Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CTCF Gene

Aliases for CTCF Gene

  • CCCTC-Binding Factor 2 3 4 5
  • CCCTC-Binding Factor (Zinc Finger Protein) 2 3
  • 11 Zinc Finger Transcriptional Repressor 2 3
  • 11-Zinc Finger Protein 3 4
  • CTCFL Paralog 3 4
  • Transcriptional Repressor CTCF 3
  • MRD21 3

External Ids for CTCF Gene

Previous GeneCards Identifiers for CTCF Gene

  • GC16P058290
  • GC16P067974
  • GC16P067331
  • GC16P067373
  • GC16P067374
  • GC16P066153
  • GC16P067596
  • GC16P053469

Summaries for CTCF Gene

Entrez Gene Summary for CTCF Gene

  • This gene is a member of the BORIS + CTCF gene family and encodes a transcriptional regulator protein with 11 highly conserved zinc finger (ZF) domains. This nuclear protein is able to use different combinations of the ZF domains to bind different DNA target sequences and proteins. Depending upon the context of the site, the protein can bind a histone acetyltransferase (HAT)-containing complex and function as a transcriptional activator or bind a histone deacetylase (HDAC)-containing complex and function as a transcriptional repressor. If the protein is bound to a transcriptional insulator element, it can block communication between enhancers and upstream promoters, thereby regulating imprinted expression. Mutations in this gene have been associated with invasive breast cancers, prostate cancers, and Wilms' tumors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]

GeneCards Summary for CTCF Gene

CTCF (CCCTC-Binding Factor) is a Protein Coding gene. Diseases associated with CTCF include Mental Retardation, Autosomal Dominant 21 and Spherocytosis, Type 4. Among its related pathways are Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3 and Chromatin Regulation / Acetylation. GO annotations related to this gene include transcription factor activity, sequence-specific DNA binding and chromatin binding. An important paralog of this gene is CTCFL.

UniProtKB/Swiss-Prot for CTCF Gene

  • Chromatin binding factor that binds to DNA sequence specific sites. Involved in transcriptional regulation by binding to chromatin insulators and preventing interaction between promoter and nearby enhancers and silencers. Acts as transcriptional repressor binding to promoters of vertebrate MYC gene and BAG1 gene. Also binds to the PLK and PIM1 promoters. Acts as a transcriptional activator of APP. Regulates APOA1/C3/A4/A5 gene cluster and controls MHC class II gene expression. Plays an essential role in oocyte and preimplantation embryo development by activating or repressing transcription. Seems to act as tumor suppressor. Plays a critical role in the epigenetic regulation. Participates in the allele-specific gene expression at the imprinted IGF2/H19 gene locus. On the maternal allele, binding within the H19 imprinting control region (ICR) mediates maternally inherited higher-order chromatin conformation to restrict enhancer access to IGF2. Plays a critical role in gene silencing over considerable distances in the genome. Preferentially interacts with unmethylated DNA, preventing spreading of CpG methylation and maintaining methylation-free zones. Inversely, binding to target sites is prevented by CpG methylation. Plays a important role in chromatin remodeling. Can dimerize when it is bound to different DNA sequences, mediating long-range chromatin looping. Mediates interchromosomal association between IGF2/H19 and WSB1/NF1 and may direct distant DNA segments to a common transcription factory. Causes local loss of histone acetylation and gain of histone methylation in the beta-globin locus, without affecting transcription. When bound to chromatin, it provides an anchor point for nucleosomes positioning. Seems to be essential for homologous X-chromosome pairing. May participate with Tsix in establishing a regulatable epigenetic switch for X chromosome inactivation. May play a role in preventing the propagation of stable methylation at the escape genes from X- inactivation. Involved in sister chromatid cohesion. Associates with both centromeres and chromosomal arms during metaphase and required for cohesin localization to CTCF sites. Regulates asynchronous replication of IGF2/H19. Plays a role in the recruitment of CENPE to the pericentromeric/centromeric regions of the chromosome during mitosis (PubMed:26321640).

Gene Wiki entry for CTCF Gene

Additional gene information for CTCF Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CTCF Gene

Genomics for CTCF Gene

Regulatory Elements for CTCF Gene

Enhancers for CTCF Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH16H067555 1.5 Ensembl ENCODE dbSUPER 73.7 -6.1 -6099 1 ZNF493 ZFP64 ZNF121 FOS KLF7 ZNF202 ZC3H11A REST ZNF623 ZNF518A ZDHHC1 EDC4 CENPT ENSG00000260465 CTCF ENKD1 NAE1 E2F4 ENSG00000263276 ACD
GH16H067987 1.1 Ensembl ENCODE 44.1 +425.2 425236 0 ELF3 ZNF493 ZFP64 ARID4B RAD21 KLF7 ZNF680 ZC3H11A REST ZNF518A ZDHHC1 EDC4 CENPT ENKD1 CTCF E2F4 FBXL8 ACD ENSG00000263276 KIAA0895L
GH16H068233 1.8 FANTOM5 ENCODE dbSUPER 25.1 +673.5 673469 5 HDGF PKNOX1 FOXA2 MLX ZFP64 ARID4B SIN3A FEZF1 DMAP1 ZNF2 CTCF ENSG00000270165 DUS2 SNTB2 PRMT7 RANBP10 CHTF8 ENSG00000263276 EDC4 ENSG00000262514
GH16H068077 2 FANTOM5 Ensembl ENCODE dbSUPER 20.8 +523.3 523275 15 MLX ZFP64 FEZF1 DMAP1 YY1 SLC30A9 ZNF143 SP3 NFYC MEF2D PRMT7 CTCF EDC4 TRADD ZDHHC1 DPEP2 DUS2 E2F4 SLC7A6OS ENSG00000212445
GH16H067479 1.7 FANTOM5 ENCODE dbSUPER 21.6 -80.4 -80355 4 HDGF PKNOX1 MLX ARNT ZFP64 ARID4B SIN3A FEZF1 DMAP1 YY1 ZDHHC1 ENKD1 NAE1 ATP6V0D1 EDC4 CENPT CTCF SLC7A6OS E2F4 ENSG00000260465
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around CTCF on UCSC Golden Path with GeneCards custom track

Promoters for CTCF Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000087155 693 3001 HDGF FOXA2 ARNT ARID4B SIN3A DMAP1 ZNF2 YY1 SLC30A9 CBX5

Genomic Location for CTCF Gene

Chromosome:
16
Start:
67,562,407 bp from pter
End:
67,639,185 bp from pter
Size:
76,779 bases
Orientation:
Plus strand

Genomic View for CTCF Gene

Genes around CTCF on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CTCF Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CTCF Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CTCF Gene

Proteins for CTCF Gene

  • Protein details for CTCF Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P49711-CTCF_HUMAN
    Recommended name:
    Transcriptional repressor CTCF
    Protein Accession:
    P49711
    Secondary Accessions:
    • B5MC38
    • Q53XI7
    • Q59EL8

    Protein attributes for CTCF Gene

    Size:
    727 amino acids
    Molecular mass:
    82785 Da
    Quaternary structure:
    • Interacts with CHD8 (PubMed:16949368). Interacts with LLPH (By similarity). Interacts with CENPE (PubMed:26321640).
    Miscellaneous:
    • More than 1300 CTCF-binding sites in potential insulators were identified in the human genome.
    SequenceCaution:
    • Sequence=BAD93030.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for CTCF Gene

    Alternative splice isoforms for CTCF Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for CTCF Gene

Post-translational modifications for CTCF Gene

  • Sumoylated on Lys-74 and Lys-689; sumoylation of CTCF contributes to the repressive function of CTCF on the MYC P2 promoter.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for CTCF Gene

Antibody Products

  • Cell Signaling Technology (CST) Antibodies for CTCF (CTCF)
  • Abcam antibodies for CTCF

No data available for DME Specific Peptides for CTCF Gene

Domains & Families for CTCF Gene

Gene Families for CTCF Gene

HGNC:
Human Protein Atlas (HPA):
  • Cancer-related genes
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for CTCF Gene

Suggested Antigen Peptide Sequences for CTCF Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P49711

UniProtKB/Swiss-Prot:

CTCF_HUMAN :
  • The 11 zinc fingers are highly conserved among vertebrates, exhibiting almost identical amino acid sequences. Different subsets or combination of individual zinc fingers gives the ability to CTCF to recognize multiple DNA target sites.
  • Belongs to the CTCF zinc-finger protein family.
Domain:
  • The 11 zinc fingers are highly conserved among vertebrates, exhibiting almost identical amino acid sequences. Different subsets or combination of individual zinc fingers gives the ability to CTCF to recognize multiple DNA target sites.
Family:
  • Belongs to the CTCF zinc-finger protein family.
genes like me logo Genes that share domains with CTCF: view

Function for CTCF Gene

Molecular function for CTCF Gene

GENATLAS Biochemistry:
Myc regulatory factor,expressed in cells of multiple lineages,in the chromosomal region deleted in sporadic breast and prostate carcinomas (see TSG16A)
UniProtKB/Swiss-Prot Function:
Chromatin binding factor that binds to DNA sequence specific sites. Involved in transcriptional regulation by binding to chromatin insulators and preventing interaction between promoter and nearby enhancers and silencers. Acts as transcriptional repressor binding to promoters of vertebrate MYC gene and BAG1 gene. Also binds to the PLK and PIM1 promoters. Acts as a transcriptional activator of APP. Regulates APOA1/C3/A4/A5 gene cluster and controls MHC class II gene expression. Plays an essential role in oocyte and preimplantation embryo development by activating or repressing transcription. Seems to act as tumor suppressor. Plays a critical role in the epigenetic regulation. Participates in the allele-specific gene expression at the imprinted IGF2/H19 gene locus. On the maternal allele, binding within the H19 imprinting control region (ICR) mediates maternally inherited higher-order chromatin conformation to restrict enhancer access to IGF2. Plays a critical role in gene silencing over considerable distances in the genome. Preferentially interacts with unmethylated DNA, preventing spreading of CpG methylation and maintaining methylation-free zones. Inversely, binding to target sites is prevented by CpG methylation. Plays a important role in chromatin remodeling. Can dimerize when it is bound to different DNA sequences, mediating long-range chromatin looping. Mediates interchromosomal association between IGF2/H19 and WSB1/NF1 and may direct distant DNA segments to a common transcription factory. Causes local loss of histone acetylation and gain of histone methylation in the beta-globin locus, without affecting transcription. When bound to chromatin, it provides an anchor point for nucleosomes positioning. Seems to be essential for homologous X-chromosome pairing. May participate with Tsix in establishing a regulatable epigenetic switch for X chromosome inactivation. May play a role in preventing the propagation of stable methylation at the escape genes from X- inactivation. Involved in sister chromatid cohesion. Associates with both centromeres and chromosomal arms during metaphase and required for cohesin localization to CTCF sites. Regulates asynchronous replication of IGF2/H19. Plays a role in the recruitment of CENPE to the pericentromeric/centromeric regions of the chromosome during mitosis (PubMed:26321640).

Phenotypes From GWAS Catalog for CTCF Gene

Gene Ontology (GO) - Molecular Function for CTCF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000978 RNA polymerase II core promoter proximal region sequence-specific DNA binding IDA 8649389
GO:0001078 transcriptional repressor activity, RNA polymerase II core promoter proximal region sequence-specific binding IDA 8649389
GO:0001228 transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific binding IEA --
GO:0003676 nucleic acid binding IEA --
GO:0003677 DNA binding IEA --
genes like me logo Genes that share ontologies with CTCF: view
genes like me logo Genes that share phenotypes with CTCF: view

Human Phenotype Ontology for CTCF Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for CTCF Gene

MGI Knock Outs for CTCF:

Animal Model Products

CRISPR Products

Targeted motifs for CTCF Gene
HOMER Transcription Factor Regulatory Elements motif CTCF
  • Consensus sequence: ATAGTGCCACCTGGTGGCCA Submotif: canonical Cell Type: CD4+

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for CTCF
  • Applied Biological Materials Clones for CTCF
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

No data available for Enzyme Numbers (IUBMB) and Transcription Factor Targets for CTCF Gene

Localization for CTCF Gene

Subcellular locations from UniProtKB/Swiss-Prot for CTCF Gene

Nucleus, nucleoplasm. Chromosome. Chromosome, centromere. Note=May translocate to the nucleolus upon cell differentiation. Associates with both centromeres and chromosomal arms during metaphase. Associates with the H19 ICR in mitotic chromosomes. May be preferentially excluded from heterochromatin during interphase.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CTCF gene
Compartment Confidence
nucleus 5
cytosol 2

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for CTCF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000775 chromosome, centromeric region IDA,IEA 18550811
GO:0000793 condensed chromosome IDA 16107875
GO:0005634 nucleus IEA,IDA 9407128
GO:0005654 nucleoplasm IDA,IEA 16107875
GO:0005694 chromosome IEA --
genes like me logo Genes that share ontologies with CTCF: view

Pathways & Interactions for CTCF Gene

genes like me logo Genes that share pathways with CTCF: view

Gene Ontology (GO) - Biological Process for CTCF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription from RNA polymerase II promoter IDA 8649389
GO:0006306 DNA methylation IEA --
GO:0006349 regulation of gene expression by genetic imprinting IEA --
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
genes like me logo Genes that share ontologies with CTCF: view

No data available for SIGNOR curated interactions for CTCF Gene

Drugs & Compounds for CTCF Gene

(2) Drugs for CTCF Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(2) Additional Compounds for CTCF Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with CTCF: view

Transcripts for CTCF Gene

Unigene Clusters for CTCF Gene

CCCTC-binding factor (zinc finger protein):
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for CTCF
  • Applied Biological Materials Clones for CTCF
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

Alternative Splicing Database (ASD) splice patterns (SP) for CTCF Gene

ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9a · 9b ^ 10 ^ 11 ^ 12 ^ 13 ^ 14a · 14b · 14c
SP1: - - - -
SP2: -
SP3: -
SP4:
SP5:

Relevant External Links for CTCF Gene

GeneLoc Exon Structure for
CTCF
ECgene alternative splicing isoforms for
CTCF

Expression for CTCF Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CTCF Gene

Protein differential expression in normal tissues from HIPED for CTCF Gene

This gene is overexpressed in Blymphocyte (12.6), Peripheral blood mononuclear cells (11.3), and NK cells (8.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for CTCF Gene



Protein tissue co-expression partners for CTCF Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of CTCF Gene:

CTCF

SOURCE GeneReport for Unigene cluster for CTCF Gene:

Hs.368367

mRNA Expression by UniProt/SwissProt for CTCF Gene:

P49711-CTCF_HUMAN
Tissue specificity: Ubiquitous. Absent in primary spermatocytes.

Evidence on tissue expression from TISSUES for CTCF Gene

  • Nervous system(4.8)
  • Blood(2.4)
  • Kidney(2.3)
  • Liver(2.2)
  • Intestine(2.1)
  • Lung(2)
  • Muscle(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for CTCF Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • integumentary
  • nervous
  • reproductive
  • skeletal muscle
  • skeleton
Organs:
Head and neck:
  • brain
  • cranial nerve
  • eye
  • face
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • mouth
  • skull
  • tooth
Pelvis:
  • testicle
General:
  • peripheral nervous system
  • skin
genes like me logo Genes that share expression patterns with CTCF: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for CTCF Gene

Orthologs for CTCF Gene

This gene was present in the common ancestor of animals.

Orthologs for CTCF Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia CTCF 33 34
  • 99.91 (n)
oppossum
(Monodelphis domestica)
Mammalia CTCF 34
  • 95 (a)
OneToOne
cow
(Bos Taurus)
Mammalia CTCF 33 34
  • 94.31 (n)
dog
(Canis familiaris)
Mammalia CTCF 33 34
  • 94.18 (n)
rat
(Rattus norvegicus)
Mammalia Ctcf 33
  • 91.98 (n)
mouse
(Mus musculus)
Mammalia Ctcf 33 16 34
  • 90.97 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia CTCF 34
  • 84 (a)
OneToOne
chicken
(Gallus gallus)
Aves CTCF 33 34
  • 83.65 (n)
lizard
(Anolis carolinensis)
Reptilia CTCF 34
  • 92 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia ctcf 33
  • 76.35 (n)
Str.970 33
African clawed frog
(Xenopus laevis)
Amphibia MGC68419 33
zebrafish
(Danio rerio)
Actinopterygii ctcf 33 34
  • 71.78 (n)
fruit fly
(Drosophila melanogaster)
Insecta CTCF 35 34
  • 34 (a)
Species where no ortholog for CTCF was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CTCF Gene

ENSEMBL:
Gene Tree for CTCF (if available)
TreeFam:
Gene Tree for CTCF (if available)

Paralogs for CTCF Gene

Paralogs for CTCF Gene

(3) SIMAP similar genes for CTCF Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with CTCF: view

Variants for CTCF Gene

Sequence variations from dbSNP and Humsavar for CTCF Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
rs879255516 Pathogenic, Mental retardation, autosomal dominant 21 (MRD21) [MIM:615502] 67,628,550(+) CACGT(C/T)GGGTA reference, missense
VAR_013141 A Wilms' tumor
VAR_013142 A breast tumor
VAR_013143 A prostate tumor
VAR_013144 A Wilms' tumor

Structural Variations from Database of Genomic Variants (DGV) for CTCF Gene

Variant ID Type Subtype PubMed ID
esv2668512 CNV deletion 23128226
esv26764 CNV loss 19812545
esv2714650 CNV deletion 23290073
esv3638890 CNV loss 21293372
esv3638891 CNV loss 21293372
nsv1070770 CNV deletion 25765185
nsv1112693 CNV deletion 24896259
nsv522852 CNV gain 19592680
nsv524363 CNV loss 19592680
nsv827711 CNV gain 20364138
nsv833266 CNV loss 17160897
nsv952046 CNV deletion 24416366

Variation tolerance for CTCF Gene

Residual Variation Intolerance Score: 4.07% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.35; 7.84% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for CTCF Gene

Human Gene Mutation Database (HGMD)
CTCF
SNPedia medical, phenotypic, and genealogical associations of SNPs for
CTCF

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CTCF Gene

Disorders for CTCF Gene

MalaCards: The human disease database

(9) MalaCards diseases for CTCF Gene - From: HGMD, OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
mental retardation, autosomal dominant 21
  • mrd21
spherocytosis, type 4
  • hereditary spherocytosis type 4
congenital mesoblastic nephroma
  • nephroma, mesoblastic
beckwith-wiedemann syndrome
  • wiedemann-beckwith syndrome
spherocytosis, type 5
  • hereditary spherocytosis type 5
- elite association - COSMIC cancer census association via MalaCards
Search CTCF in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

CTCF_HUMAN
  • Mental retardation, autosomal dominant 21 (MRD21) [MIM:615502]: A disorder characterized by significantly below average general intellectual functioning associated with impairments in adaptive behavior and manifested during the developmental period. Additional MRD21 features include short stature, microcephaly, and developmental delay. {ECO:0000269 PubMed:23746550}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for CTCF

Genetic Association Database (GAD)
CTCF
Human Genome Epidemiology (HuGE) Navigator
CTCF
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
CTCF
genes like me logo Genes that share disorders with CTCF: view

No data available for Genatlas for CTCF Gene

Publications for CTCF Gene

  1. CTCF physically links cohesin to chromatin. (PMID: 18550811) Rubio ED … Krumm A (Proceedings of the National Academy of Sciences of the United States of America 2008) 2 3 4 22 60
  2. An exceptionally conserved transcriptional repressor, CTCF, employs different combinations of zinc fingers to bind diverged promoter sequences of avian and mammalian c-myc oncogenes. (PMID: 8649389) Filippova GN … Lobanenkov VV (Molecular and cellular biology 1996) 2 3 4 22 60
  3. Critical DNA binding interactions of the insulator protein CTCF: a small number of zinc fingers mediate strong binding, and a single finger-DNA interaction controls binding at imprinted loci. (PMID: 17827499) Renda M … Pedone PV (The Journal of biological chemistry 2007) 3 4 22 60
  4. CTCF binding at the H19 imprinting control region mediates maternally inherited higher-order chromatin conformation to restrict enhancer access to Igf2. (PMID: 16815976) Kurukuti S … Ohlsson R (Proceedings of the National Academy of Sciences of the United States of America 2006) 3 4 22 60
  5. A screen for germline mutations in the gene encoding CCCTC-binding factor (CTCF) in familial non-BRCA1/BRCA2 breast cancer. (PMID: 15084242) Zhou XL … Lindblom A (Breast cancer research : BCR 2004) 3 22 45 60

Products for CTCF Gene

  • Addgene plasmids for CTCF

Sources for CTCF Gene

Content
Loading form....