Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

COL17A1 Gene

protein-coding   GIFtS: 62
GCID: GC10M105781

Collagen, Type XVII, Alpha 1


(Previous symbol: BPAG2)
Alzheimer's & Parkinson's Diseases Congress
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
Collagen, Type XVII, Alpha 11 2     Alpha 1 Type XVII Collagen2
BPAG21 2 3 5     BA16H23.2 (Collagen, Type XVII, Alpha 1 (BP180))2
180 KDa Bullous Pemphigoid Antigen 22 3     Bullous Pemphigoid Antigen 2 (180kD)2
BP1802 3     Collagen Alpha-1(XVII) Chain2
BA16H23.22     Collagen XVII, Alpha-1 Polypeptide2
BPA-22     Bullous Pemphigoid Antigen 23
LAD-12     

External Ids:    HGNC: 21941   Entrez Gene: 13082   Ensembl: ENSG000000656187   OMIM: 1138115   UniProtKB: Q9UMD93   

Export aliases for COL17A1 gene to outside databases

Previous GC identifers: GC10M104684 GC10M105024 GC10M105922 GC10M105455 GC10M099422


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for COL17A1 Gene:
This gene encodes the alpha chain of type XVII collagen. Unlike most collagens, collagen XVII is a transmembrane
protein. Collagen XVII is a structural component of hemidesmosomes, multiprotein complexes at the
dermal-epidermal basement membrane zone that mediate adhesion of keratinocytes to the underlying membrane.
Mutations in this gene are associated with both generalized atrophic benign and junctional epidermolysis bullosa.
Two homotrimeric forms of type XVII collagen exist. The full length form is the transmembrane protein. A soluble
form, referred to as either ectodomain or LAD-1, is generated by proteolytic processing of the full length form.
(provided by RefSeq, Jul 2008)

GeneCards Summary for COL17A1 Gene: 
COL17A1 (collagen, type XVII, alpha 1) is a protein-coding gene. Diseases associated with COL17A1 include pemphigoid gestationis, and herpes gestationis, and among its related super-pathways are Collagen biosynthesis and modifying enzymes and FAK1 Signaling. GO annotations related to this gene include protein binding. An important paralog of this gene is COL28A1.

UniProtKB/Swiss-Prot: COHA1_HUMAN, Q9UMD9
Function: May play a role in the integrity of hemidesmosome and the attachment of basal keratinocytes to the
underlying basement membrane
Function: The 120 kDa linear IgA disease antigen is an anchoring filament component involved in dermal-epidermal
cohesion. Is the target of linear IgA bullous dermatosis autoantibodies

Gene Wiki entry for COL17A1 (Collagen, type XVII, alpha 1) Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000010.10  NT_030059.13  NC_018921.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the COL17A1 gene promoter:
         Oct-B1   oct-B2   Pbx1a   AML1a   Nkx2-5   Gfi-1   HEN1   E2F-1   E2F   LyF-1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidCOL17A1 promoter sequence
   Search SABiosciences Chromatin IP Primers for COL17A1

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat COL17A1


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 10q24.3   Ensembl cytogenetic band:  10q25.1   HGNC cytogenetic band: 10q24.3

COL17A1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
COL17A1 gene location

GeneLoc information about chromosome 10         GeneLoc Exon Structure

GeneLoc location for GC10M105781:  view genomic region     (about GC identifiers)

Start:
105,791,044 bp from pter      End:
105,845,760 bp from pter
Size:
54,717 bases      Orientation:
minus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: COHA1_HUMAN, Q9UMD9 (See protein sequence)
Recommended Name: Collagen alpha-1(XVII) chain  
Size: 1497 amino acids; 150419 Da
Subunit: Homotrimers of alpha 1(XVII)chains. Interacts (via cytoplasmic region) with ITGB4 (via cytoplasmic
region). Interacts (via cytoplasmic region) with DST isoform 3 (via N-terminus). Interacts (via N-terminus) with
PLEC. Interacts (via cytoplasmic region) with DSP
Subcellular location: Cell junction, hemidesmosome. Membrane; Single-pass type II membrane protein. Note=Localized
along the plasma membrane of the hemidesmosome
Subcellular location: 120 kDa linear IgA disease antigen: Secreted, extracellular space, extracellular matrix,
basement membrane. Note=Exclusively localized to anchoring filaments. Localized to the epidermal side of split
skin
Subcellular location: 97 kDa linear IgA disease antigen: Secreted, extracellular space, extracellular matrix,
basement membrane. Note=Localized in the lamina lucida beneath the hemidesmosomes
Miscellaneous: Both the 120 kDa linear IgA disease antigen and the 97 kDa linear IgA disease antigen of COL17A1,
represent major antigenic targets of autoantibodies in patients with linear IgA disease (LAD). LAD is a
subepidermal blistering disorder characterized by tissue-bound and circulating IgA autoantibodies to the
dermal-epidermal junction. These IgA autoantibodies preferentially react with 97 and the 120 kDa forms, but not
with the full-length COL17A1, suggesting that the cleavage of the ectodomain generates novel autoantigenic
epitopes
Sequence caution: Sequence=AAA35605.1; Type=Erroneous initiation; Note=Translation N-terminally shortened;
Sequence=AAH04478.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence;
Secondary accessions: Q02802 Q5JV36 Q99018 Q9NQK9 Q9UC14
Alternative splicing: 2 isoforms:  Q9UMD9-1   Q9UMD9-2   (Gene prediction based on EST data)

Explore the universe of human proteins at neXtProt for COL17A1: NX_Q9UMD9

Explore proteomics data for COL17A1 at MOPED 

Post-translational modifications:

  • UniProtKB: The intracellular/endo domain is disulfide-linked
  • UniProtKB: Prolines at the third position of the tripeptide repeating unit (G-X-Y) are hydroxylated in some or all of the
    chains
  • UniProtKB: The ectodomain is shedded from the surface of keratinocytes resulting in a 120-kDa soluble form, also named as 120
    kDa linear IgA disease antigen. The shedding is mediated by membrane-bound metalloproteases. This cleavage is
    inhibited by phosophorylation at Ser-544
  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_Q9UMD9

  • COL17A1 Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    COL17A1 Protein Expression
    REFSEQ proteins: NP_000485.3  
    ENSEMBL proteins: 
     ENSP00000340937   ENSP00000358748   ENSP00000388832   ENSP00000376905  
    Reactome Protein details: Q9UMD9
    Human Recombinant Protein Products for COL17A1: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for COL17A1
    OriGene Custom MassSpec 
    OriGene Custom Protein Services for COL17A1
    GenScript Custom Purified and Recombinant Proteins Services for COL17A1
    Novus Biologicals COL17A1 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Browse Proteins at Cloud-Clone Corp. 

    Gene Ontology (GO): 5/8 cellular component terms (GO ID links to tree view) (see all 8):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005576extracellular region TAS--
    GO:0005581collagen IEA--
    GO:0005604basement membrane IEA--
    GO:0005788endoplasmic reticulum lumen TAS--
    GO:0005886plasma membrane TAS--

    COL17A1 for ontologies           About GeneDecksing



    COL17A1 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for COL17A1
    GenScript Custom Superior Antibodies Services for COL17A1
    Novus Biologicals COL17A1 Antibody
    Abcam antibodies for COL17A1
    Browse Antibodies at Cloud-Clone Corp. 
    ThermoFisher Antibody for COL17A1
    LSBio Antibodies in human, mouse, rat for COL17A1 

    Assay Products for COL17A1: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for COL17A1
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for COL17A1
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs at Cloud-Clone Corp. 
    Browse CLIAs at Cloud-Clone Corp.


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    HGNC Gene Families: 
    COLLAGEN: Collagens

    1 InterPro protein domain:
     IPR008160 Collagen

    Graphical View of Domain Structure for InterPro Entry Q9UMD9

    ProtoNet protein and cluster: Q9UMD9

    2 Blocks protein domains:
    IPB008160 Collagen triple helix repeat
    IPB008161 Collagen helix repeat



    COL17A1 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: COHA1_HUMAN, Q9UMD9
    Function: May play a role in the integrity of hemidesmosome and the attachment of basal keratinocytes to the
    underlying basement membrane
    Function: The 120 kDa linear IgA disease antigen is an anchoring filament component involved in dermal-epidermal
    cohesion. Is the target of linear IgA bullous dermatosis autoantibodies

         Genatlas biochemistry entry for COL17A1:
    collagen type XVII,alpha 1,plasma membrane of keratinocytes

         Gene Ontology (GO): 1 molecular function term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005515protein binding IPI12482924
         
    COL17A1 for ontologies           About GeneDecksing


    Phenotypes:
         2 GenomeRNAi human phenotypes for COL17A1:
     High actin ratio cells  Increased gamma-H2AX phosphory 

         5 MGI mutant phenotypes (inferred from 1 allele(MGI details for Col17a1):
     growth/size  immune system  integument  mortality/aging  reproductive system 

    COL17A1 for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-out Col17a1tm1Shzu for COL17A1

       inGenious Targeting Laboratory - Custom generated mouse model solutions for COL17A1 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for COL17A1

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for COL17A1 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for COL17A1 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat COL17A1
    8 QIAGEN miScript miRNA Assays for microRNAs that regulate COL17A1:
    hsa-miR-411* hsa-miR-203 hsa-miR-548am hsa-miR-379* hsa-miR-4287 hsa-miR-548t hsa-miR-548x hsa-miR-384
    SwitchGear 3'UTR luciferase reporter plasmidCOL17A1 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for COL17A1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat COL17A1

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for COL17A1
    Sirion Biotech Customized adenovirus for overexpression of COL17A1

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for COL17A1 (see all 7)
    OriGene ORF clones in mouse, rat for COL17A1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: COL17A1 (NM_000494)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for COL17A1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat COL17A1
    Sirion Biotech Customized lentivirus for stable overexpression of COL17A1 
                         Customized lentivirus expression plasmids for stable overexpression of COL17A1 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for COL17A1
    Search LifeMap BioReagents cell lines for COL17A1
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for COL17A1


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for COL17A1 About   (see all 10)                                                                                              See pathways by source

    SuperPathContained pathways About
    1Collagen biosynthesis and modifying enzymes
    Collagen biosynthesis and modifying enzymes0.74
    Intrinsic Prothrombin Activation Pathway0.40
    Collagen formation0.74
    Extracellular matrix organization0.39
    Assembly of collagen fibrils and other multimeric structures0.65
    Blood Coagulation Cascade0.39
    2Integrin Pathway
    Integrin Pathway0.67
    UPA-UPAR Pathway0.56
    FAK1 Signaling0.67
    Inhibition of Angiogenesis by TSP10.50
    GnRH Signaling0.56
    Transendothelial Migration of Leukocytes0.38
    3Rho Family GTPases
    Rho Family GTPases0.61
    Molecular Mechanisms of Cancer0.51
    ERK Signaling0.61
    ILK Signaling0.49
    MAPK Signaling0.58
    4Degradation of the extracellular matrix
    Degradation of the extracellular matrix0.79
    Degradation of collagen0.79
    5Cell-cell junction organization
    Cell junction organization0.69
    Cell-Cell communication0.64

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    5/15 Downloadable PowerPoint Slides of QIAGEN Pathway Central Maps for COL17A1 (see all 15)
        MAPK Signaling
    Molecular Mechanisms of Cancer
    PTEN Pathway
    Transendothelial Migration of Leukocytes
    UPA-UPAR Pathway

    2 BioSystems Pathways for COL17A1
        Alpha6-Beta4 Integrin Signaling Pathway
    a6b1 and a6b4 Integrin signaling

    5/9        Reactome Pathways for COL17A1 (see all 9)
        Assembly of collagen fibrils and other multimeric structures
    Collagen formation
    Degradation of collagen
    Extracellular matrix organization
    Collagen biosynthesis and modifying enzymes


    1         Kegg Pathway  (Kegg details for COL17A1):
        Protein digestion and absorption


    COL17A1 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for COL17A1

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/57 Interacting proteins for COL17A1 (Q9UMD93 ENSP000003409374) via UniProtKB, MINT, STRING, and/or I2D (see all 57)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    ACTN4O437073, ENSP000002526994I2D: score=2 STRING: ENSP00000252699
    CTNND1O607163, ENSP000003820044I2D: score=2 STRING: ENSP00000382004
    ITGB4P161443, ENSP000002001814I2D: score=2 STRING: ENSP00000200181
    KRT18P057833, ENSP000003734874I2D: score=2 STRING: ENSP00000373487
    LAD1O005153, ENSP000003758294I2D: score=1 STRING: ENSP00000375829
    About this table

    Gene Ontology (GO): 5/7 biological process terms (GO ID links to tree view) (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0007160cell-matrix adhesion TAS9012408
    GO:0008544epidermis development TAS9012408
    GO:0022617extracellular matrix disassembly TAS--
    GO:0030198extracellular matrix organization TAS--
    GO:0030574collagen catabolic process TAS--

    COL17A1 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    COL17A1 for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for COL17A1 (COHA1)

    10/11 Novoseek inferred chemical compound relationships for COL17A1 gene (see all 11)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    batimastat 42.3 2 11710917 (1), 11978564 (1)
    calcium 1.28 2 16906396 (2)
    nacl 0 1 9242508 (1)
    phenylalanine 0 1 9087447 (1)
    sucrose 0 1 8662839 (1)
    steroid 0 3 8689764 (2), 17596158 (1)
    tyrosine 0 2 9087447 (1), 9660880 (1)
    gold 0 1 7682575 (1)
    proline 0 2 10022517 (1), 1846881 (1)
    serine 0 1 11912005 (1)

    Search CenterWatch for drugs/clinical trials and news about COL17A1 / COHA1

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for COL17A1 gene (2 alternative transcripts): 
    NM_000494.3  NM_130778.1  

    Unigene Clusters for COL17A1:

    Collagen, type XVII, alpha 1
    Hs.117938  [show with all ESTs], Hs.732773  [show with all ESTs]
    Unigene Representative Sequences: NM_000494, AI671290
    7 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000353479(uc001kxr.3) ENST00000369733(uc010qqv.1 uc009xxp.1)
    ENST00000433822(uc001kxq.3) ENST00000480127 ENST00000393211 ENST00000488320
    ENST00000483876

    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat COL17A1
    8 QIAGEN miScript miRNA Assays for microRNAs that regulate COL17A1:
    hsa-miR-411* hsa-miR-203 hsa-miR-548am hsa-miR-379* hsa-miR-4287 hsa-miR-548t hsa-miR-548x hsa-miR-384
    SwitchGear 3'UTR luciferase reporter plasmidCOL17A1 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for COL17A1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat COL17A1
    Clone
    Products:
         
    OriGene clones in human, mouse for COL17A1 (see all 7)
    OriGene ORF clones in mouse, rat for COL17A1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: COL17A1 (NM_000494)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for COL17A1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat COL17A1
    Sirion Biotech Customized lentivirus for stable overexpression of COL17A1 
                         Customized lentivirus expression plasmids for stable overexpression of COL17A1 
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for COL17A1
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat COL17A1
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat COL17A1
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat COL17A1

    Additional mRNA sequence: AF136186.1 

    17 DOTS entries:

    DT.441052  DT.100780356  DT.121269578  DT.95197672  DT.86846102  DT.102310  DT.100780362  DT.121634602 
    DT.91887089  DT.91921785  DT.92001624  DT.92008549  DT.95197679  DT.121269571  DT.121269576  DT.121643178 
    DT.91813165 

    24/279 AceView cDNA sequences (see all 279):

    BM837978 AF136185 BE563325 AI637697 AW083397 AU076442 BM908545 BG290444 
    AF136186 BG698306 CB120762 AI373447 AA641352 BG680544 AA128560 NM_000494 
    BE615162 BM674586 BM765978 BX117940 BG678664 BE615848 AA033913 BM675955 

    GeneLoc Exon Structure

    5/8 Alternative Splicing Database (ASD) splice patterns (SP) for COL17A1 (see all 8)    About this scheme

    ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15a · 15b ^ 16 ^ 17 ^ 18 ^ 19 ^ 20 ^ 21 ^ 22 ^ 23 ^ 24 ^ 25 ^
    SP1:                                                                                                                                                            
    SP2:                                                                                                                                                            
    SP3:                                                                                                                                                            
    SP4:                                                                                                                                                            
    SP5:                                                                                                                                                            

    ExUns: 26 ^ 27a · 27b ^ 28 ^ 29 ^ 30a · 30b ^ 31a · 31b · 31c ^ 32 ^ 33 ^ 34a · 34b ^ 35
    SP1:                                                                                          
    SP2:                                                                                          
    SP3:                                                                                          
    SP4:                                                                                          
    SP5:                                            -                                             


    ECgene alternative splicing isoforms for COL17A1

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    COL17A1 expression in normal human tissues (normalized intensities)      COL17A1 embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: GATATGTTAT
    COL17A1 Expression
    About this image


    COL17A1 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/26 selected tissues (see all 26) fully expand
     
     Epithelium
             Human Bronchial Epithelial Cells (HBEpiC)   
     
     Lung (Respiratory System)    fully expand to see all 7 entries
             Basal Cells Respiratory Bronchioles
             lung ; pneumocytes   
     
     Colon (Gastrointestinal Tract)    fully expand to see all 5 entries
             colon ; endothelial cells   
             colonic mucosal (ibs)   
     
     Uterus
             uterus, post-menopause ; glandular cells   
             cervix   
     
     Oral Cavity (Gastrointestinal Tract)    fully expand to see all 3 entries
             Human Oral Keritinocytes (HOK)   
             TONGUE   

    See COL17A1 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for COL17A1

    SOURCE GeneReport for Unigene clusters: Hs.117938 Hs.732773

    UniProtKB/Swiss-Prot: COHA1_HUMAN, Q9UMD9
    Tissue specificity: Stratified squamous epithelia. Found in hemidesmosomes. Expressed in cornea, oral mucosa,
    esophagus, intestine, kidney collecting ducts, ureter, bladder, urethra and thymus but is absent in lung, blood
    vessels, skeletal muscle and nerves

        SABiosciences Custom PCR Arrays for COL17A1
    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for COL17A1
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat COL17A1
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat COL17A1
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat COL17A1
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for COL17A1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for COL17A1 gene from 5/11 species (see all 11)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Col17a11 , 5 collagen, type XVII, alpha 11, 5 83.33(n)1
    83.62(a)1
      19 (40.07 cM)5
    128211  NM_007732.21  NP_031758.21 
     476463445 
    chicken
    (Gallus gallus)
    Aves COL17A11 collagen, type XVII, alpha 1 66.02(n)
    65.18(a)
      396503  XM_421744.3  XP_421744.3 
    lizard
    (Anolis carolinensis)
    Reptilia COL17A16
    Uncharacterized protein
    62(a)
    1 ↔ 1
    3(41416337-41482317)
    zebrafish
    (Danio rerio)
    Actinopterygii col17a1b1 collagen, type XVII, alpha 1b 54.86(n)
    51.01(a)
      568794  XM_692149.5  XP_697241.3 
    worm
    (Caenorhabditis elegans)
    Secernentea dpy-76
    col-1286
    (see all 4)
    Protein COL-128
    (see all 4)
    32(a)
    22(a)
    (see all 4)
    many ↔ many
    many ↔ many
    (see all 4)
    X(7536460-7537794)
    IV(11550001-11551960)


    ENSEMBL Gene Tree for COL17A1 (if available)
    TreeFam Gene Tree for COL17A1 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for COL17A1 gene
    COL28A12  COL6A12  COLEC122  COL6A52  COLQ2  COL6A62  COL6A22  SCARA32  
    COL6A32  
    8 SIMAP similar genes for COL17A1 using alignment to 4 protein entries:     COHA1_HUMAN (see all proteins):
    COL11A2    COL16A1    SFTPD    COL24A1    MSR1    C1QTNF9
    C1QTNF9B    COL1A1

    COL17A1 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/1621 SNPs in COL17A1 are shown (see all 1621)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 10 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0175984
    Generalized atrophic benign epidermolysis bullosa (GABEB)4--see VAR_0175982 G V mis40--------
    VAR_0175964
    Generalized atrophic benign epidermolysis bullosa (GABEB)4--see VAR_0175962 S C mis40--------
    VAR_0175994
    Generalized atrophic benign epidermolysis bullosa (GABEB)4--see VAR_0175992 G D mis40--------
    rs1219127711,2,4
    CGeneralized atrophic benign epidermolysis bullosa (GABEB)4 pathogenic1106155985(-) CAGGCA/GGGGCA 2 Q R mis10--------
    VAR_0175954
    ----see VAR_0175952 M T mis40--------
    rs1137868741,2
    C--99422684(+) GGCTC-/ATATTT 1 -- ut311Minor allele frequency- A:0.50CSA 2
    rs770802421,2
    C--105790768(+) TAATCA/TTCTTG 1 -- ds50010--------
    rs111919001,2
    C,F--105795600(+) TGTATG/CGGAGT 1 -- int12Minor allele frequency- C:0.50WA CSA 4
    rs111919011,2
    C--105795609(+) GTGTGC/TGTATG 1 -- int11Minor allele frequency- T:0.50CSA 2
    rs583303281,2
    C--105795621(+) AGTGTGTGTGTGGGAGTGTATGGGA
    GTGTGTGTATGGGAGTGT
    /-
    ATGGG
    1 -- int11Minor allele frequency- -:0.00NA 2

    HapMap Linkage Disequilibrium report for COL17A1 (105791044 - 105845760 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 9 variations for COL17A1:    About this table     
    Variant IDTypeSubtypePubMed ID
    esv2453005CNV Deletion19546169
    esv269373CNV Insertion20981092
    esv2556771CNV Insertion19546169
    nsv513017CNV Insertion21212237
    esv1639508CNV Insertion17803354
    esv1752212CNV Insertion17803354
    esv273538CNV Insertion20981092
    esv1658839CNV Insertion17803354
    nsv528782CNV Loss19592680


    Human Gene Mutation Database (HGMD): COL17A1
    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing COL17A1
    DNA2.0 Custom Variant and Variant Library Synthesis for COL17A1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 113811   
    OMIM disorders: 226650  
    UniProtKB/Swiss-Prot: COHA1_HUMAN, Q9UMD9
  • Generalized atrophic benign epidermolysis bullosa (GABEB) [MIM:226650]: A non-lethal, adult form of
    junctional epidermolysis bullosa characterized by life-long blistering of the skin, associated with hair and
    tooth abnormalities. Note=The disease is caused by mutations affecting the gene represented in this entry

  • 20/40 diseases for COL17A1 (see all 40):    About MalaCards
    pemphigoid gestationis    herpes gestationis    linear iga disease    lichen planus pemphigoides
    bullous skin disease    col17a1-related junctional epidermolysis bullosa    late-onset junctional epidermolysis bullosa    bullous pemphigoid
    mucous membrane pemphigoid    junctional epidermolysis bullosa    skin disease    epidermolysis bullosa acquisita
    epidermolysis bullosa simplex    dental enamel hypoplasia    paraneoplastic pemphigus    epidermolysis bullosa
    lichen sclerosus    amelogenesis imperfecta    cicatricial pemphigoid    lichen planus

    5 diseases from the University of Copenhagen DISEASES database for COL17A1:
    Bullous pemphigoid     Epidermolysis bullosa     Cicatricial pemphigoid     Herpes gestationis
    Lichen planus

    COL17A1 for disorders           About GeneDecksing


    Congresses - knowledge worth sharing:  
    Alzheimer's & Parkinson's Diseases Congress (ADPD) 18 - 22 March 2015

    10/27 Novoseek inferred disease relationships for COL17A1 gene (see all 27)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    gabeb 97.7 91 8629821 (6), 9077475 (5), 9521865 (4), 7883981 (4) (see all 30)
    pemphigoid bullous 97.7 318 9326393 (6), 12788530 (6), 12445194 (5), 11710917 (5) (see all 99)
    epidermolysis bullosa junctional 94.7 33 9284104 (2), 17263807 (2), 8618019 (2), 15377356 (2) (see all 26)
    herpes gestationis 92.3 15 8228259 (2), 8592065 (2), 10479533 (1), 8113038 (1) (see all 13)
    pemphigoid cicatricial 90.1 20 12788530 (7), 8752852 (2), 12399776 (1), 18637895 (1) (see all 12)
    skin diseases bullous 89 2 1748679 (1), 1512460 (1)
    epidermolysis bullosa 81.9 10 9804354 (3), 17657247 (2), 16252234 (1), 17476356 (1) (see all 5)
    epidermolysis bullosa acquisita 79.8 2 8752852 (1), 19515044 (1)
    skin diseases 78.3 25 9804354 (3), 18094948 (2), 7682575 (1), 9077469 (1) (see all 20)
    epidermolysis bullosa simplex 73.5 4 11851893 (1), 15377356 (1), 14626817 (1), 1686013 (1)

    GeneTests: COL17A1
    GeneReviews: COL17A1
    Genetic Association Database (GAD): COL17A1
    Human Genome Epidemiology (HuGE) Navigator: COL17A1 (5 documents)

    Export disorders for COL17A1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for COL17A1 gene, integrated from 9 sources (see all 296):
    (articles sorted by number of sources associating them with COL17A1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Cloning and primary structural analysis of the bullous pemphigoid autoantigen, BP180. (PubMed id 1324962)1, 2, 9 Giudice G.J.... Diaz L.A. (1992)
    2. A novel homozygous point mutation in the COL17A1 gene in a Chinese family with generalized atrophic benign epidermolysis bullosa. (PubMed id 11912005)1, 2, 9 Wu Y.... Zhu X. (2002)
    3. Genetic variation in COL17A1 and the development of bullous pemphigoid. (PubMed id 14987253)1, 4, 9 Winsey S....Wojnarowska F. (2004)
    4. Genomic organization of collagenous domains and chromosomal assignment of human 180-kDa bullous pemphigoid antigen-2, a novel collagen of stratified squamous epithelium. (PubMed id 1748679)1, 2, 9 Li K.H.... Uitto J. (1991)
    5. Cloning of the human type XVII collagen gene (COL17A1), and detection of novel mutations in generalized atrophic benign epidermolysis bullosa. (PubMed id 9012408)1, 2, 9 Gatalica B.... Uitto J. (1997)
    6. Single nucleotide polymorphisms associated with aggressive periodontitis and severe chronic periodontitis in Japanese. (PubMed id 15081423)1, 4, 9 Suzuki A....Kamoi K. (2004)
    7. Three novel homozygous point mutations and a new polymorphism in the COL17A1 gene: relation to biological and clinical phenotypes of junctional epidermolysis bullosa. (PubMed id 9199555)1, 2, 9 Schumann H.... Bruckner-Tuderman L. (1997)
    8. Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (PubMed id 21348951)1, 4 Parsa A....Liggett S.B. (2011)
    9. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PubMed id 20379614)1, 4 Rose J.E....Uhl G.R. (2010)
    10. Sequential use of transcriptional profiling, expressi on quantitative trait mapping, and gene association implicates MMP20 in human k idney aging. (PubMed id 19834535)1, 4 Wheeler H.E....Kim S.K. (2009)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 1308 HGNC: 2194 AceView: COL17A1 Ensembl:ENSG00000065618 euGenes: HUgn1308
    ECgene: COL17A1 Kegg: 1308 H-InvDB: COL17A1

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for COL17A1 Pharmacogenomics, SNPs, Pathways
    GeneReviewshttp://www.ncbi.nlm.nih.gov/sites/GeneTests/lab/gene/COL17A1

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for COL17A1 gene:
    Search GeneIP for patents involving COL17A1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for COL17A1  
     Browse OriGene qPCR primer pairs and template standards   OriGene Protein Over-expression Lysate for COL17A1  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for COL17A1  
     OriGene qSTAR qPCR primer pairs in human, mouse for COL17A1   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for COL17A1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for COL17A1   OriGene Custom Protein Services for COL17A1  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat COL17A1
     QIAGEN SeqTarget long-range PCR primers for resequencing COL17A1
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat COL17A1
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat COL17A1
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat COL17A1
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat COL17A1
     GenScript Custom Purified and Recombinant Proteins Services for COL17A1 GenScript cDNA clones with any tag delivered in your preferred vector for COL17A1
     GenScript Custom Assay Services for COL17A1 GenScript Custom Superior Antibodies Services for COL17A1
     GenScript Custom overexpressing Cell Line Services for COL17A1 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in COL17A1 promoter
     Search Chromatin IP Primers for COL17A1
     RT2 qPCR Primer Assay in human, mouse, rat COL17A1
     GNC Network for COL17A1
     SABiosciences PCR Arrays including human, mouse, rat COL17A1
     Search Tocris compounds for COL17A1 (COHA1)
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     COL17A1 antibodies
     COL17A1 lysates
     Antibodies for COL17A1
     See all of Abcam's Antibodies, Kits and Proteins for COL17A1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Browse Proteins at Cloud-Clone Corp.
     Browse Antibodies at Cloud-Clone Corp.
     Browse ELISAs at Cloud-Clone Corp.
     Browse CLIAs at Cloud-Clone Corp.
     Search LifeMap BioReagents cell lines for COL17A1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for COL17A1
     SwitchGear 3'UTR luciferase reporter plasmids for COL17A1
     SwitchGear Promoter luciferase reporter plasmids for COL17A1
     ThermoFisher Antibody for COL17A1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat COL17A1
     inGenious Targeting Laboratory - Custom generated mouse model solutions for COL17A1
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for COL17A1
    Customized:
     lentivirus for stable overexpression of COL17A1
     lentivirus expression plasmids for stable overexpression of COL17A1
     adenovirus for overexpression of COL17A1
     LSBio Antibodies in human, mouse, rat for COL17A1
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      COL17A1 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4