Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

CPNE7 Gene

protein-coding GIFtS: 51
GCID: GC16P089652

copine VII

Explore 4 diseases affiliated with
CPNE7 via

MalaCards

our new
Human Malady Compendium

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, and/or ¹⁰fRNAdb)
About This Section

Aliases
Copine VII¹ ² ³
Copine 7²
Copine-7¹

External Ids:	HGNC: 2320¹	Entrez Gene: 27132²	Ensembl: ENSG00000178773⁷	OMIM: 605689⁵	UniProtKB: Q9UBL6³

Export aliases for CPNE7 gene to outside databases

Previous GC identifers: GC16P080962 GC16P090630 GC16P089345 GC16P089385 GC16P088169 GC16P089643 GC16P075338 GC16P089646

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for CPNE7:

This gene encodes a member of the copine family, which is composed of calcium-dependent membrane-binding proteins. The

gene product contains two N-terminal C2 domains and one von Willebrand factor A domain. The encoded protein may be

involved in membrane trafficking. Two alternatively spliced transcript variants encoding different isoforms have been

found for this gene. (provided by RefSeq, Nov 2008)

UniProtKB/Swiss-Prot: CPNE7_HUMAN, Q9UBL6

Function: May function in membrane trafficking. Exhibits calcium-dependent phospholipid binding properties (By

similarity)

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000016.9 NC_018927.1 NT_010542.15

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the CPNE7 gene promoter:
RFX1 Pax-5 AML1a LCR-F1 RORalpha2 E47 PPAR-alpha POU2F1 POU2F1a ZID
Other transcription factors

Browse SwitchGear Promoter luciferase reporter plasmids

Search SABiosciences Chromatin IP Primers for CPNE7

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat CPNE7

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 16q24.3 Ensembl cytogenetic band: 16q24.3 HGNC cytogenetic band: 16q24.3

CPNE7 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
CPNE7 gene location

GeneLoc information about chromosome 16 GeneLoc Exon Structure

GeneLoc location for GC16P089652: view genomic region (about GC identifiers)

Start:	89,642,176 bp from pter	End:	89,663,654 bp from pter
Size:	21,479 bases	Orientation:	plus strand

(According to ¹UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to ²PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: CPNE7_HUMAN, Q9UBL6 (See protein sequence)

Recommended Name: Copine-7

Size: 633 amino acids; 70294 Da

Alternative splicing: 2 isoforms: Q9UBL6-1 Q9UBL6-2 (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for CPNE7: NX_Q9UBL6

Post-translational modifications:

View modification sites using PhosphoSitePlus²

View neXtProt modification sites for NX_Q9UBL6

CPNE7 Protein expression data from MOPED and PaxDb: About this image

REFSEQ proteins (2 alternative transcripts):

NP_055242.1 NP_705900.1

ENSEMBL proteins:

ENSP00000268720 ENSP00000431863 ENSP00000317374 ENSP00000435876 ENSP00000455086

ENSP00000434886

Human Recombinant Protein Products for CPNE7:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	OriGene Purified Protein: CPNE7 OriGene Protein Over-expression Lysate: CPNE7 OriGene Custom Protein Services for CPNE7
	GenScript Custom Purified and Recombinant Proteins Services for CPNE7
	Novus Biologicals CPNE7 Protein Novus Biologicals CPNE7 Lysate
	Browse Sino Biological Recombinant Proteins
	Browse ProSpec Recombinant Proteins
	Uscn Proteins for CPNE7

CPNE7 Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	Browse OriGene Antibodies OriGene Custom Antibody Services for CPNE7
	GenScript Custom Superior Antibodies Services for CPNE7
	Novus Biologicals CPNE7 Antibodies
	Abcam antibodies for CPNE7
	Uscn Antibodies for CPNE7
	Search ThermoFisher Antibodies for CPNE7

Assay Products for CPNE7:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Immunoassay Development Browse OriGene Fluorogenic Cell Assay Kits
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for CPNE7
	Browse Enzo Life Sciences for kits & assays
	Uscn ELISAs and CLIAs for CPNE7

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

CPNE7 for domains About GeneDecksing

5 InterPro domains/families:

IPR018029 C2_membr_targeting

IPR008973 C2_Ca/lipid-bd_dom_CaLB

IPR010734 Copine

IPR000008 C2_Ca-dep

IPR002035 VWF_A

Graphical View of Domain Structure for InterPro Entry Q9UBL6

ProtoNet protein and cluster: Q9UBL6

2 Blocks protein families:

IPB000008 C2 domain

IPB010734 Copine

UniProtKB/Swiss-Prot: CPNE7_HUMAN, Q9UBL6

Similarity: Belongs to the copine family

Similarity: Contains 2 C2 domains

Similarity: Contains 1 VWFA domain

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, Sirion Biotech, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, Sirion Biotech, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

Molecular Function:

UniProtKB/Swiss-Prot Summary: CPNE7_HUMAN, Q9UBL6

Function: May function in membrane trafficking. Exhibits calcium-dependent phospholipid binding properties (By

copine VII,member of the COPINE family,potential tumor suppressor,but excluded as a candidate gene in breast cancers

(TSG16A,TSG16D)

Gene Ontology (GO): 1 molecular function term (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005215	transporter activity	TAS	10534407

CPNE7 for ontologies About GeneDecksing

Animal Models:

inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for CPNE7

miRNA Products:		Browse 3'-UTR reporter clones for miRNA target validation Browse MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat CPNE7
		1 QIAGEN miScript miRNA Assays for microRNA that regulate CPNE7:
		hsa-miR-296-5p
		SwitchGear 3'UTR luciferase reporter plasmid: CPNE7 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for CPNE7 (see all 7) OriGene siRNA: CPNE7
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat CPNE7
		Sirion Biotech Custom design and validation of potent shRNA sequences against CPNE7

Gene Editing Products:			DNA2.0 Custom Protein Engineering Service for CPNE7
			Sirion Biotech Customized adenovirus for overexpression of CPNE7 Sirion Biotech Customized adenovirus for potent knockdown of CPNE7

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for CPNE7 (see all 4) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for CPNE7 (see all 2) OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 2): CPNE7 (NM_014427)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for CPNE7
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CPNE7

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for CPNE7
		Search LifeMap BioReagents cell lines for CPNE7
		Sirion Biotech Customized stable knockdown cell line services for CPNE7 Sirion Biotech Customized inducible knockdown cell line services for CPNE7 Sirion Biotech Customized stable overexpressing cell line services for CPNE7 Sirion Biotech Customized inducible overexpressing cell line services for CPNE7

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CPNE7

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section

Interactions:

Search SABiosciences Gene Network Central^TM Interacting Genes and Proteins Networks for CPNE7

STRING Interaction Network Preview (showing 5 interactants - click image to see more details)

5/9 Interacting proteins for CPNE7 (Q9UBL6^{2, 3} ENSP00000268720⁴) via UniProtKB, MINT, STRING, and/or I2D (see all 9)

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
CSNK2B	P67870²^,³	MINT-8253187 I2D: score=2
CALCOCO2	Q13137²^,³, ENSP00000258947⁴	MINT-66571 I2D: score=5 STRING: ENSP00000258947
USP53	Q70EK8³, ENSP00000274030⁴	I2D: score=2 STRING: ENSP00000274030
UVRAG	Q9P2Y5³, ENSP00000348455⁴	I2D: score=1 STRING: ENSP00000348455
OTUB1	Q96FW1³	I2D: score=2

About this table

Gene Ontology (GO): 2 biological process terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0006629	lipid metabolic process	TAS	10534407
GO:0006810	transport	TAS	10534407

CPNE7 for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for CPNE7

1 HMDB Compound for CPNE7 About this table

Compound	Synonyms	CAS #	PubMed Ids
Calcium	Ca (see all 2)	7440-70-2	--

Search CenterWatch for drugs/clinical trials and news about CPNE7

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, Sirion Biotech, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for CPNE7 gene (2 alternative transcripts):

NM_014427.4 NM_153636.2

Unigene Cluster for CPNE7:

Copine VII

Hs.461775 [show with all ESTs]

Unigene Representative Sequence: NM_014427

9 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000268720(uc002fnp.3 uc002fnq.3) ENST00000525982 ENST00000319518

ENST00000532500 ENST00000529800 ENST00000568977 ENST00000566398 ENST00000526232

ENST00000564421

miRNA Products:		Browse 3'-UTR reporter clones for miRNA target validation Browse OriGene MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat CPNE7
		1 QIAGEN miScript miRNA Assays for microRNA that regulate CPNE7:
		hsa-miR-296-5p
		SwitchGear 3'UTR luciferase reporter plasmid: CPNE7 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for CPNE7 (see all 7) OriGene siRNA: CPNE7
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat CPNE7
		Sirion Biotech Custom design and validation of potent shRNA sequences against CPNE7

Clone Products:		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for CPNE7 (see all 4) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for CPNE7 (see all 2) OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 2): CPNE7 (NM_014427)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for CPNE7
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CPNE7

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for CPNE7 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat CPNE7
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat CPNE7
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat CPNE7

Additional cDNA sequence:

AJ133798.1 AK123526.1 BC035334.1 BC064577.1

12 DOTS entries:

DT.436487 DT.100020557 DT.97805165 DT.92419539 DT.99977642 DT.91677324 DT.97824111 DT.97842295

DT.97842296 DT.40207136 DT.412253 DT.75149716

24/60 AceView cDNA sequences (see all 60):

BQ014714 BM987502 BM797064 BC035334 BQ009550 BC064577 NM_153636 Z39757

AJ133798 BM823274 BM824628 NM_014427 AL539371 AK123526 BI914091 BX444965

BX431644 BI918287 CA431690 BV176556 BX281473 BX420737 BX441703 BM824893

GeneLoc Exon Structure

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

CPNE7 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS
CGAP TAG: GGGTCTGCGG

About this image

CPNE7 expression in embryonic tissues and stem cells
Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine About this table

6 LifeMap In Vivo Development Anatomical Compartments/Cells

Tissue

Anatomical Compartment

Cell

Category (developmental path)

Spinal Cord

Spinal Dorsal Columns

Dorsal Spinal Cord Progenitor Cells

Spinal Cord

Spinal Ventral Columns

Ventral Spinal Cord Progenitor Cells

Motor Neurons

Neural Tube

Neural Tube

Spinal Dorsal Columns

Spinal Cord

Spinal Ventral Columns

Spinal Cord

Expression:

Positive

Negative

Selective marker

Experimental details:

Curated

Microarrays

In-situ hybridization

See CPNE7 Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for CPNE7

SOURCE GeneReport for Unigene cluster: Hs.461775

SABiosciences Custom PCR Arrays for CPNE7

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for CPNE7 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat CPNE7
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat CPNE7
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat CPNE7

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CPNE7

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of eukaryotes.

Orthologs for CPNE7 gene from 6/20 species (see all 20) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
chicken (Gallus gallus)	Aves	CPNE7¹	copine VII	83.72(n) 83.14(a)		415851 XM_414211.3 XP_414211.3
lizard (Anolis carolinensis)	Reptilia	-- --	--	87(a) 69(a)	1 ↔ many 1 ↔ many	AAWZ02041805(1996-4997) GL343487.1(477548-515222)
zebrafish (Danio rerio)	Actinopterygii	LOC564556¹	copine-7-like	73.44(n) 76.41(a)		564556 XM_687889.4 XP_692981.4
worm (Caenorhabditis elegans)	Secernentea	Y73F8A.19³	--	28(a)		IV(15361756-15368155) --
thale cress (Arabidopsis thaliana)	eudicotyledons	AT5G63970⁶ AT1G79380⁶ (see all 5)	Copine (Calcium-dependent phospholipid-binding pro... Ca(2)-dependent phospholipid-binding family protei... (see all 5)	20(a) 19(a) (see all 5)	possible ortholog possible ortholog (see all 5)	5(25606771-25609247) 1(29860491-29863316)
rice (Oryza sativa)	Liliopsida	-- -- (see all 7)	copine, putative, expressed (see all 7)	9(a) 20(a) (see all 7)	possible ortholog possible ortholog (see all 7)	9(22507403-22512808) 1(42349883-42354354)

ENSEMBL Gene Tree for CPNE7 (if available)
TreeFam Gene Tree for CPNE7 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

Paralogs for CPNE7 gene

CPNE9² CPNE2² CPNE6² CPNE3² CPNE5² CPNE8² CPNE4² CPNE1²

8 SIMAP similar genes for CPNE7 using alignment to 5 protein entries: CPNE7_HUMAN (see all proteins):

CPNE4 CPNE2 CPNE6 CPNE3 CPNE9 CPNE5

CPNE1 CPNE8

CPNE7 for paralogs About GeneDecksing

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 16 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs116672064^1,2		--	89640225(+)	`TGCGTG/ATATGT`	2	--	us2k¹		1		WA	118
rs144580676^1,2		--	89640243(+)	`TCTCAG/TTTCCT`	2	--	us2k¹		0	--	--	--	--
rs458526^1,2	C,F,A	--	89640267(+)	`CAGGGA/GAAGCT`	2	--	us2k¹ tfbs³		5		NA EA	246
rs190787071^1,2		--	89640538(+)	`AAACTA/CTGTGA`	2	--	us2k¹		0	--	--	--	--
rs76825130^1,2	F	--	89640731(+)	`AGGAGC/GTTTCG`	2	--	us2k¹		1		WA	118
rs183019400^1,2		--	89640735(+)	`GCTTTC/TGGGTG`	2	--	us2k¹		0	--	--	--	--
rs151327105^1,2	C	--	89640771(+)	`GTCTG-/GGGAAAACTGTCCCA GGGCTGCTGGAACCGAGCGGGAG`	2	--	us2k¹		0	--	--	--	--
rs139746594^1,2		--	89640803(+)	`CGAGC-/TGGGGAG`	2	--	us2k¹		0	--	--	--	--
rs60644216^1,2		--	89640812(+)	`AGGCAC/TGGCCT`	2	--	us2k¹		0	--	--	--	--
rs185902325^1,2		--	89640864(+)	`GCATCC/TTTTTC`	2	--	us2k¹		0	--	--	--	--

HapMap Linkage Disequilibrium report for CPNE7 (89642176 - 89663654 bp)
Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
Database of Genomic Variants (DGV): 10 variations for CPNE7
4 CNVs: 7139 72698 30798 4018
6 Indels: 45490 45491 72699 11852 33637 25742

SABiosciences Cancer Mutation PCR Assays

QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing CPNE7

DNA2.0 Custom Variant and Variant Library Synthesis for CPNE7

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

CPNE7 for disorders           About GeneDecksing

OMIM gene information: 605689    OMIM disorders: --

4 diseases for CPNE7:    About MalaCards

sporadic breast cancer breast cancer hermaphroditism infertility

Export disorders for CPNE7 gene to outside databases

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for CPNE7 gene integrated from 9 sources:
(articles sorted by number of sources associating them with CPNE7)

Utopia: connect your pdf to the dynamic
world of online information

The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)^{1, 2} Gerhard D.S....Malek J. (2004)
Characterization of copine VII, a new member of the copine family, and its exclusion as a candidate in sporadic breast cancers with loss of heterozygosity at 16q24.3. (PubMed id 10534407)^{1, 2} Savino M.... Savoia A. (1999)
Systematic and quantitative assessment of the ubiquiti n-modified proteome. (PubMed id 21906983)¹ Kim W....Gygi S.P. (2011)
A directed protein interaction network for investigat ing intracellular signal transduction. (PubMed id 21900206)¹ Vinayagam A....Wanker E.E. (2011)
Dynamics of cullin-RING ubiquitin ligase network revea led by systematic quantitative proteomics. (PubMed id 21145461)¹ Bennett E.J....Harper J.W. (2010)
Defining the human deubiquitinating enzyme interactio n landscape. (PubMed id 19615732)¹ Sowa M.E....Harper J.W. (2009)
Towards a proteome-scale map of the human protein-protein interaction network. (PubMed id 16189514)¹ Rual J.F....Vidal M. (2005)
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)¹ Strausberg R.L....Marra M.A. (2002)
Normalization and subtraction: two approaches to facilitate gene discovery. (PubMed id 8889548)¹ Bonaldo M.F.... Soares M.B. (1996)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 27132	HGNC: 2320	AceView: CPNE7	Ensembl:ENSG00000178773	euGenes: HUgn27132
ECgene: CPNE7	H-InvDB: CPNE7

(According to HUGE)
About This Section

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for CPNE7	Pharmacogenomics, SNPs, Pathways
ATLAS Chromosomes in Cancer entry for CPNE7	Genetics and Cytogenetics in Oncology and Haematology

Intellectual Property for CPNE7 gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for CPNE7 gene:
Search GeneIP for patents involving CPNE7

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, LifeMap BioReagents, and Sirion Biotech, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory)
About This Section


	EMD Millipore Custom Antibody & Bulk Services
	EMD Millipore Preclinical / Clinical Development Services
	EMD Millipore Immunoassay Services
	EMD Millipore Target Screening & Profiling Services

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Kinase Activity Assays/Reagents
	Browse ELISpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Multiplex/Array Assay Kits/Reagents
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Phosphatase Activity Assays/Reagents		Browse Recombinant/Natural Proteins

	Browse OriGene Antibodies		Browse OriGene shRNA RFPs
	OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for CPNE7		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for CPNE7
	OriGene Protein Over-expression Lysate for CPNE7		Browse OriGene Fluorogenic Cell Assay Kits
	OriGene siRNA for CPNE7		Browse 3'-UTR reporter clones for miRNA target validation
	OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for CPNE7		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for CPNE7
	Browse OriGene GFP tagged cDNA clones in CMV expression vector		Browse OriGene MicroRNA Expression Plasmids
	Browse OriGene basic RS shRNAs		Browse OriGene validated miRNA SYBR primer pairs
	OriGene Purified Protein for CPNE7		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for CPNE7		OriGene Custom Protein Services for CPNE7
	OriGene Custom Immunoassay Development

	QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat CPNE7
	QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing CPNE7
	QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat CPNE7
	QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat CPNE7
	QIAGEN QuantiFast Probe-based Assays in human, mouse, rat CPNE7
	QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat CPNE7

	GenScript Custom Purified and Recombinant Proteins Services for CPNE7		GenScript cDNA clones with any tag delivered in your preferred vector for CPNE7
	GenScript Custom Assay Services for CPNE7		GenScript Custom Superior Antibodies Services for CPNE7
	GenScript Custom overexpressing Cell Line Services for CPNE7		CloneReady with Over 120,000 Genes
	Gene Synthesis: Any Gene in Any Vector		Vector-based siRNA and miRNA, Ready for Transfection
	Gene Mutant Library, Variants up to 10^11		Plasmid Preparation
	Custom Peptide Services

Search for Antibodies & Assays

	Regulatory tfbs in CPNE7 promoter
	Search Chromatin IP Primers for CPNE7
	RT² qPCR Primer Assay in human, mouse, rat CPNE7
	Search GNC Networks for CPNE7
	SABiosciences Custom PCR Arrays for CPNE7

Search Tocris compounds for CPNE7

	Browse Sino Biological Proteins and Antibodies
	Browse Sino Biological cDNA Clones
	Antibodies/Proteins Production Services
	Rabbit Monoclonal Antibody Platform
	Bulk Purchasing

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	CPNE7 antibodies
	CPNE7 proteins
	CPNE7 lysates

	Antibodies for CPNE7
	See all of Abcam's Antibodies, Kits and Proteins for CPNE7
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Browse ProSpec Recombinant Proteins

CPNE7 Proteins, Antibodies, CLIAs, and ELISAs

Search LifeMap BioReagents cell lines for CPNE7

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CPNE7

	SwitchGear 3'UTR luciferase reporter plasmids for CPNE7
	Browse SwitchGear Promoter luciferase reporter plasmids for CPNE7

Search ThermoFisher Antibodies for CPNE7

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CPNE7

inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for CPNE7

Sirion Biotech Customized:

	stable knockdown cell line services for CPNE7
	inducible knockdown cell line services for CPNE7
	design and validation of potent shRNA sequences against CPNE7
	adenovirus for potent knockdown of CPNE7
	adenovirus for overexpression of CPNE7
	stable overexpressing cell line services for CPNE7
	inducible overexpressing cell line services for CPNE7

GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013 , 13 May 2013

View Random Gene

Category			VWF (GIFTS: 73) von Willebrand factor
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes CPNE7 gene at Home site.

hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4

Advanced Search

Export list of displayed genes

CPNE7 Gene

copine VII

Aliases
for CPNE7 gene

Summaries
for CPNE7 gene

Genomic Views
for CPNE7 gene

Proteins
for CPNE7 gene

Protein Domains /
Families
for CPNE7 gene

Function
for CPNE7 gene

Pathways & Interactions
for CPNE7 gene

Drugs & Compounds
for CPNE7 gene

Transcripts
for CPNE7 gene

Expression
for CPNE7 gene

Orthologs
for CPNE7 gene

Paralogs
for CPNE7 gene

Genomic Variants
for CPNE7 gene

Disorders / Diseases
for CPNE7 gene

Publications
for CPNE7 gene

External Searches for CPNE7 gene

Genome Databases showing CPNE7 gene

Other Databases showing CPNE7 gene

Specialized Databases showing CPNE7 gene

Intellectual Property
for CPNE7 gene

Products
for CPNE7 gene

View Random Gene

Advanced Search

Export list of displayed genes

CPNE7 Gene

copine VII

Aliasesfor CPNE7 gene

Summariesfor CPNE7 gene

Genomic Viewsfor CPNE7 gene

Proteinsfor CPNE7 gene

Protein Domains /Familiesfor CPNE7 gene

Functionfor CPNE7 gene

Pathways & Interactionsfor CPNE7 gene

Drugs & Compoundsfor CPNE7 gene

Transcriptsfor CPNE7 gene

Expression for CPNE7 gene

Orthologsfor CPNE7 gene

Paralogsfor CPNE7 gene

Genomic Variantsfor CPNE7 gene

Disorders / Diseasesfor CPNE7 gene

Publicationsfor CPNE7 gene

External Searches for CPNE7 gene

Genome Databases showing CPNE7 gene

Other Databases showing CPNE7 gene

Specialized Databases showing CPNE7 gene

Intellectual Propertyfor CPNE7 gene

Productsfor CPNE7 gene

View Random Gene

Aliases
for CPNE7 gene

Summaries
for CPNE7 gene

Genomic Views
for CPNE7 gene

Proteins
for CPNE7 gene

Protein Domains /
Families
for CPNE7 gene

Function
for CPNE7 gene

Pathways & Interactions
for CPNE7 gene

Drugs & Compounds
for CPNE7 gene

Transcripts
for CPNE7 gene

Expression
for CPNE7 gene

Orthologs
for CPNE7 gene

Paralogs
for CPNE7 gene

Genomic Variants
for CPNE7 gene

Disorders / Diseases
for CPNE7 gene

Publications
for CPNE7 gene

Intellectual Property
for CPNE7 gene

Products
for CPNE7 gene