Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



COL17A1 Gene

protein-coding   GIFtS: 63
GCID: GC10M105781

Collagen, Type XVII, Alpha 1


(Previous symbol: BPAG2)
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Collagen, Type XVII, Alpha 11 2     Alpha 1 Type XVII Collagen2
BPAG21 2 3 5     BA16H23.2 (Collagen, Type XVII, Alpha 1 (BP180))2
180 KDa Bullous Pemphigoid Antigen 22 3     Bullous Pemphigoid Antigen 2 (180kD)2
BP1802 3     Collagen Alpha-1(XVII) Chain2
BA16H23.22     Collagen XVII, Alpha-1 Polypeptide2
BPA-22     Type XVII Collagen Alpha-12
LAD-12     Bullous Pemphigoid Antigen 23

External Ids:    HGNC: 21941   Entrez Gene: 13082   Ensembl: ENSG000000656187   OMIM: 1138115   UniProtKB: Q9UMD93   

Export aliases for COL17A1 gene to outside databases

Previous GC identifers: GC10M104684 GC10M105024 GC10M105922 GC10M105455 GC10M099422


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for COL17A1 Gene:
This gene encodes the alpha chain of type XVII collagen. Unlike most collagens, collagen XVII is a transmembrane
protein. Collagen XVII is a structural component of hemidesmosomes, multiprotein complexes at the
dermal-epidermal basement membrane zone that mediate adhesion of keratinocytes to the underlying membrane.
Mutations in this gene are associated with both generalized atrophic benign and junctional epidermolysis bullosa.
Two homotrimeric forms of type XVII collagen exist. The full length form is the transmembrane protein. A soluble
form, referred to as either ectodomain or LAD-1, is generated by proteolytic processing of the full length form.
(provided by RefSeq, Jul 2008)

GeneCards Summary for COL17A1 Gene:
COL17A1 (collagen, type XVII, alpha 1) is a protein-coding gene. Diseases associated with COL17A1 include col17a1-related junctional epidermolysis bullosa, and bullous skin disease. An important paralog of this gene is COL28A1.

UniProtKB/Swiss-Prot: COHA1_HUMAN, Q9UMD9
Function: May play a role in the integrity of hemidesmosome and the attachment of basal keratinocytes to the
underlying basement membrane
Function: The 120 kDa linear IgA disease antigen is an anchoring filament component involved in dermal-epidermal
cohesion. Is the target of linear IgA bullous dermatosis autoantibodies

Gene Wiki entry for COL17A1 (Collagen, type XVII, alpha 1) Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000010.11  NC_018921.2  NT_030059.14  
Regulatory elements:
   Regulatory transcription factor binding sites in the COL17A1 gene promoter:
         Oct-B1   oct-B2   Pbx1a   AML1a   Nkx2-5   Gfi-1   HEN1   E2F-1   E2F   LyF-1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidCOL17A1 promoter sequence
   Search Chromatin IP Primers for COL17A1

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat COL17A1


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 10q24.3   Ensembl cytogenetic band:  10q25.1   HGNC cytogenetic band: 10q24.3

COL17A1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
COL17A1 gene location

GeneLoc information about chromosome 10         GeneLoc Exon Structure

GeneLoc location for GC10M105781:  view genomic region     (about GC identifiers)

Start:
105,791,044 bp from pter      End:
105,845,760 bp from pter
Size:
54,717 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: COHA1_HUMAN, Q9UMD9 (See protein sequence)
Recommended Name: Collagen alpha-1(XVII) chain  
Size: 1497 amino acids; 150419 Da
Subunit: Homotrimers of alpha 1(XVII)chains. Interacts (via cytoplasmic region) with ITGB4 (via cytoplasmic
region). Interacts (via cytoplasmic region) with DST isoform 3 (via N-terminus). Interacts (via N-terminus) with
PLEC. Interacts (via cytoplasmic region) with DSP
Miscellaneous: Both the 120 kDa linear IgA disease antigen and the 97 kDa linear IgA disease antigen of COL17A1,
represent major antigenic targets of autoantibodies in patients with linear IgA disease (LAD). LAD is a
subepidermal blistering disorder characterized by tissue-bound and circulating IgA autoantibodies to the
dermal-epidermal junction. These IgA autoantibodies preferentially react with 97 and the 120 kDa forms, but not
with the full-length COL17A1, suggesting that the cleavage of the ectodomain generates novel autoantigenic
epitopes
Sequence caution: Sequence=AAA35605.1; Type=Erroneous initiation; Note=Translation N-terminally shortened;
Sequence=AAH04478.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence;
Secondary accessions: Q02802 Q5JV36 Q99018 Q9NQK9 Q9UC14
Alternative splicing: 2 isoforms:  Q9UMD9-1   Q9UMD9-2   (Gene prediction based on EST data)

Explore the universe of human proteins at neXtProt for COL17A1: NX_Q9UMD9

Explore proteomics data for COL17A1 at MOPED

Post-translational modifications: 

  • The intracellular/endo domain is disulfide-linked1
  • Prolines at the third position of the tripeptide repeating unit (G-X-Y) are hydroxylated in some or all of the
    chains1
  • The ectodomain is shedded from the surface of keratinocytes resulting in a 120-kDa soluble form, also named as 120
    kDa linear IgA disease antigen. The shedding is mediated by membrane-bound metalloproteases. This cleavage is
    inhibited by phosophorylation at Ser-5441
  • Glycosylation2 at Thr1284, Asn1421
  • Modification sites at PhosphoSitePlus

  • See COL17A1 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins: NP_000485.3  
    ENSEMBL proteins: 
     ENSP00000340937   ENSP00000358748   ENSP00000388832   ENSP00000376905  
    Reactome Protein details: Q9UMD9

    COL17A1 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for COL17A1
    OriGene Custom MassSpec
    OriGene Custom Protein Services for COL17A1
    GenScript Custom Purified and Recombinant Proteins Services for COL17A1
    Novus Biologicals COL17A1 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Browse Proteins at Cloud-Clone Corp.

    COL17A1 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for COL17A1
    Novus Biologicals COL17A1 Antibody
    Abcam antibodies for COL17A1
    Browse Antibodies at Cloud-Clone Corp.
    ThermoFisher Antibody for COL17A1
    LSBio Antibodies in human, mouse, rat for COL17A1

    COL17A1 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for COL17A1
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for COL17A1
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs at Cloud-Clone Corp.
    Browse CLIAs at Cloud-Clone Corp.


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    HGNC Gene Families:
    COLLAGEN: Collagens

    1 InterPro protein domain:
     IPR008160 Collagen

    Graphical View of Domain Structure for InterPro Entry Q9UMD9

    ProtoNet protein and cluster: Q9UMD9

    2 Blocks protein domains:
    IPB008160 Collagen triple helix repeat
    IPB008161 Collagen helix repeat



    COL17A1 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: COHA1_HUMAN, Q9UMD9
    Function: May play a role in the integrity of hemidesmosome and the attachment of basal keratinocytes to the
    underlying basement membrane
    Function: The 120 kDa linear IgA disease antigen is an anchoring filament component involved in dermal-epidermal
    cohesion. Is the target of linear IgA bullous dermatosis autoantibodies

         Genatlas biochemistry entry for COL17A1:
    collagen type XVII,alpha 1,plasma membrane of keratinocytes

         Gene Ontology (GO): 1 molecular function term:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005515protein binding IPI12482924
         
    COL17A1 for ontologies           About GeneDecksing


    Phenotypes:
         2 GenomeRNAi human phenotypes for COL17A1:
     High actin ratio cells  Increased gamma-H2AX phosphory 

         5 MGI mutant phenotypes (inferred from 1 allele(MGI details for Col17a1):
     growth/size/body  immune system  integument  mortality/aging  reproductive system 

    COL17A1 for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-out Col17a1tm1Shzu for COL17A1

       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for COL17A1
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for COL17A1

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for COL17A1
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for COL17A1

    miRNA
    Products:
        
    miRTarBase miRNAs that target COL17A1:
    hsa-mir-124-3p (MIRT022276)

    Block miRNA regulation of human, mouse, rat COL17A1 using miScript Target Protectors
    8 qRT-PCR Assays for microRNAs that regulate COL17A1:
    hsa-miR-411* hsa-miR-203 hsa-miR-548am hsa-miR-379* hsa-miR-4287 hsa-miR-548t hsa-miR-548x hsa-miR-384
    SwitchGear 3'UTR luciferase reporter plasmidCOL17A1 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for COL17A1
    Predesigned siRNA for gene silencing in human, mouse, rat COL17A1

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for COL17A1

    Clone
    Products:
         
    OriGene clones in human, mouse for COL17A1 (see all 6)
    OriGene ORF clones in mouse, rat for COL17A1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: COL17A1 (NM_000494)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for COL17A1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat COL17A1

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for COL17A1
    Browse ESI BIO Cell Lines and PureStem Progenitors for COL17A1 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for COL17A1


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    COHA1_HUMAN, Q9UMD9: Cell junction, hemidesmosome. Membrane; Single-pass type II membrane protein. Note=Localized
    along the plasma membrane of the hemidesmosome
    COHA1_HUMAN, Q9UMD9: 120 kDa linear IgA disease antigen: Secreted, extracellular space, extracellular matrix,
    basement membrane. Note=Exclusively localized to anchoring filaments. Localized to the epidermal side of split
    skin
    COHA1_HUMAN, Q9UMD9: 97 kDa linear IgA disease antigen: Secreted, extracellular space, extracellular matrix,
    basement membrane. Note=Localized in the lamina lucida beneath the hemidesmosomes
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    extracellular5
    endoplasmic reticulum4
    plasma membrane4
    cytosol2
    nucleus2
    cytoskeleton1
    mitochondrion1
    peroxisome1

    Gene Ontology (GO): Selected cellular component terms (see all 8):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005576extracellular region TAS--
    GO:0005581collagen IEA--
    GO:0005604basement membrane IEA--
    GO:0005788endoplasmic reticulum lumen TAS--
    GO:0005886plasma membrane TAS--

    COL17A1 for ontologies           About GeneDecksing


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for COL17A1 About   (see all 9)  
    See pathways by source

    SuperPathContained pathways About
    1Collagen biosynthesis and modifying enzymes
    Collagen biosynthesis and modifying enzymes0.75
    Intrinsic Prothrombin Activation Pathway0.39
    Collagen formation0.75
    Blood Coagulation Cascade0.38
    2Alpha6-Beta4 Integrin Signaling Pathway
    Alpha6-Beta4 Integrin Signaling Pathway
    Type I hemidesmosome assembly0.00
    3Integrin Pathway
    FAK1 Signaling0.67
    UPA-UPAR Pathway0.56
    Integrin Pathway0.67
    Inhibition of Angiogenesis by TSP10.50
    GnRH Signaling0.56
    Transendothelial Migration of Leukocytes0.38
    4ERK Signaling
    Rho Family GTPases0.61
    Molecular Mechanisms of Cancer0.51
    ERK Signaling0.61
    ILK Signaling0.49
    MAPK Signaling0.58
    5Degradation of the extracellular matrix
    Degradation of the extracellular matrix0.43
    Extracellular matrix organization0.34
    Collagen degradation0.43

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    Selected Downloadable PowerPoint Slides of GeneGlobe Pathway Central Maps for COL17A1 (see all 15)
        MAPK Signaling
    Molecular Mechanisms of Cancer
    PTEN Pathway
    Transendothelial Migration of Leukocytes
    UPA-UPAR Pathway

    2 BioSystems Pathways for COL17A1
        Alpha6-Beta4 Integrin Signaling Pathway
    a6b1 and a6b4 Integrin signaling

    4 Reactome Pathways for COL17A1
        Collagen biosynthesis and modifying enzymes
    Type I hemidesmosome assembly
    Assembly of collagen fibrils and other multimeric structures
    Collagen degradation


    1 Kegg Pathway  (Kegg details for COL17A1):
        Protein digestion and absorption


    COL17A1 for pathways           About GeneDecksing

        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for COL17A1
    Interactions:

        GeneGlobe Interaction Network for COL17A1

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    Selected Interacting proteins for COL17A1 (Q9UMD93 ENSP000003409374) via UniProtKB, MINT, STRING, and/or I2D (see all 57)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    ACTN4O437073, ENSP000002526994I2D: score=2 STRING: ENSP00000252699
    CTNND1O607163, ENSP000003820044I2D: score=2 STRING: ENSP00000382004
    ITGB4P161443, ENSP000002001814I2D: score=2 STRING: ENSP00000200181
    KRT18P057833, ENSP000003734874I2D: score=2 STRING: ENSP00000373487
    LAD1O005153, ENSP000003758294I2D: score=1 STRING: ENSP00000375829
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0007160cell-matrix adhesion TAS9012408
    GO:0008544epidermis development TAS9012408
    GO:0022617extracellular matrix disassembly TAS--
    GO:0030198extracellular matrix organization TAS--
    GO:0030574collagen catabolic process TAS--

    COL17A1 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for COL17A1 (COHA1)

    Selected Novoseek inferred chemical compound relationships for COL17A1 gene (see all 11)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    batimastat 42.3 2 11710917 (1), 11978564 (1)
    calcium 1.28 2 16906396 (2)
    nacl 0 1 9242508 (1)
    phenylalanine 0 1 9087447 (1)
    sucrose 0 1 8662839 (1)
    steroid 0 3 8689764 (2), 17596158 (1)
    tyrosine 0 2 9087447 (1), 9660880 (1)
    gold 0 1 7682575 (1)
    proline 0 2 10022517 (1), 1846881 (1)
    serine 0 1 11912005 (1)



    COL17A1 for compounds           About GeneDecksing



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for COL17A1 gene (2 alternative transcripts): 
    NM_000494.3  NM_130778.1  

    Unigene Cluster for COL17A1:

    Collagen, type XVII, alpha 1
    Hs.117938  [show with all ESTs]
    Unigene Representative Sequence: NM_000494
    7 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000353479(uc001kxr.3) ENST00000369733(uc010qqv.1 uc009xxp.1)
    ENST00000433822(uc001kxq.3) ENST00000480127 ENST00000393211 ENST00000488320
    ENST00000483876
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat COL17A1 using miScript Target Protectors
    8 qRT-PCR Assays for microRNAs that regulate COL17A1:
    hsa-miR-411* hsa-miR-203 hsa-miR-548am hsa-miR-379* hsa-miR-4287 hsa-miR-548t hsa-miR-548x hsa-miR-384
    SwitchGear 3'UTR luciferase reporter plasmidCOL17A1 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for COL17A1
    Predesigned siRNA for gene silencing in human, mouse, rat COL17A1
    Clone
    Products:
         
    OriGene clones in human, mouse for COL17A1 (see all 6)
    OriGene ORF clones in mouse, rat for COL17A1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: COL17A1 (NM_000494)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for COL17A1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat COL17A1
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for COL17A1
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat COL17A1
      QuantiTect SYBR Green Assays in human, mouse, rat COL17A1
      QuantiFast Probe-based Assays in human, mouse, rat COL17A1

    Additional mRNA sequence: 

    AF136185.1 AK309940.1 BC004478.2 M63730.1 M91669.1 

    17 DOTS entries:

    DT.441052  DT.100780356  DT.121269578  DT.86846102  DT.95197672  DT.102310  DT.100780362  DT.121634602 
    DT.91887089  DT.91921785  DT.92001624  DT.92008549  DT.95197679  DT.121269571  DT.121269576  DT.121643178 
    DT.91813165 

    Selected AceView cDNA sequences (see all 279):

    BM908545 BG290444 CB120762 AA641352 BM837978 AI637697 AW083397 AF136185 
    BE563325 BG698306 AU076442 BG680544 AF136186 AI373447 BG676959 AW573197 
    AA034033 C00407 BM839106 T29336 BM772041 BE713835 BE713694 BV205093 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for COL17A1 (see all 8)    About this scheme

    ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15a · 15b ^ 16 ^ 17 ^ 18 ^ 19 ^ 20 ^ 21 ^ 22 ^ 23 ^ 24 ^ 25 ^
    SP1:                                                                                                                                                            
    SP2:                                                                                                                                                            
    SP3:                                                                                                                                                            
    SP4:                                                                                                                                                            
    SP5:                                                                                                                                                            

    ExUns: 26 ^ 27a · 27b ^ 28 ^ 29 ^ 30a · 30b ^ 31a · 31b · 31c ^ 32 ^ 33 ^ 34a · 34b ^ 35
    SP1:                                                                                          
    SP2:                                                                                          
    SP3:                                                                                          
    SP4:                                                                                          
    SP5:                                            -                                             


    ECgene alternative splicing isoforms for COL17A1

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    COL17A1 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: GATATGTTAT
    COL17A1 Expression
    About this image


    COL17A1 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 3) fully expand
     
     Lung (Respiratory System)    fully expand to see all 2 entries
             Basal Cells Respiratory Bronchioles
     
     Hair (Integumentary System)
             Bulge Stem Cells Bulge
     
     Bone (Muscoskeletal System)
             Zeugopod Epiphyseal End
    COL17A1 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    COL17A1 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.117938

    UniProtKB/Swiss-Prot: COHA1_HUMAN, Q9UMD9
    Tissue specificity: Stratified squamous epithelia. Found in hemidesmosomes. Expressed in cornea, oral mucosa,
    esophagus, intestine, kidney collecting ducts, ureter, bladder, urethra and thymus but is absent in lung, blood
    vessels, skeletal muscle and nerves

        Custom PCR Arrays for COL17A1
    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for COL17A1
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat COL17A1
    QuantiTect SYBR Green Assays in human, mouse, rat COL17A1
    QuantiFast Probe-based Assays in human, mouse, rat COL17A1
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for COL17A1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of animals.

    Orthologs for COL17A1 gene from Selected species (see all 10)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Col17a15 collagen, type XVII, alpha 1   --   19 (40.07 cM) 47646344 
    chicken
    (Gallus gallus)
    Aves COL17A16
    Collagen alpha-1(XVII) chain 120 kDa linear IgA di...
    63(a)
    1 ↔ 1
    6(23670969-23706526)
    lizard
    (Anolis carolinensis)
    Reptilia COL17A16
    collagen, type XVII, alpha 1
    63(a)
    1 ↔ 1
    3(41416337-41482317)
    zebrafish
    (Danio rerio)
    Actinopterygii col17a1b6
    col17a1a6
    collagen, type XVII, alpha 1a
    43(a)
    43(a)
    many → 1
    many → 1
    13(24976134-25004032) ENSDARG00000079011
    1(50074734-50112253) ENSDARG00000069415
    worm
    (Caenorhabditis elegans)
    Secernentea col-896
    col-1186
    (see all 14)
    Protein COL-89 (col-89) mRNA, complete cds
    Protein COL-118, isoform a (col-118) mRNA, complet...
    (see all 14)
    39(a)
    37(a)
    (see all 14)
    many ↔ many
    many ↔ many
    (see all 14)
    III(4748180-4749156) WBGene00000664
    IV(8848182-8849676) WBGene00000692


    ENSEMBL Gene Tree for COL17A1 (if available)
    TreeFam Gene Tree for COL17A1 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for COL17A1 gene
    COL28A12  COL6A12  COLEC122  COL6A52  COLQ2  COL6A62  COL6A22  SCARA32  
    COL6A32  
    8 SIMAP similar genes for COL17A1 using alignment to 4 protein entries:     COHA1_HUMAN (see all proteins):
    COL11A2    COL16A1    SFTPD    COL24A1    MSR1    C1QTNF9
    C1QTNF9B    COL1A1

    COL17A1 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for COL17A1 (see all 1621)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 10 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1219127711,2,,4
    CGeneralized atrophic benign epidermolysis bullosa (GABEB)4 pathogenic1106155985(-) CAGGCA/GGGGCA 2 Q R mis10--------
    VAR_0175984
    Generalized atrophic benign epidermolysis bullosa (GABEB)4--see VAR_0175982 G V mis40--------
    VAR_0175964
    Generalized atrophic benign epidermolysis bullosa (GABEB)4--see VAR_0175962 S C mis40--------
    VAR_0175994
    Generalized atrophic benign epidermolysis bullosa (GABEB)4--see VAR_0175992 G D mis40--------
    rs1137868741,2
    C--99422684(+) GGCTC-/ATATTT 1 -- ut311Minor allele frequency- A:0.50CSA 2
    rs770802421,2
    C--105790768(+) TAATCA/TTCTTG 1 -- ds50010--------
    rs111919001,2
    C,F--105795600(+) TGTATG/CGGAGT 1 -- int12Minor allele frequency- C:0.50WA CSA 4
    rs111919011,2
    C--105795609(+) GTGTGC/TGTATG 1 -- int11Minor allele frequency- T:0.50CSA 2
    rs583303281,2
    C--105795621(+) AGTGTGTGTGTGGGAGTGTATGGGA
    GTGTGTGTATGGGAGTGT
    /-
    ATGGG
    1 -- int11Minor allele frequency- -:0.00NA 2
    rs741996021,2
    C--105795645(-) ACACTACAC/-  
            
    TCCAG
    1 -- int11Minor allele frequency- -:0.00NA 2

    HapMap Linkage Disequilibrium report for COL17A1 (105791044 - 105845760 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 9 variations for COL17A1:    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2453005CNV Deletion19546169
    esv269373CNV Insertion20981092
    esv2556771CNV Insertion19546169
    nsv513017CNV Insertion21212237
    esv1639508CNV Insertion17803354
    esv1752212CNV Insertion17803354
    esv273538CNV Insertion20981092
    esv1658839CNV Insertion17803354
    nsv528782CNV Loss19592680

    Human Gene Mutation Database (HGMD): COL17A1
    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing COL17A1
    DNA2.0 Custom Variant and Variant Library Synthesis for COL17A1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 113811   
    OMIM disorders: 226650  
    UniProtKB/Swiss-Prot: COHA1_HUMAN, Q9UMD9
  • Generalized atrophic benign epidermolysis bullosa (GABEB) [MIM:226650]: A non-lethal, adult form of
    junctional epidermolysis bullosa characterized by life-long blistering of the skin, associated with hair and
    tooth abnormalities. Note=The disease is caused by mutations affecting the gene represented in this entry

  • Selected diseases for COL17A1 (see all 47):    
    About MalaCards
    col17a1-related junctional epidermolysis bullosa    bullous skin disease    late-onset junctional epidermolysis bullosa    pemphigoid gestationis
    herpes gestationis    lichen planus pemphigoides    junctional epidermolysis bullosa    mucous membrane pemphigoid
    linear iga disease    skin disease    bullous pemphigoid    epidermolysis bullosa acquisita
    junctional epidermolysis bullosa, non-herlitz type    dental enamel hypoplasia    epidermolysis bullosa simplex    paraneoplastic pemphigus
    lichen planus    epidermolysis bullosa    lichen sclerosus    amelogenesis imperfecta

    5 diseases from the University of Copenhagen DISEASES database for COL17A1:
    Bullous pemphigoid     Epidermolysis bullosa     Cicatricial pemphigoid     Herpes gestationis
    Lichen planus

    COL17A1 for disorders           About GeneDecksing

    Selected Novoseek inferred disease relationships for COL17A1 gene (see all 27)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    gabeb 97.7 91 8629821 (6), 9077475 (5), 9521865 (4), 7883981 (4) (see all 30)
    pemphigoid bullous 97.7 318 9326393 (6), 12788530 (6), 12445194 (5), 11710917 (5) (see all 99)
    epidermolysis bullosa junctional 94.7 33 9284104 (2), 17263807 (2), 8618019 (2), 15377356 (2) (see all 26)
    herpes gestationis 92.3 15 8228259 (2), 8592065 (2), 10479533 (1), 8113038 (1) (see all 13)
    pemphigoid cicatricial 90.1 20 12788530 (7), 8752852 (2), 12399776 (1), 18637895 (1) (see all 12)
    skin diseases bullous 89 2 1748679 (1), 1512460 (1)
    epidermolysis bullosa 81.9 10 9804354 (3), 17657247 (2), 16252234 (1), 17476356 (1) (see all 5)
    epidermolysis bullosa acquisita 79.8 2 8752852 (1), 19515044 (1)
    skin diseases 78.3 25 9804354 (3), 18094948 (2), 7682575 (1), 9077469 (1) (see all 20)
    epidermolysis bullosa simplex 73.5 4 11851893 (1), 15377356 (1), 14626817 (1), 1686013 (1)

    GeneTests: COL17A1
    GeneReviews: COL17A1
    Genetic Association Database (GAD): COL17A1
    Human Genome Epidemiology (HuGE) Navigator: COL17A1 (5 documents)

    Export disorders for COL17A1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for COL17A1 gene, integrated from 10 sources (see all 296):
    (articles sorted by number of sources associating them with COL17A1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Cloning and primary structural analysis of the bullous pemphigoid autoantigen, BP180. (PubMed id 1324962)1, 2, 9 Giudice G.J.... Diaz L.A. (J. Invest. Dermatol. 1992)
    2. A novel homozygous point mutation in the COL17A1 gene in a Chinese family with generalized atrophic benign epidermolysis bullosa. (PubMed id 11912005)1, 2, 9 Wu Y.... Zhu X. (J. Dermatol. Sci. 2002)
    3. Genetic variation in COL17A1 and the development of bullous pemphigoid. (PubMed id 14987253)1, 4, 9 Winsey S....Wojnarowska F. (Exp. Dermatol. 2004)
    4. Genomic organization of collagenous domains and chromosomal assignment of human 180-kDa bullous pemphigoid antigen-2, a novel collagen of stratified squamous epithelium. (PubMed id 1748679)1, 2, 9 Li K.H.... Uitto J. (J. Biol. Chem. 1991)
    5. Cloning of the human type XVII collagen gene (COL17A1), and detection of novel mutations in generalized atrophic benign epidermolysis bullosa. (PubMed id 9012408)1, 2, 9 Gatalica B.... Uitto J. (Am. J. Hum. Genet. 1997)
    6. Single nucleotide polymorphisms associated with aggressive periodontitis and severe chronic periodontitis in Japanese. (PubMed id 15081423)1, 4, 9 Suzuki A....Kamoi K. (Biochem. Biophys. Res. Commun. 2004)
    7. Three novel homozygous point mutations and a new polymorphism in the COL17A1 gene: relation to biological and clinical phenotypes of junctional epidermolysis bullosa. (PubMed id 9199555)1, 2, 9 Schumann H.... Bruckner-Tuderman L. (Am. J. Hum. Genet. 1997)
    8. Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (PubMed id 21348951)1, 4 Parsa A....Liggett S.B. (Clin Transl Sci 2011)
    9. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PubMed id 20379614)1, 4 Rose J.E....Uhl G.R. (Mol. Med. 2010)
    10. Sequential use of transcriptional profiling, expression quantitative trait mapping, and gene association implicates MMP20 in human kidney aging. (PubMed id 19834535)1, 4 Wheeler H.E....Kim S.K. (PLoS Genet. 2009)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 1308 HGNC: 2194 AceView: COL17A1 Ensembl:ENSG00000065618 euGenes: HUgn1308
    ECgene: COL17A1 Kegg: 1308 H-InvDB: COL17A1

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for COL17A1 Pharmacogenomics, SNPs, Pathways
    GeneReviewshttp://www.ncbi.nlm.nih.gov/books/NBK1116/?term=COL17A1[genesymbol]

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for COL17A1 gene:
    Search GeneIP for patents involving COL17A1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for COL17A1  
     Browse OriGene qPCR primer pairs and template standards   OriGene Protein Over-expression Lysate for COL17A1  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for COL17A1  
     OriGene qSTAR qPCR primer pairs in human, mouse for COL17A1   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for COL17A1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for COL17A1   OriGene Custom Protein Services for COL17A1  

     
     
     Block miRNA regulation of human, mouse, rat COL17A1 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing COL17A1
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat COL17A1 Predesigned siRNA for gene silencing in human, mouse, rat COL17A1
     QuantiFast Probe-based Assays in human, mouse, rat COL17A1 QuantiTect SYBR Green Assays in human, mouse, rat COL17A1
     Custom PCR Arrays for COL17A1 Search Chromatin IP Primers for COL17A1
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat COL17A1  GeneGlobe Interaction Network for COL17A1
     Regulatory tfbs in COL17A1 promoter
     GenScript Custom Purified and Recombinant Proteins Services for COL17A1 GenScript cDNA clones with any tag delivered in your preferred vector for COL17A1
     GenScript Custom Assay Services for COL17A1 GenScript Custom overexpressing Cell Line Services for COL17A1
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for COL17A1 (COHA1)
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     COL17A1 antibodies
     COL17A1 lysates
     Antibodies for COL17A1
     See all of Abcam's Antibodies, Kits and Proteins for COL17A1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Browse Proteins at Cloud-Clone Corp.
     Browse Antibodies at Cloud-Clone Corp.
     Browse ELISAs at Cloud-Clone Corp.
     Browse CLIAs at Cloud-Clone Corp.



     Browse ESI BIO Cell Lines and PureStem Progenitors for COL17A1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for COL17A1
     SwitchGear 3'UTR luciferase reporter plasmids for COL17A1
     SwitchGear Promoter luciferase reporter plasmids for COL17A1
     ThermoFisher Antibody for COL17A1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat COL17A1
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for COL17A1
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for COL17A1
     LSBio Antibodies in human, mouse, rat for COL17A1
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      COL17A1 gene at Home site.
    Version: 3.12.164 25 Aug 2014
    hostname: 356980-web2.xennexinc.com index build: 126 solr: 1.4