Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



CTCF Gene

protein-coding   GIFtS: 68
GCID: GC16P067596

CCCTC-Binding Factor (Zinc Finger Protein)

  See CTCF-related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
CCCTC-Binding Factor (Zinc Finger Protein)1 2     MRD212 5
11 Zinc Finger Transcriptional Repressor1 2     Transcriptional Repressor CTCF2
11-Zinc Finger Protein2 3     CCCTC-Binding Factor3
CTCFL Paralog2 3     

External Ids:    HGNC: 137231   Entrez Gene: 106642   Ensembl: ENSG000001029747   OMIM: 6041675   UniProtKB: P497113   

Export aliases for CTCF gene to outside databases

Previous GC identifers: GC16P058290 GC16P067974 GC16P067331 GC16P067373 GC16P067374 GC16P066153 GC16P053469


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for CTCF Gene:
This gene is a member of the BORIS + CTCF gene family and encodes a transcriptional regulator protein with 11
highly conserved zinc finger (ZF) domains. This nuclear protein is able to use different combinations of the ZF
domains to bind different DNA target sequences and proteins. Depending upon the context of the site, the protein
can bind a histone acetyltransferase (HAT)-containing complex and function as a transcriptional activator or bind
a histone deacetylase (HDAC)-containing complex and function as a transcriptional repressor. If the protein is
bound to a transcriptional insulator element, it can block communication between enhancers and upstream
promoters, thereby regulating imprinted expression. Mutations in this gene have been associated with invasive
breast cancers, prostate cancers, and Wilms' tumors. Alternatively spliced transcript variants encoding different
isoforms have been found for this gene. (provided by RefSeq, Jul 2010)

GeneCards Summary for CTCF Gene:
CTCF (CCCTC-binding factor (zinc finger protein)) is a protein-coding gene. Diseases associated with CTCF include mental retardation, autosomal dominant 21, and mesoblastic nephroma. GO annotations related to this gene include transcription corepressor activity and sequence-specific DNA binding transcription factor activity. An important paralog of this gene is CTCFL.

UniProtKB/Swiss-Prot: CTCF_HUMAN, P49711
Function: Chromatin binding factor that binds to DNA sequence specific sites. Involved in transcriptional
regulation by binding to chromatin insulators and preventing interaction between promoter and nearby enhancers
and silencers. Acts as transcriptional repressor binding to promoters of vertebrate MYC gene and BAG1 gene. Also
binds to the PLK and PIM1 promoters. Acts as a transcriptional activator of APP. Regulates APOA1/C3/A4/A5 gene
cluster and controls MHC class II gene expression. Plays an essential role in oocyte and preimplantation embryo
development by activating or repressing transcription. Seems to act as tumor suppressor. Plays a critical role in
the epigenetic regulation. Participates in the allele-specific gene expression at the imprinted IGF2/H19 gene
locus. On the maternal allele, binding within the H19 imprinting control region (ICR) mediates maternally
inherited higher-order chromatin conformation to restrict enhancer access to IGF2. Plays a critical role in gene
silencing over considerable distances in the genome. Preferentially interacts with unmethylated DNA, preventing
spreading of CpG methylation and maintaining methylation-free zones. Inversely, binding to target sites is
prevented by CpG methylation. Plays a important role in chromatin remodeling. Can dimerize when it is bound to
different DNA sequences, mediating long-range chromatin looping. Mediates interchromosomal association between
IGF2/H19 and WSB1/NF1 and may direct distant DNA segments to a common transcription factory. Causes local loss of
histone acetylation and gain of histone methylation in the beta-globin locus, without affecting transcription.
When bound to chromatin, it provides an anchor point for nucleosomes positioning. Seems to be essential for
homologous X-chromosome pairing. May participate with Tsix in establishing a regulatable epigenetic switch for X
chromosome inactivation. May play a role in preventing the propagation of stable methylation at the escape genes
from X- inactivation. Involved in sister chromatid cohesion. Associates with both centromeres and chromosomal
arms during metaphase and required for cohesin localization to CTCF sites. Regulates asynchronous replication of
IGF2/H19

Gene Wiki entry for CTCF Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence at NCBI GenBank:
NC_000016.9  NT_010498.16  NC_018927.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the CTCF gene promoter:
         Egr-2   MEF-2A   NF-1   NF-1/L   p53   Nkx2-5   aMEF-2   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): CTCF promoter sequence
   Search Chromatin IP Primers for CTCF

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat CTCF


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 16q21-q22.3   Ensembl cytogenetic band:  16q22.1   HGNC cytogenetic band: 16q21-q22.3

CTCF Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
CTCF gene location

GeneLoc information about chromosome 16         GeneLoc Exon Structure

GeneLoc location for GC16P067596:  view genomic region     (about GC identifiers)

Start:
67,596,310 bp from pter      End:
67,673,088 bp from pter
Size:
76,779 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., eBioscience, and/or antibodies-online,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., eBioscience, and/or antibodies-online, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, Cloud-Clone Corp, antibodies-online, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: CTCF_HUMAN, P49711 (See protein sequence)
Recommended Name: Transcriptional repressor CTCF  
Size: 727 amino acids; 82785 Da
Subunit: Interacts with CHD8
Miscellaneous: More than 13'00 CTCF-binding sites in potential insulators were identified in the human genome
Sequence caution: Sequence=BAD93030.1; Type=Erroneous initiation; Note=Translation N-terminally shortened;
2 PDB 3D structures from and Proteopedia for CTCF:
1X6H (3D)        2CT1 (3D)    
Secondary accessions: B5MC38 Q53XI7 Q59EL8
Alternative splicing: 2 isoforms:  P49711-1   P49711-2   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for CTCF: NX_P49711

Explore proteomics data for CTCF at MOPED

Post-translational modifications: 

  • Sumoylated on Lys-74 and Lys-689; sumoylation of CTCF contributes to the repressive function of CTCF on the MYC P2
    promoter (By similarity)1
  • Modification sites at neXtProt
  • Modification sites at PhosphoSitePlus

  • See CTCF Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (2 alternative transcripts): 
    NP_001177951.1  NP_006556.1  

    ENSEMBL proteins: 
     ENSP00000264010   ENSP00000384707  

    CTCF Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for CTCF
    OriGene Custom MassSpec
    OriGene Custom Protein Services for CTCF
    GenScript Custom Purified and Recombinant Proteins Services for CTCF
    Novus Biologicals CTCF Protein
    Novus Biologicals CTCF Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for CTCF

     
    Search eBioscience for Proteins for CTCF 

     
    antibodies-online proteins for CTCF (9 products) 

     
    antibodies-online peptides for CTCF

    CTCF Antibody Products:

    EMD Millipore Mono- and Polyclonal Antibodies for the study of CTCF
    R&D Systems Antibodies for CTCF
    Cell Signaling Technology (CST) Antibodies for CTCF 
    OriGene Antibodies for CTCF
    OriGene Custom Antibody Services for CTCF
    Novus Biologicals CTCF Antibodies
    Abcam antibodies for CTCF
    Cloud-Clone Corp. Antibodies for CTCF
    ThermoFisher Antibodies for CTCF
    antibodies-online antibodies for CTCF (62 products) 

    CTCF Assay Products:

    EMD Millipore Kits and Assays for the Analysis of CTCF
    OriGene Custom Assay Services for CTCF
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for CTCF
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for CTCF
    Cloud-Clone Corp. CLIAs for CTCF
    Search eBioscience for ELISAs for CTCF 
    antibodies-online kits for CTCF (8 products) 


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    HGNC Gene Families:
    ZNF: Zinc fingers, C2H2-type

    3 InterPro protein domains:
     IPR015880 Znf_C2H2-like
     IPR013087 Znf_C2H2/integrase_DNA-bd
     IPR007087 Znf_C2H2

    Graphical View of Domain Structure for InterPro Entry P49711

    ProtoNet protein and cluster: P49711

    1 Blocks protein domain: IPB007086 C2H2-type zinc finger signature

    UniProtKB/Swiss-Prot: CTCF_HUMAN, P49711
    Domain: The 11 zinc fingers are highly conserved among vertebrates, exhibiting almost identical amino acid
    sequences. Different subsets or combination of individual zinc fingers gives the ability to CTCF to recognize
    multiple DNA target sites
    Similarity: Belongs to the CTCF zinc-finger protein family
    Similarity: Contains 11 C2H2-type zinc fingers


    Find genes that share domains with CTCF           About GenesLikeMe


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: CTCF_HUMAN, P49711
    Function: Chromatin binding factor that binds to DNA sequence specific sites. Involved in transcriptional
    regulation by binding to chromatin insulators and preventing interaction between promoter and nearby enhancers
    and silencers. Acts as transcriptional repressor binding to promoters of vertebrate MYC gene and BAG1 gene. Also
    binds to the PLK and PIM1 promoters. Acts as a transcriptional activator of APP. Regulates APOA1/C3/A4/A5 gene
    cluster and controls MHC class II gene expression. Plays an essential role in oocyte and preimplantation embryo
    development by activating or repressing transcription. Seems to act as tumor suppressor. Plays a critical role in
    the epigenetic regulation. Participates in the allele-specific gene expression at the imprinted IGF2/H19 gene
    locus. On the maternal allele, binding within the H19 imprinting control region (ICR) mediates maternally
    inherited higher-order chromatin conformation to restrict enhancer access to IGF2. Plays a critical role in gene
    silencing over considerable distances in the genome. Preferentially interacts with unmethylated DNA, preventing
    spreading of CpG methylation and maintaining methylation-free zones. Inversely, binding to target sites is
    prevented by CpG methylation. Plays a important role in chromatin remodeling. Can dimerize when it is bound to
    different DNA sequences, mediating long-range chromatin looping. Mediates interchromosomal association between
    IGF2/H19 and WSB1/NF1 and may direct distant DNA segments to a common transcription factory. Causes local loss of
    histone acetylation and gain of histone methylation in the beta-globin locus, without affecting transcription.
    When bound to chromatin, it provides an anchor point for nucleosomes positioning. Seems to be essential for
    homologous X-chromosome pairing. May participate with Tsix in establishing a regulatable epigenetic switch for X
    chromosome inactivation. May play a role in preventing the propagation of stable methylation at the escape genes
    from X- inactivation. Involved in sister chromatid cohesion. Associates with both centromeres and chromosomal
    arms during metaphase and required for cohesin localization to CTCF sites. Regulates asynchronous replication of
    IGF2/H19

         Genatlas biochemistry entry for CTCF:
    Myc regulatory factor,expressed in cells of multiple lineages,in the chromosomal region deleted in sporadic breast
    and prostate carcinomas (see TSG16A)

         Gene Ontology (GO): Selected molecular function terms (see all 9):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003677DNA binding ----
    GO:0003700sequence-specific DNA binding transcription factor activity IDA8649389
    GO:0003714transcription corepressor activity TAS8649389
    GO:0005515protein binding IPI19505873
    GO:0008270zinc ion binding TAS8649389
         
    Find genes that share ontologies with CTCF           About GenesLikeMe


    Phenotypes:
         1 GenomeRNAi human phenotype for CTCF:
     Synthetic lethal with c-Myc af 

         4 MGI mutant phenotypes (inferred from 3 alleles(MGI details for Ctcf):
     cellular  hematopoietic system  immune system  mortality/aging 

    Find genes that share phenotypes with CTCF           About GenesLikeMe

    Animal Models:
       genOway: Develop your customized and physiologically relevant rodent model for CTCF

    Transcription Factor Targeting: 
    Targeting motifs: HOMER Transcription Factor Regulatory Elements motif viewer 
                                          Consensus sequence:  ATAGTGCCACCTGGTGGCCA 

    miRNA
    Products:
        
    miRTarBase miRNAs that target CTCF:
    hsa-mir-215-5p (MIRT024342), hsa-mir-24-3p (MIRT030430), hsa-let-7b-5p (MIRT052311), hsa-mir-615-3p (MIRT040249), hsa-mir-192-5p (MIRT026312), hsa-mir-1229-3p (MIRT036336)

    Block miRNA regulation of human, mouse, rat CTCF using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate CTCF (see all 33):
    hsa-miR-140-5p hsa-miR-100* hsa-let-7a-2* hsa-miR-624 hsa-miR-192 hsa-miR-105 hsa-miR-23a hsa-miR-3148
    SwitchGear 3'UTR luciferase reporter plasmidCTCF 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for CTCF
    Predesigned siRNA for gene silencing in human, mouse, rat CTCF

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for CTCF

    Clone
    Products:
         
    OriGene clones in human, mouse for CTCF (see all 11)
    OriGene ORF clones in mouse, rat for CTCF
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): CTCF (NM_006565)
    Sino Biological Human cDNA Clone for CTCF
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for CTCF
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CTCF

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for CTCF
    Browse ESI BIO Cell Lines and PureStem Progenitors for CTCF 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CTCF

    Flow Cytometry
    Products:
       

     
    eBioscience FlowRNA Probe Sets ( VA1-12430 VA6-12938) for CTCF 


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    CTCF_HUMAN, P49711: Nucleus, nucleoplasm. Chromosome. Chromosome, centromere. Note=May translocate to the
    nucleolus upon cell differentiation. Associates with both centromeres and chromosomal arms during metaphase.
    Associates with the H19 ICR in mitotic chromosomes. May be preferentially excluded from heterochromatin during
    interphase
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    nucleus5
    cytosol2

    Gene Ontology (GO): 5 cellular component terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000775chromosome, centromeric region IDA18550811
    GO:0000793condensed chromosome IDA16107875
    GO:0005634nucleus IDA--
    GO:0005654nucleoplasm IDA16107875
    GO:0005730NOT nucleolus IDA--

    Find genes that share ontologies with CTCF           About GenesLikeMe


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for CTCF About    
    See pathways by source

    SuperPathContained pathways About
    1TGF-beta Receptor Signaling Pathway
    TGF-beta Receptor Signaling Pathway
    2SIDS Susceptibility Pathways
    SIDS Susceptibility Pathways
    3Meiosis (EMD)
    Meiosis
    4Chromatin Regulation / Acetylation
    Chromatin Regulation / Acetylation


    Find genes that share SuperPaths with CTCF           About GenesLikeMe

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways


    1 Cell Signaling Technology (CST) Pathway for CTCF
        Chromatin Regulation / Acetylation

    2 BioSystems Pathways for CTCF
        SIDS Susceptibility Pathways
    TGF-beta Receptor Signaling Pathway



        Pathway & Disease-focused RT2 Profiler PCR Arrays including CTCF: 
              Polycomb & Trithorax Complexes in human mouse rat
              Epigenetic Chromatin Remodeling Factors in human mouse rat

    Interactions:

        GeneGlobe Interaction Network for CTCF

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    Selected Interacting proteins for CTCF (P497112, 3 ENSP000002640104) via UniProtKB, MINT, STRING, and/or I2D (see all 51)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    SMC1AQ146832, 3, ENSP000003234214MINT-6492397 I2D: score=2 STRING: ENSP00000323421
    RAD21O602162, 3, ENSP000002973384MINT-6492407 I2D: score=2 STRING: ENSP00000297338
    CHD8Q9HCK83, ENSP000004062884I2D: score=3 STRING: ENSP00000406288
    POLR2AP249283, ENSP000003149494I2D: score=2 STRING: ENSP00000314949
    SMAD3P840223, ENSP000003329734I2D: score=2 STRING: ENSP00000332973
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 17):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006306DNA methylation ----
    GO:0006349regulation of gene expression by genetic imprinting IEA--
    GO:0006351transcription, DNA-templated IEA--
    GO:0006355regulation of transcription, DNA-templated ----
    GO:0007059chromosome segregation IEA--

    Find genes that share ontologies with CTCF           About GenesLikeMe



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for CTCF

    4 Novoseek inferred chemical compound relationships for CTCF gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    5-aza-2'deoxycytidine 60.6 8 16140943 (1), 20051228 (1)
    zinc 53.7 24 10954607 (2), 11706010 (2), 10839547 (1), 18632606 (1) (see all 21)
    steroid 0 2 10480923 (1)
    serine 0 1 15986064 (1)



    Find genes that share compounds with CTCF           About GenesLikeMe



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for CTCF gene (2 alternative transcripts): 
    NM_001191022.1  NM_006565.3  

    Unigene Cluster for CTCF:

    CCCTC-binding factor (zinc finger protein)
    Hs.368367  [show with all ESTs]
    Unigene Representative Sequence: NM_006565
    3 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000264010(uc002etl.3) ENST00000401394(uc002etm.1 uc010cek.3)
    ENST00000566078
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat CTCF using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate CTCF (see all 33):
    hsa-miR-140-5p hsa-miR-100* hsa-let-7a-2* hsa-miR-624 hsa-miR-192 hsa-miR-105 hsa-miR-23a hsa-miR-3148
    SwitchGear 3'UTR luciferase reporter plasmidCTCF 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for CTCF
    Predesigned siRNA for gene silencing in human, mouse, rat CTCF
    Clone
    Products:
         
    OriGene clones in human, mouse for CTCF (see all 11)
    OriGene ORF clones in mouse, rat for CTCF
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): CTCF (NM_006565)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for CTCF
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CTCF
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for CTCF
    OriGene qSTAR qPCR primer pairs in human, mouse for CTCF
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat CTCF
      QuantiTect SYBR Green Assays in human, mouse, rat CTCF
      QuantiFast Probe-based Assays in human, mouse, rat CTCF
    Flow Cytometry
    Products:
       

     
    eBioscience FlowRNA Probe Sets ( VA1-12430 VA6-12938) for CTCF 

    Additional mRNA sequence: 

    AB209793.1 AK093395.1 AK314804.1 BC014267.2 BT009915.1 U25435.1 

    11 DOTS entries:

    DT.417853  DT.100754165  DT.97822115  DT.95090087  DT.92431171  DT.120708965  DT.120708982  DT.91941097 
    DT.95088550  DT.91897972  DT.95155350 

    Selected AceView cDNA sequences (see all 215):

    CA438106 BM909975 F03030 BM471463 AU125348 BT009915 CK904287 CA865658 
    BX479165 CD722994 BU184110 AU120655 U25435 W84457 CB241893 AI753629 
    N89961 AA348177 BQ226171 AA814313 N58408 AU132930 CA434958 CA396422 

    GeneLoc Exon Structure

    5 Alternative Splicing Database (ASD) splice patterns (SP) for CTCF    About this scheme

    ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9a · 9b ^ 10 ^ 11 ^ 12 ^ 13 ^ 14a · 14b · 14c
    SP1:                    -     -     -                                               -                           
    SP2:                                                                                -                           
    SP3:                                                                                -                           
    SP4:                                                                                                            
    SP5:                                                                                                            


    ECgene alternative splicing isoforms for CTCF

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    CTCF expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: AGACCTGTAA
    CTCF Expression
    About this image


    CTCF expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 6) fully expand
     
     Brain (Nervous System)    fully expand to see all 4 entries
             Cerebral Cortex
     
     Ovary (Reproductive System)    fully expand to see all 2 entries
             Ovarian Mesenchymal Stroma Cells Ovary Interstitium
             Oviduct
     
     Trophoblast (Extraembryonic Tissues)
             Trophoblast Cells Trophoblast
     
     Testis (Reproductive System)
             Leydig Cells Testis Interstitium
     
     Bone (Muscoskeletal System)
             Bone Marrow
    CTCF Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    CTCF Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.368367

    UniProtKB/Swiss-Prot: CTCF_HUMAN, P49711
    Tissue specificity: Ubiquitous. Absent in primary spermatocytes

        Pathway & Disease-focused RT2 Profiler PCR Arrays including CTCF: 
              Polycomb & Trithorax Complexes in human mouse rat
              Epigenetic Chromatin Remodeling Factors in human mouse rat

    Primer
    Products:
    OriGene qPCR primer pairs and template standards for CTCF
    OriGene qSTAR qPCR primer pairs in human, mouse for CTCF
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat CTCF
    QuantiTect SYBR Green Assays in human, mouse, rat CTCF
    QuantiFast Probe-based Assays in human, mouse, rat CTCF
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CTCF

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of animals.

    Orthologs for CTCF gene from Selected species (see all 13)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Ctcf1 , 5 CCCTC-binding factor1, 5 90.97(n)1
    97.11(a)1
      8 (53.04 cM)5
    130181  NM_181322.31  NP_851839.11 
     1056365685 
    chicken
    (Gallus gallus)
    Aves CTCF1 CCCTC-binding factor (zinc finger protein) 83.65(n)
    93.25(a)
      396274  NM_205332.4  NP_990663.1 
    lizard
    (Anolis carolinensis)
    Reptilia CTCF6
    CCCTC-binding factor (zinc finger protein)
    92(a)
    1 ↔ 1
    GL343295.1(964156-978165)
    African clawed frog
    (Xenopus laevis)
    Amphibia MGC684192 hypothetical protein MGC68419 79.35(n)    BC057697.1 
    zebrafish
    (Danio rerio)
    Actinopterygii ctcf1 CCCTC-binding factor (zinc finger protein) 71.78(n)
    78.8(a)
      415104  NM_001001844.1  NP_001001844.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta CTCF3 transcription factor 34(a)   65F6   --


    ENSEMBL Gene Tree for CTCF (if available)
    TreeFam Gene Tree for CTCF (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for CTCF gene
    CTCFL2  HINFP2  ZFP642  
    3 SIMAP similar genes for CTCF using alignment to 1 protein entry:     CTCF_HUMAN:
    CTCFL    ZNF323    ZNF32

    Find genes that share paralogs with CTCF           About GenesLikeMe



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for CTCF (see all 1387)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 16 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0131424
    A breast tumor4--see VAR_0131422 K E mis40--------
    VAR_0707764
    Mental retardation, autosomal dominant 21 (MRD21)4--see VAR_0707762 R W mis40--------
    VAR_0131414
    A Wilms' tumor4--see VAR_0131412 R W mis40--------
    VAR_0131444
    A Wilms' tumor4--see VAR_0131442 R Q mis40--------
    VAR_0131434
    A prostate tumor4--see VAR_0131432 H R mis40--------
    rs1478089521,2
    C--67594320(+) CCAAGA/GTCAAC 2 -- us2k10--------
    rs1412276011,2
    --67594341(+) TCCTTA/GTATCT 2 -- us2k10--------
    rs1920114941,2
    --67594481(+) ATTTAC/TTATTA 2 -- us2k10--------
    rs1450631571,2
    --67594511(+) GCTTTA/GTTGCC 2 -- us2k10--------
    rs1848218861,2
    --67594621(+) AGGCGC/TGCGAT 2 -- us2k10--------

    HapMap Linkage Disequilibrium report for CTCF (67596310 - 67673088 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 8 variations for CTCF:    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2668512CNV Deletion23128226
    esv2714650CNV Deletion23290073
    dgv2890n71CNV Loss21882294
    nsv833266CNV Loss17160897
    esv26764CNV Loss19812545
    nsv524363CNV Loss19592680
    nsv827711CNV Gain20364138
    nsv522852CNV Gain19592680

    Human Gene Mutation Database (HGMD): CTCF
    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing CTCF
    DNA2.0 Custom Variant and Variant Library Synthesis for CTCF

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 604167   
    OMIM disorders: 615502  
    4 diseases for CTCF:    
    About MalaCards
    mental retardation, autosomal dominant 21    mesoblastic nephroma    congenital mesoblastic nephroma    north american indian childhood cirrhosis

    3 diseases from the University of Copenhagen DISEASES database for CTCF:
    Beckwith-Wiedemann syndrome     Cornelia de Lange syndrome     Silver-Russell syndrome

    Find genes that share disorders with CTCF           About GenesLikeMe

    Selected Novoseek inferred disease relationships for CTCF gene (see all 18)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    beckwith-wiedemann syndrome 67.3 2 17158821 (1), 15743916 (1)
    wilms tumor 42.1 5 15743916 (2), 11431321 (1), 12203779 (1), 11782357 (1)
    carcinoma lobular 31.5 2 18213475 (1), 15609312 (1)
    breast cancer 25.4 23 15958555 (6), 15084242 (3), 15354217 (2), 14503807 (2) (see all 11)
    growth retardation 24.9 2 15941718 (1), 11507042 (1)
    cancer 20.1 15 12191639 (2), 18095639 (1), 20101205 (1), 18625744 (1) (see all 11)
    tumors 15.5 44 9591631 (3), 10545425 (2), 15958555 (2), 19450526 (2) (see all 22)
    hnscc 15.3 2 16391843 (2)
    myeloid leukemia 8.49 3 15941718 (2), 10037138 (1)
    breast carcinoma 3.66 1 15354217 (1)

    Genetic Association Database (GAD): CTCF
    Human Genome Epidemiology (HuGE) Navigator: CTCF (8 documents)

    Export disorders for CTCF gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for CTCF gene, integrated from 10 sources (see all 276):
    (articles sorted by number of sources associating them with CTCF)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. An exceptionally conserved transcriptional repressor, CTCF, employs different combinations of zinc fingers to bind diverged promoter sequences of avian and mammalian c-myc oncogenes. (PubMed id 8649389)1, 2, 3, 9 Filippova G.N.... Lobanenkov V.V. (Mol. Cell. Biol. 1996)
    2. CTCF physically links cohesin to chromatin. (PubMed id 18550811)1, 2, 3, 9 Rubio E.D.... Krumm A. (Proc. Natl. Acad. Sci. U.S.A. 2008)
    3. A widely expressed transcription factor with multiple DNA sequence specificity, CTCF, is localized at chromosome segment 16q22.1 within one of the smallest regions of overlap for common deletions in breast and prostate cancers. (PubMed id 9591631)1, 2, 9 Filippova G.N.... Lobanenkov V.V. (Genes Chromosomes Cancer 1998)
    4. CTCF binding at the H19 imprinting control region mediates maternally inherited higher-order chromatin conformation to restrict enhancer access to Igf2. (PubMed id 16815976)1, 2, 9 Kurukuti S.... Ohlsson R. (Proc. Natl. Acad. Sci. U.S.A. 2006)
    5. Critical DNA binding interactions of the insulator protein CTCF: a small number of zinc fingers mediate strong binding, and a single finger-DNA interaction controls binding at imprinted loci. (PubMed id 17827499)1, 2, 9 Renda M.... Pedone P.V. (J. Biol. Chem. 2007)
    6. Tumor-associated zinc finger mutations in the CTCF transcription factor selectively alter its DNA-binding specificity. (PubMed id 11782357)1, 2, 9 Filippova G.N.... Lobanenkov V.V. (Cancer Res. 2002)
    7. The novel BORIS + CTCF gene family is uniquely involved in the epigenetics of normal biology and cancer. (PubMed id 12191639)1, 2, 9 Klenova E.M.... Lobanenkov V.V. (Semin. Cancer Biol. 2002)
    8. A screen for germline mutations in the gene encoding CCCTC-binding factor (CTCF) in familial non-BRCA1/BRCA2 breast cancer. (PubMed id 15084242)1, 4, 9 Zhou X.L....Lindblom A. (Breast Cancer Res. 2004)
    9. CTCF, a candidate trans-acting factor for X-inactivation choice. (PubMed id 11743158)1, 2, 9 Chao W.... Lee J.T. (Science 2002)
    10. Architectural roles of multiple chromatin insulators at the human apolipoprotein gene cluster. (PubMed id 19322193)1, 2, 9 Mishiro T.... Nakao M. (EMBO J. 2009)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 10664 HGNC: 13723 AceView: CTCF Ensembl:ENSG00000102974 euGenes: HUgn10664
    ECgene: CTCF H-InvDB: CTCF

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for CTCF Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for CTCF Genetics and Cytogenetics in Oncology and Haematology

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for CTCF gene:
    Search GeneIP for patents involving CTCF

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, eBioscience, antibodies-online, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from genOway)
    About This Section

    TryGeneCards Plus

     EMD Millipore Kits and Assays for the Analysis of CTCF
     Browse Purified and Recombinant Proteins at EMD Millipore
     Browse Small Molecules at EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of CTCF
     
     EMD Millipore genomic analysis products

      
     Antibodies for CTCF (CTCF)   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for CTCF   OriGene RNAi products in human, mouse, rat for CTCF  
     OriGene qPCR primer pairs and template standards for CTCF   OriGene Protein Over-expression Lysate for CTCF  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for CTCF  
     OriGene qSTAR qPCR primer pairs in human, mouse for CTCF   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for CTCF   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for CTCF   OriGene Custom Protein Services for CTCF  

     
     
     Block miRNA regulation of human, mouse, rat CTCF using miScript Target Protectors SeqTarget long-range PCR primers for resequencing CTCF
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat CTCF Predesigned siRNA for gene silencing in human, mouse, rat CTCF
     QuantiFast Probe-based Assays in human, mouse, rat CTCF QuantiTect SYBR Green Assays in human, mouse, rat CTCF
     PCR Arrays including human, mouse, rat CTCF Search Chromatin IP Primers for CTCF
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat CTCF  GeneGlobe Interaction Network for CTCF
     Regulatory tfbs in CTCF promoter
     GenScript Custom Purified and Recombinant Proteins Services for CTCF GenScript cDNA clones with any tag delivered in your preferred vector for CTCF
     GenScript Custom Assay Services for CTCF GenScript Custom overexpressing Cell Line Services for CTCF
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Antibodies & Assays for CTCF 

     Search Tocris compounds for CTCF
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     cDNA Clones for CTCF
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     CTCF antibodies
     CTCF proteins
     CTCF lysates
     Antibodies for CTCF
     See all of Abcam's Antibodies, Kits and Proteins for CTCF
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for CTCF
     Antibodies for CTCF
     ELISAs for CTCF
     CLIAs for CTCF



     Browse ESI BIO Cell Lines and PureStem Progenitors for CTCF
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CTCF
     SwitchGear 3'UTR luciferase reporter plasmids for CTCF
     SwitchGear Promoter luciferase reporter plasmids for CTCF
     ThermoFisher Antibodies for CTCF
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CTCF
     Browse compounds at ApexBio
     Search Addgene for plasmids for CTCF
      Search eBioscience for proteins for CTCF
      Search eBioscience for elisas for CTCF
      eBioscience FlowRNA Probe Sets
     genOway: Develop your customized and physiologically relevant rodent model for CTCF
     antibodies-online antibodies for CTCF (62 products)
     antibodies-online kits for CTCF (8 products)
     antibodies-online peptides for CTCF
     antibodies-online proteins for CTCF (9 products)
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014 , 7 Oct 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      CTCF gene at Home site.
    Version: 3.12.252 27 Nov 2014
    hostname: 356980-web2.xennexinc.com index build: 128 solr: 1.4