebrin 3

External Ids for DBN1 Gene

Previous HGNC Symbols for DBN1 Gene

  • D0S117E

Previous GeneCards Identifiers for DBN1 Gene

  • GC05M177180
  • GC05M177726
  • GC05M176819
  • GC05M176865
  • GC05M176867
  • GC05M176816
  • GC05M176883
  • GC05M171803

Summaries for DBN1 Gene

Entrez Gene Summary for DBN1 Gene

  • The protein encoded by this gene is a cytoplasmic actin-binding protein thought to play a role in the process of neuronal growth. It is a member of the drebrin family of proteins that are developmentally regulated in the brain. A decrease in the amount of this protein in the brain has been implicated as a possible contributing factor in the pathogenesis of memory disturbance in Alzheimer's disease. At least two alternative splice variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

GeneCards Summary for DBN1 Gene

DBN1 (Drebrin 1) is a Protein Coding gene. Diseases associated with DBN1 include Alzheimer Disease and Down Syndrome. Among its related pathways are Cytoskeletal Signaling and G-Beta Gamma Signaling. Gene Ontology (GO) annotations related to this gene include actin binding and profilin binding. An important paralog of this gene is DBNL.

UniProtKB/Swiss-Prot for DBN1 Gene

  • Drebrins might play some role in cell migration, extension of neuronal processes and plasticity of dendrites. Required for actin polymerization at immunological synapses (IS) and for CXCR4 recruitment to IS.

Gene Wiki entry for DBN1 Gene

Additional gene information for DBN1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for DBN1 Gene

Genomics for DBN1 Gene

GeneHancer (GH) Regulatory Elements for DBN1 Gene

Promoters and enhancers for DBN1 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH05I177467 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 558.3 +8.8 8824 7.1 HDGF PKNOX1 ARID4B SIN3A YBX1 GLIS2 ZNF143 KLF7 FOS RUNX3 DBN1 MXD3 DOK3 DDX41 FAM193B RPL21P60 PRR7 FGFR4 ENSG00000279821 PIR32965
GH05I177476 Enhancer 1.3 Ensembl ENCODE dbSUPER 550.8 +1.6 1591 4.3 PKNOX1 ARID4B POLR2B ATF7 RUNX3 RXRA NCOA1 ZNF592 MEF2D SSRP1 DBN1 ENSG00000279821 PRR7 FGFR4 PIR32965 GC05P176931
GH05I177425 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 12.2 +51.0 50964 8.6 HDGF PKNOX1 SMAD1 ARNT ARID4B SIN3A DMAP1 ZNF2 IRF4 YY1 GRK6 NSD1 FAF2 UIMC1 DOK3 ENSG00000247679 LOC202181 ZNF346-IT1 PFN3 FAM193B
GH05I177443 Promoter/Enhancer 2.5 EPDnew Ensembl ENCODE dbSUPER 12 +34.0 33972 6.1 HDGF HNRNPUL1 PKNOX1 CLOCK MLX ARID4B SIN3A DMAP1 ZNF2 POLR2B PRR7 PRR7-AS1 UIMC1 FAM193B F12 GRK6 PFN3 NSD1 SLC34A1 DBN1
GH05I177360 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 11.1 +117.9 117906 3.3 HDGF PKNOX1 ATF1 ARNT SIN3A DMAP1 ZNF2 ZBTB7B ZNF48 GLIS2 RGS14 RAB24 MXD3 LOC105377750 PFN3 GRK6 F12 PRELID1 DBN1 DOK3
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around DBN1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the DBN1 gene promoter:

Genomic Locations for DBN1 Gene

Genomic Locations for DBN1 Gene
23,729 bases
Minus strand

Genomic View for DBN1 Gene

Genes around DBN1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
DBN1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for DBN1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for DBN1 Gene

Proteins for DBN1 Gene

  • Protein details for DBN1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein Accession:
    Secondary Accessions:
    • A8MV58
    • B2RBG0
    • Q9UFZ5

    Protein attributes for DBN1 Gene

    649 amino acids
    Molecular mass:
    71429 Da
    Quaternary structure:
    • Interacts with RUFY3 (By similarity). Binds F-actin. Interacts with CXCR4; this interaction is enhanced by antigenic stimulation (PubMed:20215400).

    Three dimensional structures from OCA and Proteopedia for DBN1 Gene

    Alternative splice isoforms for DBN1 Gene


neXtProt entry for DBN1 Gene

Post-translational modifications for DBN1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for DBN1 Gene

Domains & Families for DBN1 Gene

Gene Families for DBN1 Gene

Human Protein Atlas (HPA):
  • Plasma proteins
  • Predicted intracellular proteins

Protein Domains for DBN1 Gene

Suggested Antigen Peptide Sequences for DBN1 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with DBN1: view

No data available for UniProtKB/Swiss-Prot for DBN1 Gene

Function for DBN1 Gene

Molecular function for DBN1 Gene

GENATLAS Biochemistry:
drebrin,actin binding protein involved in neuronal growth,developmentally regulated,embryonic isoforms E1,E2
UniProtKB/Swiss-Prot Function:
Drebrins might play some role in cell migration, extension of neuronal processes and plasticity of dendrites. Required for actin polymerization at immunological synapses (IS) and for CXCR4 recruitment to IS.

Phenotypes From GWAS Catalog for DBN1 Gene

Gene Ontology (GO) - Molecular Function for DBN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003779 actin binding NAS 12761245
GO:0005515 protein binding IPI 12577067
GO:0005522 profilin binding ISS --
GO:0045296 cadherin binding IDA 25468996
genes like me logo Genes that share ontologies with DBN1: view
genes like me logo Genes that share phenotypes with DBN1: view

Animal Models for DBN1 Gene

MGI Knock Outs for DBN1:

miRNA for DBN1 Gene

miRTarBase miRNAs that target DBN1

Clone Products

  • Addgene plasmids for DBN1

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for DBN1 Gene

Localization for DBN1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for DBN1 Gene

Cytoplasm. Cytoplasm, cell cortex. Cell junction. Cell projection. Cell projection, growth cone. Note=In the absence of antigen, evenly distributed throughout subcortical regions of the T-cell membrane and cytoplasm. In the presence of antigen, distributes to the immunological synapse forming at the T-cell-APC contact area, where it localizes at the peripheral and distal supramolecular activation clusters (SMAC) (PubMed:20215400). Colocalized with DBN1, RUFY3 and F-actin at the transitional domain of the axonal growth cone (By similarity). {ECO:0000250 UniProtKB:Q9QXS6, ECO:0000269 PubMed:20215400}.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for DBN1 gene
Compartment Confidence
cytoskeleton 5
plasma membrane 4
nucleus 2
cytosol 2

Subcellular locations from the

Human Protein Atlas (HPA)
  • Actin filaments (3)
  • Plasma membrane (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for DBN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005622 intracellular IEA --
GO:0005737 cytoplasm NAS 12009525
GO:0005856 cytoskeleton IDA 24327345
GO:0005886 plasma membrane IEA --
GO:0005911 cell-cell junction IEA --
genes like me logo Genes that share ontologies with DBN1: view

Pathways & Interactions for DBN1 Gene

genes like me logo Genes that share pathways with DBN1: view

Pathways by source for DBN1 Gene

2 Cell Signaling Technology pathways for DBN1 Gene
1 Qiagen pathway for DBN1 Gene

Gene Ontology (GO) - Biological Process for DBN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007015 actin filament organization ISS,IEA --
GO:0007275 multicellular organism development IEA --
GO:0007399 nervous system development IEA --
GO:0010643 cell communication by chemical coupling IEA --
GO:0010644 cell communication by electrical coupling IEA --
genes like me logo Genes that share ontologies with DBN1: view

No data available for SIGNOR curated interactions for DBN1 Gene

Drugs & Compounds for DBN1 Gene

(2) Drugs for DBN1 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(2) Additional Compounds for DBN1 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with DBN1: view

Transcripts for DBN1 Gene

Unigene Clusters for DBN1 Gene

Drebrin 1:
Representative Sequences:

Clone Products

  • Addgene plasmids for DBN1

Alternative Splicing Database (ASD) splice patterns (SP) for DBN1 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4a · 4b ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13a · 13b ^ 14 ^ 15a · 15b ^ 16 ^ 17a · 17b · 17c
SP1: - - -
SP2: - - - - -
SP3: - - - - -
SP4: -
SP6: - -

Relevant External Links for DBN1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for DBN1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for DBN1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for DBN1 Gene

This gene is overexpressed in Fetal Brain (18.5), Bone marrow mesenchymal stem cell (10.8), and Bone marrow stromal cell (6.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for DBN1 Gene

Protein tissue co-expression partners for DBN1 Gene

NURSA nuclear receptor signaling pathways regulating expression of DBN1 Gene:


SOURCE GeneReport for Unigene cluster for DBN1 Gene:


mRNA Expression by UniProt/SwissProt for DBN1 Gene:

Tissue specificity: Brain neurons. Also found in the heart, placenta, skeletal muscle, kidney and pancreas. Expressed in peripheral blood lymphocytes, including T-cells (at protein level).

Evidence on tissue expression from TISSUES for DBN1 Gene

  • Nervous system(5)
  • Muscle(4.4)
  • Blood(4.2)
  • Eye(4.2)
  • Liver(4.2)
  • Bone(4)
  • Kidney(2.7)
genes like me logo Genes that share expression patterns with DBN1: view

No data available for mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for DBN1 Gene

Orthologs for DBN1 Gene

This gene was present in the common ancestor of animals.

Orthologs for DBN1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia DBN1 33 34
  • 99.41 (n)
(Bos Taurus)
Mammalia DBN1 33 34
  • 88.94 (n)
(Canis familiaris)
Mammalia DBN1 33 34
  • 88.59 (n)
(Mus musculus)
Mammalia Dbn1 33 16 34
  • 85.63 (n)
(Rattus norvegicus)
Mammalia Dbn1 33
  • 85.42 (n)
(Monodelphis domestica)
Mammalia DBN1 34
  • 62 (a)
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 17 (a)
(Gallus gallus)
Aves DBN1 33 34
  • 70.88 (n)
(Anolis carolinensis)
Reptilia DBN1 34
  • 62 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia dbn1 33
  • 63.2 (n)
Str.17297 33
African clawed frog
(Xenopus laevis)
Amphibia Xl.24319 33
(Danio rerio)
Actinopterygii LOC561153 33
  • 64.72 (n)
dbn1 34
  • 49 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG10083 34
  • 19 (a)
(Caenorhabditis elegans)
Secernentea K08E3.4 34
  • 17 (a)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.3471 34
  • 23 (a)
Species where no ortholog for DBN1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for DBN1 Gene

Gene Tree for DBN1 (if available)
Gene Tree for DBN1 (if available)

Paralogs for DBN1 Gene

Paralogs for DBN1 Gene

(1) SIMAP similar genes for DBN1 Gene using alignment to 7 proteins:

genes like me logo Genes that share paralogs with DBN1: view

Variants for DBN1 Gene

Sequence variations from dbSNP and Humsavar for DBN1 Gene

SNP ID Clin Chr 05 pos Variation AA Info Type
VAR_035910 A breast cancer sample p.Glu278Lys
VAR_035911 A breast cancer sample p.Glu640Gln
rs1000212219 -- 177,461,518(-) A/T intron_variant
rs1000216234 -- 177,472,009(-) G/A/C intron_variant
rs1000306866 -- 177,466,351(-) GGAGATGCTGCTCCCAAGGAGATG/GGAGATG intron_variant

Structural Variations from Database of Genomic Variants (DGV) for DBN1 Gene

Variant ID Type Subtype PubMed ID
dgv10184n54 CNV loss 21841781
dgv3231n106 CNV deletion 24896259
dgv733n27 CNV loss 19166990
dgv963e201 CNV deletion 23290073
esv1004774 CNV deletion 20482838
esv2731196 CNV deletion 23290073
esv2731198 CNV deletion 23290073
nsv1073511 CNV deletion 25765185
nsv1161311 CNV duplication 26073780
nsv1161313 CNV duplication 26073780
nsv329790 CNV deletion 16902084
nsv471057 CNV loss 18288195
nsv515805 CNV loss 19592680

Variation tolerance for DBN1 Gene

Residual Variation Intolerance Score: 13.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.69; 73.02% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for DBN1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for DBN1 Gene

Disorders for DBN1 Gene

MalaCards: The human disease database

(2) MalaCards diseases for DBN1 Gene - From: DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
alzheimer disease
  • ad
down syndrome
  • trisomy 21
- elite association - COSMIC cancer census association via MalaCards
Search DBN1 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for DBN1

genes like me logo Genes that share disorders with DBN1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for DBN1 Gene

Publications for DBN1 Gene

  1. Molecular cloning of cDNA encoding human drebrin E and chromosomal mapping of its gene. (PMID: 8216329) Toda M … Uyemura K (Biochemical and biophysical research communications 1993) 2 3 4 22 58
  2. F-actin-binding protein drebrin regulates CXCR4 recruitment to the immune synapse. (PMID: 20215400) Pérez-Martínez M … Sánchez-Madrid F (Journal of cell science 2010) 3 4 22 58
  3. Control of cell shape and plasticity during development and disease by the actin-binding protein Drebrin. (PMID: 20183806) Dun XP … Chilton JK (Histology and histopathology 2010) 3 22 58
  4. Targeting of the F-actin-binding protein drebrin by the microtubule plus-tip protein EB3 is required for neuritogenesis. (PMID: 18806788) Geraldo S … Gordon-Weeks PR (Nature cell biology 2008) 3 22 58
  5. Decreased drebrin mRNA expression in Alzheimer disease: correlation with tau pathology. (PMID: 18338803) Julien C … Calon F (Journal of neuroscience research 2008) 3 22 58

Products for DBN1 Gene

Sources for DBN1 Gene

Loading form....