Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

CTLA4 Gene

protein-coding   GIFtS: 66
GCID: GC02P204696

cytotoxic T-lymphocyte-associated protein 4

(Previous name: celiac disease 3 )
(Previous symbol: CELIAC3)
 Explore 196 diseases affiliated with
CTLA4 via our new
 Human Malady Compendium 
Biological research products
for CTLA4
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Cytotoxic T-Lymphocyte-Associated Protein 41 2     CD281
CD1521 2 3     ICOS1
CELIAC31 2 5     CD152 Isoform2
CD1 2     Cytotoxic T Lymphocyte Associated Antigen 4 Short Spliced Form2
GSE1 2     Cytotoxic T-Lymphocyte Antigen 42
Celiac Disease 31 2     Cytotoxic T-Lymphocyte Protein 42
Cytotoxic T-Lymphocyte-Associated Antigen 42 3     Cytotoxic T-Lymphocyte-Associated Serine Esterase-42
CTLA-42 3     Ligand And Transmembrane Spliced Cytotoxic T Lymphocyte Associated Antigen 42
GRD42 5     CD152 Antigen3
IDDM122 5     

External Ids:    HGNC: 25051   Entrez Gene: 14932   Ensembl: ENSG000001635997   OMIM: 1238905   UniProtKB: P164103   

Export aliases for CTLA4 gene to outside databases

Previous GC identifers: GC02P202949 GC02P203457 GC02P204935 GC02P204558 GC02P204440 GC02P196580


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for CTLA4:
This gene is a member of the immunoglobulin superfamily and encodes a protein which transmits an inhibitory signal to T
cells. The protein contains a V domain, a transmembrane domain, and a cytoplasmic tail. Alternate transcriptional
splice variants, encoding different isoforms, have been characterized. The membrane-bound isoform functions as a
homodimer interconnected by a disulfide bond, while the soluble isoform functions as a monomer. Mutations in this gene
have been associated with insulin-dependent diabetes mellitus, Graves disease, Hashimoto thyroiditis, celiac disease,
systemic lupus erythematosus, thyroid-associated orbitopathy, and other autoimmune diseases. (provided by RefSeq, Jul
2008)

UniProtKB/Swiss-Prot: CTLA4_HUMAN, P16410
Function: Inhibitory receptor acting as a major negative regulator of T-cell responses. The affinity of CTLA4 for its
natural B7 family ligands, CD80 and CD86, is considerably stronger than the affinity of their cognate stimulatory
coreceptor CD28

Gene Wiki entry for CTLA4 (CTLA-4)


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000002.11  NC_018913.1  NT_005403.17  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the CTLA4 gene promoter:
         AML1a   AP-1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidCTLA4 promoter sequence
   Search SABiosciences Chromatin IP Primers for CTLA4

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat CTLA4


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 2q33   Ensembl cytogenetic band:  2q33.2   HGNC cytogenetic band: 2q33

CTLA4 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
CTLA4 gene location

GeneLoc information about chromosome 2         GeneLoc Exon Structure

GeneLoc location for GC02P204696:  view genomic region     (about GC identifiers)

Start:
204,732,509 bp from pter      End:
204,738,683 bp from pter
Size:
6,175 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: CTLA4_HUMAN, P16410 (See protein sequence)
Recommended Name: Cytotoxic T-lymphocyte protein 4 precursor  
Size: 223 amino acids; 24656 Da
Subunit: Homodimer; disulfide-linked. Binds to CD80/B7-1 and CD86/B7.2
Subcellular location: Cell membrane; Single-pass type I membrane protein. Note=Exists primarily an intracellular
antigen whose surface expression is tightly regulated by restricted trafficking to the cell surface and rapid
internalisation;
6/7 PDB 3D structures from and Proteopedia for CTLA4 (see all 7):
1AH1 (3D)        1H6E (3D)        1I85 (3D)        1I8L (3D)        2X44 (3D)        3BX7 (3D)    
Secondary accessions: A0N1S0 E9PDH0 Q0PP65 Q52MC1 Q53TD5 Q5S005 Q8WXJ1 Q96P43 Q9UKN9
Alternative splicing: 4 isoforms:  P16410-1   P16410-2   P16410-3   P16410-4   

Explore the universe of human proteins at neXtProt for CTLA4: NX_P16410

Post-translational modifications:

  • N-glycosylation is important for dimerization1
  • Phosphorylation at Tyr-201 prevents binding to the AP-2 adapter complex, blocks endocytosis, and leads to retention of
  • CTLA4 on the cell surface1
  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_P16410

  • CTLA4 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins (2 alternative transcripts): 
    NP_001032720.1  NP_005205.2  

    ENSEMBL proteins: 
     ENSP00000303939   ENSP00000295854   ENSP00000417779   ENSP00000409707  
    Reactome Protein details: P16410
    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    R&D Systems Recombinant & Natural Proteins for CTLA4 (CTLA-4)
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate: CTLA4
    OriGene Custom Protein Services for CTLA4 
    GenScript Custom Purified and Recombinant Proteins Services for CTLA4
    Novus Biologicals CTLA4 Proteins
    Novus Biologicals CTLA4 Lysate
    Sino Biological Recombinant Protein for CTLA4
    ProSpec Recombinant Protein for CTLA4
    Uscn Proteins for CTLA4

    Gene Ontology (GO): 5/7 cellular component terms (GO ID links to tree view) (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005794Golgi apparatus IDA15814706
    GO:0005886plasma membrane TAS--
    GO:0005887integral to plasma membrane TAS3220103
    GO:0009897external side of plasma membrane IDA18641304
    GO:0016020membrane ----


    CTLA4 for ontologies           About GeneDecksing



    CTLA4 Antibody Products: 
    EMD Millipore Mono- and Polyclonal Antibodies for the study of CTLA4
    R&D Systems Antibodies for CTLA4 (CTLA-4)
    OriGene Antibodies: CTLA4
    OriGene Custom Antibody Services for CTLA4 
    GenScript Custom Superior Antibodies Services for CTLA4
    Novus Biologicals CTLA4 Antibodies
    Abcam antibodies for CTLA4 
    Uscn Antibodies for CTLA4
    ThermoFisher Antibodies for CTLA4

    Assay Products for CTLA4: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    R&D Systems Multiplex/Array Assay Kits & Reagents for CTLA4 (CTLA-4)
    GenScript Custom Assay Services for CTLA4
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for CTLA4


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    CTLA4 for domains           About GeneDecksing

    4 InterPro domains/families:
     IPR003596 Ig_V-set_subgr
     IPR013783 Ig-like_fold
     IPR013106 Ig_V-set
     IPR008096 CTLA4

    Graphical View of Domain Structure for InterPro Entry P16410

    ProtoNet protein and cluster: P16410

    3 Blocks protein families:
    IPB003596 Immunoglobulin V-type
    IPB003599 Immunoglobulin subtype
    IPB008096 Cytotoxic T-lymphocyte antigen 4 signature


    UniProtKB/Swiss-Prot: CTLA4_HUMAN, P16410
    Similarity: Contains 1 Ig-like V-type (immunoglobulin-like) domain


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: CTLA4_HUMAN, P16410
    Function: Inhibitory receptor acting as a major negative regulator of T-cell responses. The affinity of CTLA4 for its
    natural B7 family ligands, CD80 and CD86, is considerably stronger than the affinity of their cognate stimulatory
    coreceptor CD28

         Genatlas biochemistry entry for CTLA4:
    cytotoxic T-lymphocyte-associated granule serine protease 4,B7 costimulatory protein receptor for CD80,CD86,negative
    regulatory T cell presenting costimulatory molecule,member of the immunoglobulin superfamily,with an association of
    the exon 3 microsatellite,106bp allele with autoimmune disorders (conferring susceptibility to Graves disease and to
    thyroid associated orbitopathy but not to systemic lupus erythematosus),susceptibility gene for the celiac disease and
    for multiple sclerosis

    miRNA
    Products:
        
    miRTarBase miRNAs that target CTLA4:
    hsa-mir-155 (MIRT004436)

    Browse 3'-UTR reporter clones for miRNA target validation
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat CTLA4
    8/14 QIAGEN miScript miRNA Assays for microRNAs that regulate CTLA4 (see all 14):
    hsa-miR-4324 hsa-miR-502-5p hsa-miR-4311 hsa-miR-3688-3p hsa-miR-4255 hsa-miR-496 hsa-miR-656 hsa-miR-544b
    SwitchGear 3'UTR luciferase reporter plasmidCTLA4 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for CTLA4 (see all 7)
    OriGene shRNA RFP: CTLA4
    OriGene siRNA: CTLA4
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat CTLA4

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for CTLA4

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for CTLA4 (see all 4)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for CTLA4 (see all 2)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector (see all 2): CTLA4 (NM_005214)
    Sino Biological Human cDNA Clone for CTLA4
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for CTLA4
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CTLA4 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for CTLA4
    Search LifeMap BioReagents cell lines for CTLA4

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CTLA4

    Gene Ontology (GO): 1 molecular function term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005515protein binding IPI--


    CTLA4 for ontologies           About GeneDecksing


    1 GenomeRNAi human phenotype for CTLA4:
     Increased cell number in G1, a 

    Animal Models:
         Mouse knock-outs for CTLA4: Ctla4tm1All Ctla4tm1Mak Ctla4tm1Shr
         14 MGI mutant phenotypes (inferred from 5 alleles(MGI details for Ctla4):
     cardiovascular system  cellular  digestive/alimentary  endocrine/exocrine gland  hematopoietic system 
     homeostasis/metabolism  immune system  integument  liver/biliary system  mortality/aging 
     normal  pigmentation  respiratory system  skeleton 

    CTLA4 for phenotypes           About GeneDecksing


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways - 5/10 super-pathways (see all 10About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1Immune System
    Immune System1.00
    Adaptive Immune System0.59
    2CD28 co-stimulation
    Costimulation by the CD28 family0.41
    CTLA4 Signaling0.15
    3Rheumatoid arthritis
    Rheumatoid arthritis1.00
    4Cell adhesion molecules (CAMs)
    Cell adhesion molecules (CAMs)1.00
    5PKC-Theta Pathway
    TCR Signaling0.68

    Pathway sources
    See GeneCards unified pathways
    Show all pathways

    3 Downloadable PowerPoint Slides of QIAGEN Pathway Central Maps for CTLA4
        CTLA4 Signaling
    TCR Signaling
    CD28 Signaling in T-Helper Cell

    1 BioSystems Pathway for CTLA4 
        Calcineurin-regulated NFAT-dependent transcription in lymphocytes

    4        Reactome Pathways for CTLA4
        Costimulation by the CD28 family
    Adaptive Immune System
    CTLA4 inhibitory signaling
    Immune System


    4         Kegg Pathways  (Kegg details for CTLA4):
        Cell adhesion molecules (CAMs)
    T cell receptor signaling pathway
    Autoimmune thyroid disease
    Rheumatoid arthritis


    CTLA4 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for CTLA4

    STRING Interaction Network Preview (showing 5 interactants - click image to see 22)

    5/24 Interacting proteins for CTLA4 (P164101, 2, 3 ENSP000003039394) via UniProtKB, MINT, STRING, and/or I2D (see all 24)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    PIK3R1P279862, 3, ENSP000002743354MINT-8035246 MINT-8035216 MINT-8035201 I2D: score=2 STRING: ENSP00000274335
    CD86P420811, 3, ENSP000003320494EBI-1030991,EBI-1030956 I2D: score=3 STRING: ENSP00000332049
    CD80P336811, 3, ENSP000002642464EBI-1030991,EBI-1031024 I2D: score=4 STRING: ENSP00000264246
    FYNP062413, ENSP000003576564I2D: score=4 STRING: ENSP00000357656
    LCKP062393, ENSP000003378254I2D: score=2 STRING: ENSP00000337825
    About this table

    Gene Ontology (GO): 5/7 biological process terms (GO ID links to tree view) (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006955immune response IEA--
    GO:0006974response to DNA damage stimulus IMP17875758
    GO:0030889negative regulation of B cell proliferation IMP17875758
    GO:0031295T cell costimulation TAS--
    GO:0043065positive regulation of apoptotic process IMP17875758


    CTLA4 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    CTLA4 for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for CTLA4
    UniProtKB/Swiss-Prot: CTLA4_HUMAN, P16410
    Pharmaceutical: Engineered fusion proteins consisting of the extracellular domain of CTLA4 and the IgG Fc region
    (Ctla4-Ig), inhibit T-cell-dependent antibody responses, and are used as immunosuppressive agents. They are soluble,
    have an enhanced affinity for B7 ligands and act as a competitive inhibitor of CD28


    1 DrugBank Compound for CTLA4    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    Alpha-D-Mannose-- 3458-28-4target--17139284 17016423

    10/50 Novoseek chemical compound relationships for CTLA4 gene (see all 50)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    mh-30 81.1 3 15841095 (1), 15316504 (1)
    abatacept 77.4 32 18050376 (2), 18718877 (1), 19243211 (1), 19259798 (1) (see all 13)
    ctla4-ig 74.7 17 8228824 (2), 17924973 (2), 7678111 (1), 7504299 (1) (see all 13)
    belatacept 63 3 16121705 (1), 20502720 (1)
    indoleamine 45.9 4 17981708 (1), 17715231 (1), 18816483 (1), 16493086 (1)
    il 10 42.3 7 15607008 (2), 15708894 (1), 18261221 (1), 18337305 (1) (see all 5)
    ionomycin 38.2 12 12444128 (3), 10600000 (2), 10777098 (1), 9857283 (1)
    tyrosine 27.9 60 9712716 (6), 9973379 (4), 10604992 (3), 10842319 (3) (see all 29)
    tgf beta1 21.3 6 19269255 (4), 19597336 (1), 16872485 (1)
    infliximab 18.8 1 19104936 (1)

    Search CenterWatch for drugs/clinical trials and news about CTLA4 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for CTLA4 gene (2 alternative transcripts): 
    NM_001037631.2  NM_005214.4  

    Unigene Cluster for CTLA4:

    Cytotoxic T-lymphocyte-associated protein 4
    Hs.247824  [show with all ESTs]
    Unigene Representative Sequence: NM_005214
    5 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000302823(uc002vak.2 uc002val.2 uc010fty.2 uc010ftz.2)
    ENST00000295854 ENST00000487393 ENST00000472206 ENST00000427473

    miRNA
    Products:
         
    Browse 3'-UTR reporter clones for miRNA target validation
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat CTLA4
    8/14 QIAGEN miScript miRNA Assays for microRNAs that regulate CTLA4 (see all 14):
    hsa-miR-4324 hsa-miR-502-5p hsa-miR-4311 hsa-miR-3688-3p hsa-miR-4255 hsa-miR-496 hsa-miR-656 hsa-miR-544b
    SwitchGear 3'UTR luciferase reporter plasmidCTLA4 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for CTLA4 (see all 7)
    OriGene shRNA RFP: CTLA4
    OriGene siRNA: CTLA4
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat CTLA4
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for CTLA4 (see all 4)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for CTLA4 (see all 2)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector (see all 2): CTLA4 (NM_005214)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for CTLA4
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CTLA4 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for CTLA4
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat CTLA4
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat CTLA4
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat CTLA4

    Additional cDNA sequence: 

    AF414120.1 AF486806.1 AJ298052.1 AK313732.1 AY209009.1 AY792514.1 AY999702.1 BC069566.1 
    BC070162.1 BC074842.2 BC074893.2 DQ785106.1 L15006.1 U90273.1 

    5 DOTS entries:

    DT.40126443  DT.91756479  DT.95146339  DT.95133126  DT.99980295 

    22 AceView cDNA sequences:

    U90273 BC074842 AF414120 NM_005214 AF486806 AI819438 AW207094 AW515943 
    BC074893 BG058720 BG236211 BV183431 BM997840 BC069566 AY209009 L15006 
    CD639535 BC070162 BE837454 AA210929 BG536887 AI860199 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    CTLA4 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: TATAATATTT

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image
    See CTLA4 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for CTLA4

    SOURCE GeneReport for Unigene cluster: Hs.247824

    UniProtKB/Swiss-Prot: CTLA4_HUMAN, P16410
    Tissue specificity: Widely expressed with highest levels in lymphoid tissues. Detected in activated T-cells where
    expression levels are 30- to 50-fold less than CD28, the stimulatory coreceptor, on the cell surface following
    activation

        SABiosciences Expression via Pathway-Focused PCR Arrays including CTLA4: 
              Cell Surface Markers in human mouse rat
              Th1/Th2 Response in human mouse rat
              T-cell & B-cell Activation in human mouse rat
              T-Cell Anergy & Immune Tolerance in human mouse rat
              Diabetes in human mouse rat

    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for CTLA4
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat CTLA4
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat CTLA4
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat CTLA4
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CTLA4

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of chordates.

    Orthologs for CTLA4 gene from 3/9 species (see all 9)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Ctla41 , 5 cytotoxic T-lymphocyte-associated protein 41, 5 79.97(n)1
    74.89(a)1
      1 (30.58 cM)5
    124771  NM_009843.31  NP_033973.21 
     608870005 
    chicken
    (Gallus gallus)
    Aves CTLA41 cytotoxic T-lymphocyte-associated protein 4 60.85(n)
    49.23(a)
      424106  NM_001040091.1  NP_001035180.1 
    lizard
    (Anolis carolinensis)
    Reptilia --
    --
    --
    34(a)
    31(a)
    many → 1
    many → 1
    AAWZ02040505(1945-5793)
    GL343208.1(2684025-2687950)


    ENSEMBL Gene Tree for CTLA4 (if available)
    TreeFam Gene Tree for CTLA4 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for CTLA4 gene
    CD282  
    1 SIMAP similar gene for CTLA4 using alignment to 8 protein entries:     CTLA4_HUMAN (see all proteins):
    CTLA-4

    CTLA4 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    UniProtKB/Swiss-Prot: CTLA4_HUMAN, P16410
    Polymorphism: Genetic variations in CTLA4 are associated with susceptibility to several autoimmune disorders. They
    influence responsiveness to hepatitis B virus (HBV) infection [MIM:610424]


    140 NCBI SNPs in CTLA4 are shown (see top 10    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 2 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs2317751,2
    C,F,O,A,H,other196580012(+) TGGCTA/GCCAGG 4 T A mis1 ese339Minor allele frequency- G:0.44EA NA MN NS CSA WA EU 11608
    rs358325611,2
    F--196577998(+) TGCTCA/GTCCCC 2 -- us2k15Minor allele frequency- G:0.01MN 404
    rs134101491,2
    C,H--196578058(+) CTTTAG/ACCCAT 2 -- us2k19Minor allele frequency- A:0.00NS EA MN 824
    rs7336191,2
    C,F,H,--196578103(-) ATTGAG/CAACAG 2 -- us2k116Minor allele frequency- C:0.03NS EA NA MN CSA WA 1585
    rs360218101,2
    F--196578126(+) CTTTTC/TGTCTT 2 -- us2k15Minor allele frequency- T:0.01MN 404
    rs30872411,2
    C,H--196578189(+) TACATA/GATACT 2 -- us2k19Minor allele frequency- G:0.00MN NS EA 824
    rs45538081,2
    C,F,A,H,--196578303(+) TTTTTA/GAAAAA 2 -- us2k114Minor allele frequency- G:0.15MN NS EA NA WA 1014
    rs621825951,2
    C,F,--196578486(+) AATCTG/ACATGT 2 -- us2k16Minor allele frequency- A:0.12NA WA EA 248
    rs168402521,2
    C,F,H,--196578817(+) ATGGAC/TGGACT 2 -- us2k132Minor allele frequency- T:0.15NA NS EA WA 3332
    rs115713171,2
    C,F,H,--196579306(+) TTTTCC/TGCCTA 2 -- us2k1 trp321Minor allele frequency- T:0.03MN NS EA NA 2374
    rs57429091,2
    C,F,H,--196579645(+) ATCCTC/TAAAGT 2 -- us2k130Minor allele frequency- T:0.13NS NA MN EA 4106
    rs352197271,2
    C,F,--196581347(+) AGGATG/ACTCAG 2 -- int16Minor allele frequency- A:0.01MN EA 524
    rs30872421,2
    C--196581383(+) AGGGTA/C/G/
            
    AGGGA
    2 -- int15MN 404
    rs753395241,2
    F,--196581899(+) TCAGGG/AGAAGC 2 -- int11Minor allele frequency- A:0.02WA 118
    rs556571781,2
    C,--196582499(+) TGAAGC/GGGGGA 2 -- int10--------
    rs563876031,2
    C,F,--196582514(+) AGGCCG/ATGGGG 2 -- int11Minor allele frequency- A:0.06EA 120
    rs10654421,2
    C,H--196582769(+) CATGAT/CGGGGA 4 /T /M mis110Minor allele frequency- C:0.00MN NS EA 990
    rs739930401,2
    C,F,--196583108(+) ATTGTG/TGGTGG 2 -- int13Minor allele frequency- T:0.06WA CSA 122
    rs412659611,2
    C,F,--196583159(+) NNNNAG/ATTGGG 2 -- int11Minor allele frequency- A:0.03NA 120
    rs799712951,2
    --196583658(+) AGAACC/TGTAGG 2 -- int10--------
    rs115713181,2
    C,H,--196584619(-) GAATGT/CTCACA 2 -- int14Minor allele frequency- C:0.00NS EA 414
    rs560837531,2
    C,--196585101(+) TTATGA/GTGTGG 2 -- ut310--------
    rs133845481,2
    C,H,--196585208(+) GAGACG/ATTTAT 2 -- ut31 ese34Minor allele frequency- A:0.00NS EA 396
    rs354111541,2
    C,F,--196585284(+) TCAAGG/CCTTCA 2 -- ut315Minor allele frequency- C:0.01MN 400
    rs354827311,2
    C,F,--196586125(+) GGAAGG/CTATCC 2 -- ds50015Minor allele frequency- C:0.01MN 396
    rs340318801,2
    C,F,--196586144(+) TCCTTT/CTGATT 2 -- ds50016Minor allele frequency- C:0.02MN WA 514
    rs115713191,2
    C,F,H,--196586194(-) GACTGC/TTATGT 2 -- ds500117Minor allele frequency- T:0.13MN NS EA NA WA 1152
    rs1472677151,2
    --204730793(+) CCACCC/TTTTTC 2 -- us2k10--------
    rs115713151,2
    C,F,H,--204730901(-) CTGGAG/ATTGAA 2 -- us2k130Minor allele frequency- A:0.48NS EA NA MN WA CSA 2732
    rs7336181,2
    C,F,A,H,--204730944(-) GACAGA/GCAGCT 2 -- us2k121Minor allele frequency- G:0.17NS EA NA MN WA 2742
    rs1886074421,2
    --204731069(+) TTGGCC/GCTTGA 2 -- us2k10--------
    rs115713161,2
    C,F,H,--204731089(-) AGAAAC/TCTTCA 2 -- us2k125Minor allele frequency- T:0.34NA NS EA MN CSA WA 2437
    rs1155524681,2
    F,--204731128(+) GCAGGT/ACAGAA 2 -- us2k11Minor allele frequency- A:0.03WA 118
    rs1814813821,2
    --204731175(+) TACATA/GTGTAA 2 -- us2k10--------
    rs2317711,2
    C,--204731240(+) AATTTA/TAAAAA 2 -- us2k1 tfbs36Minor allele frequency- T:0.08NA WA EA 246
    rs2317721,2
    C,F,H,--204731553(+) CTGTTG/ACAACT 2 -- us2k123Minor allele frequency- A:0.02NS EA NA WA CSA 1888
    rs1859716501,2
    --204731613(+) TTTTTG/TTTTTG 2 -- us2k10--------
    rs2317731,2
    C,F,O,H,--204731672(+) CCCATA/GAATGT 2 -- us2k1 tfbs320Minor allele frequency- G:0.01NS EA NA WA CSA 1602
    rs1903649141,2
    --204731779(+) CTGTCA/TCAAAT 2 -- us2k10--------
    rs2317741,2
    C,F,O,A,H,--204732223(+) TGGAGA/TTGTCA 2 -- us2k1 tfbs332Minor allele frequency- T:0.07NA MN NS EA WA CSA 2291
    rs1382797361,2
    C,--204732688(+) TCAGCG/AGCACA 4 /Q /R mis11Minor allele frequency- A:0.00NA 4548
    rs168402751,2
    C,F,--204732740(+) CTCCTG/CTTTTT 4 /L syn1 ese36Minor allele frequency- C:0.01NA WA 4814
    rs2317761,2
    C,F,H,--204732850(+) GTCAAG/AGGCAG 2 -- int131Minor allele frequency- A:0.01EA NA NS WA CSA 2149
    rs1825544381,2
    --204732870(+) GCAAAA/GCCAGA 2 -- int10--------
    rs1872018881,2
    --204732998(+) TAGTAA/GGGGCT 2 -- int10--------
    rs1408429591,2
    --204733064(+) CTATGA/GGACTG 2 -- int10--------
    rs1174924361,2
    F,--204733098(+) TAGCCA/TTAGTC 2 -- int11Minor allele frequency- T:0.02EA 120
    rs1447951061,2
    --204733220(+) GTCCTC/TGGATT 2 -- int10--------
    rs1908387641,2
    --204733334(+) ATTCTA/CCTAGC 2 -- int10--------
    rs1493927301,2
    --204733379(+) TTGCC-/AAAAAA 2 -- int10--------
    rs1823568771,2
    --204733492(+) GTTTTC/TAGCTC 2 -- int10--------
    rs1475141921,2
    --204733532(+) GGCTTA/CAAATG 2 -- int10--------
    rs1856541891,2
    --204733547(+) GTATAA/TCCATT 2 -- int10--------
    rs2317771,2
    C,F,O,A,H,--204733588(+) CTTGGC/TTAAGA 2 -- int125Minor allele frequency- T:0.16NA NS EA WA CSA 2270
    rs1903631271,2
    --204733726(+) CTCTTA/TGAAGT 2 -- int10--------
    rs2317781,2
    C,F,O,H,--204733821(+) GTGATA/GAGTGT 2 -- int120Minor allele frequency- G:0.03NA NS EA WA CSA 938
    rs1830362741,2
    --204734217(+) TCTCTA/TATATA 2 -- int10--------
    rs1158325271,2
    F,--204734315(+) TATTTA/GTTGTA 2 -- int11Minor allele frequency- G:0.08WA 118
    rs2317791,2
    C,F,O,A,H,--204734487(+) GCAAGC/TCTCTC 2 -- int122Minor allele frequency- T:0.48NS EA NA WA 2552
    rs1485750911,2
    --204734664(+) GCCCTC/TGGCTC 2 -- int10--------
    rs1429759261,2
    --204734724(+) GAAGGC/TGGAGG 2 -- int10--------
    rs1888235131,2
    --204734746(+) CATCAA/GGACAC 2 -- int10--------
    rs1511277131,2
    --204734764(+) CCTGGA/GTGACA 2 -- int10--------
    rs1456068601,2
    C,--204734887(+) TCCGG-/AGC   
       TATAT
    AGCTC
    2 -- int10--------
    rs1406903841,2
    --204734946(+) ATCTCA/CTCTAA 2 -- int10--------
    rs1457463901,2
    --204735087(+) GAATC-/TTATTT 2 -- int10--------
    rs1929246321,2
    --204735099(+) CTCAGC/TAAGAA 2 -- int10--------
    rs1838687081,2
    --204735141(+) TTGAGA/GGATGG 2 -- int10--------
    rs1496740621,2
    --204735177(+) GGAAGA/GGGTAA 2 -- int10--------
    rs1402987251,2
    --204735205(+) GGGGGC/GAGAAA 2 -- int10--------
    rs2001803571,2
    --204735302(+) TTTCCA/GTGCTA 2 -- int10--------
    rs1449880771,2
    C--204735525(+) CAGTGG/AAAATC 4 /E /G mis11Minor allele frequency- A:0.00NA 4552
    rs1888620821,2
    C,--204735610(+) CCACCA/GCCATA 4 P syn10--------
    rs412659591,2
    C,--204735680(+) CTGAGC/TTGACA 2 -- int10--------
    rs2021878771,2
    --204735694(+) GTTGCA/GTTGCA 2 -- int10--------
    rs1380298871,2
    --204735954(+) AATAGC/TCAAAC 2 -- int10--------
    rs2013002811,2
    --204736057(+) TAGAGC/TTTAAA 2 -- int10--------
    rs2002716001,2
    --204736077(+) GGGAGG/TCTCTG 2 -- int10--------
    rs1996593161,2
    --204736192(+) ACAGCC/TGTTTC 3 A int1 syn10--------
    rs558067471,2
    C,--204736350(+) AGAACA/GCACTA 2 -- int10--------
    rs1381607781,2
    --204736496(+) TGCTC-/TTTGTCT 2 -- int10--------
    rs1884564521,2
    --204736587(+) GATGGC/TCTTTA 2 -- int10--------
    rs2317801,2
    C,H,--204736697(+) TCCCTA/GTTATC 2 -- int121Minor allele frequency- G:0.02EA NA NS WA CSA 815
    rs115713241,2
    C,H,--204736860(-) CAGAGG/TTGTCT 2 -- int14Minor allele frequency- T:0.00NS EA 414
    rs2317811,2
    C,A,H,--204736887(+) CCATTG/ACAAAC 2 -- int117Minor allele frequency- A:0.04EA NA WA CSA 428
    rs1842945451,2
    --204736940(+) TTCTCA/GCTCTT 2 -- int10--------
    rs1143529371,2
    F,--204736987(+) ACATAC/TACAAA 2 -- int11Minor allele frequency- T:0.02NA 120
    rs1900677551,2
    --204737001(+) ATACTC/TTATTC 2 -- int10--------
    rs1817236161,2
    --204737004(+) CTCTAC/TTCCAA 2 -- int10--------
    rs1153958721,2
    --204737016(+) ATCCTC/GTACCC 2 -- int11Minor allele frequency- G:0.01NA 120
    rs1431798551,2
    --204737142(+) TTGATC/TAATTA 2 -- int10--------
    rs1482813161,2
    --204737213(+) ATTCAA/GGGCAA 2 -- int10--------
    rs748084601,2
    C,--204737478(+) ATGCCC/GCCAAC 4 P A mis1 syn10--------
    rs341624471,2
    C,F,--204737569(+) TTTCAA/GTTTCC 2 -- ut315Minor allele frequency- G:0.01MN 400
    rs561023771,2
    C,F,--204737635(+) CATTTG/AGGGGG 2 -- ut311Minor allele frequency- A:0.03EA 120
    rs1428631331,2
    C,--204738051(+) TATAC-/ATATATATATATATATATAT
    ATATATATATATATATATATAT
    ATATA
    2 -- ut310--------
    rs671814501,2
    C--204738106(+) TATAT-/ATATATATATATATATATAT
    ATATATATATATATATATATAT
    TTTAA
    2 -- ut311Minor allele frequency- ATATATATATATATATATATATATATATATATATATATATAT:0.00NA 2
    rs1807899831,2
    --204738119(+) TGATAA/GTATTG 2 -- ut310--------
    rs1391059901,2
    --204738184(+) TATATA/GGCAGT 2 -- ut310--------
    rs556962171,2
    C,--204738577(+) TGAAGA/GTTTCT 2 -- ut310--------
    rs1902114581,2
    --204738590(+) AAATTA/TACACT 2 -- ut310--------
    rs2317211,2
    C,F,H,--204738725(+) GTGTTT/CAAATT 2 -- ds500130Minor allele frequency- C:0.01NS EA MN NA WA CSA 2382
    rs1825333641,2
    --204738878(+) CCATCC/TTCTTT 2 -- ds50010--------
    rs1393546161,2
    --204738884(+) TCTTTC/GCTTTT 2 -- ds50010--------
    rs30872431,2
    C,F,O,H,--204738919(+) ATAACG/ATGGGT 2 -- ds500130Minor allele frequency- A:0.36NS EA NA MN CSA WA 4045
    rs1132135671,2
    ----196579695(+) TCCATA/GGATTG 2 -- us2k10--------
    rs680811991,2
    ----204738043(+) ATTGC-/ATATATACATATATATATAT
    ATATATATATATATATATATAT
    ATATA
    4 -- ut310--------
    rs719716321,2
    ----204738067(+) TATAT-/ATATATATA
    TATATATATAT
    TTTAA
    2 -- ut310--------
    rs102031981,2
    ----196578537(+) aaattA/Ttaaaa 2 -- us2k1 tfbs30--------
    rs350423241,2
    ----196584153(+) TCTCA-/GGACAC 2 -- int10--------
    rs1465418511,2
    ----204732693(+) GGCACA/GAGGCT 4 K E mis11Minor allele frequency- G:0.00NA 4550
    rs2014842581,2
    ----204738051(+) TATAC-/ATATATATATAT
    ATATATATATATAT
    ATATA
    2 -- ut310--------
    rs1124725271,2
    ----204731237(+) AATTT-/TAAAAA 2 -- us2k11Minor allele frequency- T:0.00CSA 2
    rs357034521,2
    ----196582285(+) GACAT-/GGGGGG 2 -- int10--------
    rs608727631,2
    ----204738053(+) TATAT-/ATATAT
            
    TTTAA
    4 -- ut310--------
    rs2018011371,2
    ----204738051(+) TATAC-/ATATATATATA
    TATATATATATAT
    ATATA
    2 -- ut310--------
    rs1133186711,2
    ----196585774(+) ACAAAC/TATGTG 2 -- ut310--------
    rs1117972161,2
    ----204731005(+) AAAAA-/ACCTCT 2 -- us2k10--------
    rs1125063751,2
    ----196579693(+) CATCCA/GTGGAT 2 -- us2k10--------
    rs664757121,2
    ----204738057(+) TATAT-/ATAT  
      ATATAT
    TTTAA
    4 -- ut310--------
    rs2006572801,2
    ----204736111(+) GAACCG/ATGCCC 3 /P syn1 int11Minor allele frequency- A:0.00EU 1323
    rs1999439431,2
    ----204735415(+) GTGACA/GGTGCT 4 T syn11Minor allele frequency- G:0.00EU 1323
    rs562178111,2
    ----196585752(+) CAGTTC/TGATGG 2 -- ut310--------
    rs2017789351,2
    ----204732687(+) TTCAGC/TGGCAC 4 R W mis10--------
    rs1459506561,2
    ----204732752(+) CTTCTC/TTTCAT 4 L syn11Minor allele frequency- T:0.00NA 4550
    rs751458771,2
    ----196579760(+) CCCACA/GGCTTC 2 -- us2k10--------
    rs1118604071,2
    ----196580243(+) TGGGCA/GGCAGC 2 -- int11Minor allele frequency- G:0.00CSA 1
    rs1462003421,2
    ----204735338(+) TGGTAC/TTGGCC 4 L syn11Minor allele frequency- T:0.00NA 4552
    rs1126400131,2
    ----196583535(+) CACCAC/TGTCTG 2 -- int10--------
    rs668573451,2
    ----204738043(+) ATTGC-/ATAT  
      ATACAT
    ATATA
    2 -- ut310--------
    rs596654211,2
    ----204738092(+) ATATAC/TATATA 2 -- ut311Minor allele frequency- T:0.00NA 2
    rs1117713071,2
    ----204734640(+) CCTAGA/-AGAGG 2 -- int11Minor allele frequency- -:0.00CSA 2
    rs1476793421,2
    ----204735589(+) TGCAAG/AGTGGA 4 /K syn11Minor allele frequency- A:0.00NA 4552
    rs1135289411,2
    ----196581755(+) TTGGCA/GTGCAG 2 -- int10--------
    rs1465718011,2
    ----204736189(+) CTCACA/TGCTGT 3 T syn1 int11Minor allele frequency- T:0.00NA 4550
    rs593877381,2
    ----196586151(+) GATTTC/TTTCAC 2 -- ds50010--------
    rs1391545571,2
    ----204735445(+) GTGACT/CGAAGT 4 /T syn11Minor allele frequency- C:0.00NA 4552
    rs1125932511,2
    ----196581963(+) CCCTCA/GGCTCT 2 -- int10--------
    rs1999129251,2
    ----204736208(+) GCAAAA/GTGGTG 3 M V mis1 int10--------
    rs1135056921,2
    ----196583219(+) ATATGT/ATATGA 2 -- int11Minor allele frequency- A:0.00CSA 1

    HapMap Linkage Disequilibrium report for CTLA4 (204732509 - 204738683 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
          Database of Genomic Variants (DGV) variations for CTLA4: --
    Human Gene Mutation Database (HGMD): CTLA4

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing CTLA4
    DNA2.0 Custom Variant and Variant Library Synthesis for CTLA4

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    CTLA4 for disorders           About GeneDecksing

    OMIM gene information: 123890   
    OMIM disorders: 140300  601388  609755  
    UniProtKB/Swiss-Prot: CTLA4_HUMAN, P16410
  • Genetic variation in CTLA4 influences susceptibility to systemic lupus erythematosus (SLE) [MIM:152700]. SLE
  • is a chronic, inflammatory and often febrile multisystemic disorder of connective tissue. It affects principally the
    skin, joints, kidneys and serosal membranes. SLE is thought to represent a failure of the regulatory mechanisms of the
    autoimmune system
  • Note=Genetic variations in CTLA4 may influence susceptibility to Graves disease, an autoimmune disorder
  • associated with overactivity of the thyroid gland and hyperthyroidism
  • Genetic variation in CTLA4 is the cause of susceptibility to diabetes mellitus insulin-dependent type 12
  • (IDDM12) [MIM:601388]. A multifactorial disorder of glucose homeostasis that is characterized by susceptibility to
    ketoacidosis in the absence of insulin therapy. Clinical fetaures are polydipsia, polyphagia and polyuria which result
    from hyperglycemia-induced osmotic diuresis and secondary thirst. These derangements result in long-term complications
    that affect the eyes, kidneys, nerves, and blood vessels
  • Genetic variation in CTLA4 is the cause of susceptibility to celiac disease type 3 (CELIAC3) [MIM:609755]. It
  • is a multifactorial disorder of the small intestine that is influenced by both environmental and genetic factors. It
    is characterized by malabsorption resulting from inflammatory injury to the mucosa of the small intestine after the
    ingestion of wheat gluten or related rye and barley proteins. In its classic form, celiac disease is characterized in
    children by malabsorption and failure to thrive

    20/196 diseases for CTLA4 (see all 196):    About MalaCards
    celiac disease    systemic lupus erythematosus    diabetes mellitus    lupus erythematosus
    graves' disease    graft versus host disease    thyroiditis    b-cell non-hodgkin lymphoma
    diffuse large b-cell lymphoma    hypersensitivity reaction type ii disease    thrombotic thrombocytopenic purpura    non-hodgkin lymphoma
    chronic inflammatory demyelinating polyneuropathy    wegener's granulomatosis    demyelinating polyneuropathy    microscopic polyangiitis
    sclerosing cholangitis    myasthenia gravis    b-cell lymphomas    common variable immunodeficiency

    9 diseases from the University of Copenhagen DISEASES database for CTLA4:
    Hypersensitivity reaction type II disease     Melanoma     Hyperthyroidism     Thyroiditis
    Diabetes mellitus     Rheumatoid arthritis     Connective tissue disease     Multiple sclerosis
    Asthma

    10/93 Novoseek disease relationships for CTLA4 gene (see all 93)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    autoimmune thyroid disease 84.6 60 9861324 (2), 12202150 (2), 17504905 (2), 19559744 (2) (see all 38)
    autoimmune diseases 84.2 258 18613834 (3), 10215771 (3), 15649153 (3), 9861324 (2) (see all 99)
    graves disease 82.3 122 19524188 (4), 15182328 (4), 10404810 (4), 9231050 (3) (see all 63)
    autoimmunity 80.1 83 19595177 (4), 15790353 (3), 16046318 (2), 19412189 (2) (see all 56)
    hashimotos thyroiditis 75.3 38 9398726 (4), 17020648 (3), 16611252 (2), 12225635 (2) (see all 16)
    genetic susceptibility 70.3 54 11752507 (2), 8989248 (2), 16405845 (2), 10619986 (1) (see all 35)
    metastatic melanoma 68.3 31 16283570 (2), 18528295 (2), 16490844 (2), 16615096 (2) (see all 22)
    cancer regression 64 5 12826605 (2), 16283570 (1), 18528295 (1)
    addisons disease 58.8 22 9398726 (4), 10197076 (3), 15240634 (2), 15621571 (1) (see all 9)
    diabetes mellitus insulin-dependent 55.4 37 10619986 (3), 15961581 (2), 15237707 (2), 19136037 (2) (see all 19)

    Genetic Association Database (GAD): CTLA4
    Human Genome Epidemiology (HuGE) Navigator: CTLA4 (525 documents)

    Export disorders for CTLA4 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for CTLA4 gene, integrated from 9 sources (see all 1455):
    (articles sorted by number of sources associating them with CTLA4)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. CTLA-4 polymorphisms and systemic lupus erythematosus (SLE): a meta- analysis. (PubMed id 15688186)1, 2, 4, 9 Lee Y.H.... Nath S.K. (2005)
    2. Evidence for CTLA4 as a susceptibility gene for systemic lupus erythematosus. (PubMed id 15138458)1, 2, 4, 9 Barreto M.... Vicente A.M. (2004)
    3. Insulin-dependent diabetes mellitus (IDDM) is associated with CTLA4 polymorphisms in multiple ethnic groups. (PubMed id 9259273)1, 2, 4, 9 Marron M.P.... She J.-X. (1997)
    4. A common CTLA4 haplotype associated with coeliac disease. (PubMed id 15657618)1, 2, 4 Hunt K.A.... van Heel D.A. (2005)
    5. Association of the T-cell regulatory gene CTLA4 with susceptibility to autoimmune disease. (PubMed id 12724780)1, 2, 4 Ueda H....Gough S.C. (2003)
    6. Cytotoxic T lymphocyte antigen-4 (CTLA-4) gene polymorphism confers susceptibility to thyroid associated orbitopathy. (PubMed id 10475192)1, 2, 4 Vaidya B.... Pearce S.H.S. (1999)
    7. CTLA-4 gene polymorphism is associated with predisposition to coeliac disease. (PubMed id 10189842)1, 2, 4 Djilali-Saiah I.... Caillat-Zucman S. (1998)
    8. Human Ig superfamily CTLA-4 gene: chromosomal localization and identity of protein sequence between murine and human CTLA-4 cytoplasmic domains. (PubMed id 3220103)1, 2, 3 Dariavach P.... Lefranc M.-P. (1988)
    9. CTLA4 is differentially associated with autoimmune diseases in the Dutch population. (PubMed id 16025348)1, 4, 9 Zhernakova A....Koeleman B.P. (2005)
    10. Polymorphsims of CTLA-4 exon 1 +49, CTLA-4 promoter -318 and Fas promoter -670 in spondyloarthropathies. (PubMed id 11771526)1, 4, 9 Lee Y.H....Song G.G. (2001)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 1493 HGNC: 2505 AceView: CTLA4 Ensembl:ENSG00000163599 euGenes: HUgn1493
    ECgene: CTLA4 Kegg: 1493 H-InvDB: CTLA4

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for CTLA4 Pharmacogenomics, SNPs, Pathways
    Wikipedia http://en.wikipedia.org/wiki/CTLA-4

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for CTLA4 gene:
    Search GeneIP for patents involving CTLA4

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
     Browse for Gene Knock-down Tools from EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     Browse Small Molecules at EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of CTLA4
     Browse Purified and Recombinant Proteins at EMD Millipore
     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Antibodies for CTLA4 (CTLA-4)   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Multiplex/Array Assay Kits/Reagents for CTLA4 (CTLA-4)  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Recombinant/Natural Proteins for CTLA4 (CTLA-4)  
     OriGene Antibodies for CTLA4   OriGene shRNA RFP for CTLA4  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for CTLA4   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for CTLA4  
     OriGene Protein Over-expression Lysate for CTLA4   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for CTLA4   Browse 3'-UTR reporter clones for miRNA target validation  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for CTLA4   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for CTLA4  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for CTLA4   OriGene Custom Protein Services for CTLA4  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat CTLA4
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing CTLA4
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat CTLA4
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat CTLA4
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat CTLA4
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat CTLA4
     GenScript Custom Purified and Recombinant Proteins Services for CTLA4 GenScript cDNA clones with any tag delivered in your preferred vector for CTLA4
     GenScript Custom Assay Services for CTLA4 GenScript Custom Superior Antibodies Services for CTLA4
     GenScript Custom overexpressing Cell Line Services for CTLA4 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in CTLA4 promoter
     Search Chromatin IP Primers for CTLA4
     RT2 qPCR Primer Assay in human, mouse, rat CTLA4
     GNC Network for CTLA4
     SABiosciences PCR Arrays including human, mouse, rat CTLA4
     Search Tocris compounds for CTLA4
     Proteins and Antibodies for CTLA4
     cDNA Clones for CTLA4
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     CTLA4 antibodies
     CTLA4 proteins
     CTLA4 lysates
     Antibodies for CTLA4
     See all of Abcam's Antibodies, Kits and Proteins for CTLA4
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Recombinant Protein for CTLA4




     CTLA4 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for CTLA4
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CTLA4
     SwitchGear 3'UTR luciferase reporter plasmids for CTLA4
     SwitchGear Promoter luciferase reporter plasmids for CTLA4
     ThermoFisher Antibodies for CTLA4
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CTLA4
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      CTLA4 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 100 solr: 1.4