Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CNEP1R1 Gene

Aliases for CNEP1R1 Gene

  • CTD Nuclear Envelope Phosphatase 1 Regulatory Subunit 1 2 3 5
  • Transmembrane Protein 188 2 3 4
  • Nuclear Envelope Phosphatase 1-Regulatory Subunit 1 2 3
  • C16orf69 3 4
  • TMEM188 3 4
  • NEP1-R1 3 4
  • Nuclear Envelope Phosphatase-Regulatory Subunit 1 3
  • Chromosome 16 Open Reading Frame 69 2
  • NEP1R1 3
  • TMP125 3

External Ids for CNEP1R1 Gene

Previous HGNC Symbols for CNEP1R1 Gene

  • C16orf69
  • TMEM188

Previous GeneCards Identifiers for CNEP1R1 Gene

  • GC16P050058

Summaries for CNEP1R1 Gene

Entrez Gene Summary for CNEP1R1 Gene

  • This gene encodes a transmembrane protein that belongs to the Tmemb_18A family. A similar protein in yeast is a component of an endoplasmic reticulum-associated protein phosphatase complex and is thought to play a role in the synthesis of triacylglycerol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

GeneCards Summary for CNEP1R1 Gene

CNEP1R1 (CTD Nuclear Envelope Phosphatase 1 Regulatory Subunit 1) is a Protein Coding gene. Among its related pathways are Mitotic Prophase and Transport of the SLBP independent Mature mRNA.

UniProtKB/Swiss-Prot for CNEP1R1 Gene

  • Forms with the serine/threonine protein phosphatase CTDNEP1 an active complex which dephosphorylates and may activate LPIN1 and LPIN2. LPIN1 and LPIN2 are phosphatidate phosphatases that catalyze the conversion of phosphatidic acid to diacylglycerol and control the metabolism of fatty acids at different levels. May indirectly modulate the lipid composition of nuclear and/or endoplasmic reticulum membranes and be required for proper nuclear membrane morphology and/or dynamics. May also indirectly regulate the production of lipid droplets and triacylglycerol.

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CNEP1R1 Gene

Genomics for CNEP1R1 Gene

Regulatory Elements for CNEP1R1 Gene

Enhancers for CNEP1R1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH16G050264 1.7 FANTOM5 ENCODE dbSUPER 11.8 +242.3 242281 5.8 HDGF PKNOX1 FOXA2 MLX ARNT AGO1 ARID4B DMAP1 ZNF766 ZNF143 CNEP1R1 BRD7 PAPD5 NKD1 CYLD ADCY7 GC16P050268
GH16G050201 1.2 Ensembl ENCODE 11.3 +179.2 179172 4.1 PKNOX1 FOXA2 MLX ARID4B FOS SP5 MXD4 KAT8 ZNF585B RFX3 HEATR3 PAPD5 ENSG00000252526 CNEP1R1 BRD7 GC16M050159 ADCY7
GH16G050207 1.2 Ensembl ENCODE 11.3 +184.8 184832 3.6 ELF3 PKNOX1 WRNIP1 ARID4B FEZF1 ZNF48 ZBTB40 RAD21 YY1 ZNF121 HEATR3 PAPD5 ENSG00000252526 CNEP1R1 BRD7 GC16M050159 ADCY7
GH16G050151 1.1 ENCODE 10.7 +129.7 129674 4.6 HDGF PKNOX1 FOXA2 ZFP64 ARID4B SIN3A FEZF1 DMAP1 ZNF2 YY1 HEATR3 CNEP1R1 BRD7 LOC101927250 GC16M050159
GH16G050372 1 Ensembl ENCODE 10 +348.7 348690 1.7 CTCF TFAP4 MXI1 FOXA2 SAP130 ARID4B ZIC2 HBP1 RAD21 RARA CNEP1R1 ENSG00000205414 BRD7 LINC02178
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around CNEP1R1 on UCSC Golden Path with GeneCards custom track

Promoters for CNEP1R1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000085720 1190 1601 FOXA2 MLX CREB3L1 ARNT WRNIP1 ARID4B SIN3A DMAP1 ZBTB7B YY1

Genomic Location for CNEP1R1 Gene

Chromosome:
16
Start:
50,024,410 bp from pter
End:
50,037,088 bp from pter
Size:
12,679 bases
Orientation:
Plus strand

Genomic View for CNEP1R1 Gene

Genes around CNEP1R1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CNEP1R1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CNEP1R1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CNEP1R1 Gene

Proteins for CNEP1R1 Gene

  • Protein details for CNEP1R1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q8N9A8-NEPR1_HUMAN
    Recommended name:
    Nuclear envelope phosphatase-regulatory subunit 1
    Protein Accession:
    Q8N9A8
    Secondary Accessions:
    • Q4G1A9
    • Q5H9V0
    • Q8NE06

    Protein attributes for CNEP1R1 Gene

    Size:
    125 amino acids
    Molecular mass:
    14267 Da
    Quaternary structure:
    • Interacts with CTDNEP1; the complex dephosphorylates LPIN1 and LPIN2.

    Alternative splice isoforms for CNEP1R1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for CNEP1R1 Gene

Post-translational modifications for CNEP1R1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for CNEP1R1 Gene

Domains & Families for CNEP1R1 Gene

Protein Domains for CNEP1R1 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for CNEP1R1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q8N9A8

UniProtKB/Swiss-Prot:

NEPR1_HUMAN :
  • Belongs to the CNEP1R1 family.
Family:
  • Belongs to the CNEP1R1 family.
genes like me logo Genes that share domains with CNEP1R1: view

No data available for Gene Families for CNEP1R1 Gene

Function for CNEP1R1 Gene

Molecular function for CNEP1R1 Gene

UniProtKB/Swiss-Prot Function:
Forms with the serine/threonine protein phosphatase CTDNEP1 an active complex which dephosphorylates and may activate LPIN1 and LPIN2. LPIN1 and LPIN2 are phosphatidate phosphatases that catalyze the conversion of phosphatidic acid to diacylglycerol and control the metabolism of fatty acids at different levels. May indirectly modulate the lipid composition of nuclear and/or endoplasmic reticulum membranes and be required for proper nuclear membrane morphology and/or dynamics. May also indirectly regulate the production of lipid droplets and triacylglycerol.

Gene Ontology (GO) - Molecular Function for CNEP1R1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 22134922
genes like me logo Genes that share ontologies with CNEP1R1: view
genes like me logo Genes that share phenotypes with CNEP1R1: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for CNEP1R1 Gene

Localization for CNEP1R1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CNEP1R1 Gene

Nucleus membrane; Multi-pass membrane protein. Cytoplasm. Note=Filamentous pattern in the cytoplasm.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CNEP1R1 gene
Compartment Confidence
nucleus 5
cytosol 4
plasma membrane 2
extracellular 1
mitochondrion 1
peroxisome 1

Gene Ontology (GO) - Cellular Components for CNEP1R1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
GO:0005635 nuclear envelope TAS --
GO:0005737 cytoplasm IEA,IDA 22134922
GO:0005829 cytosol IDA --
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with CNEP1R1: view

Pathways & Interactions for CNEP1R1 Gene

genes like me logo Genes that share pathways with CNEP1R1: view

Pathways by source for CNEP1R1 Gene

Interacting Proteins for CNEP1R1 Gene

Gene Ontology (GO) - Biological Process for CNEP1R1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006629 lipid metabolic process IEA --
GO:0007077 mitotic nuclear envelope disassembly TAS --
GO:0010867 positive regulation of triglyceride biosynthetic process IGI 22134922
GO:0034504 protein localization to nucleus IDA 22134922
GO:0035307 positive regulation of protein dephosphorylation IDA 22134922
genes like me logo Genes that share ontologies with CNEP1R1: view

No data available for SIGNOR curated interactions for CNEP1R1 Gene

Transcripts for CNEP1R1 Gene

Unigene Clusters for CNEP1R1 Gene

CTD nuclear envelope phosphatase 1 regulatory subunit 1:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for CNEP1R1 Gene

No ASD Table

Relevant External Links for CNEP1R1 Gene

GeneLoc Exon Structure for
CNEP1R1
ECgene alternative splicing isoforms for
CNEP1R1

Expression for CNEP1R1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CNEP1R1 Gene

Protein differential expression in normal tissues from HIPED for CNEP1R1 Gene

This gene is overexpressed in Bone (16.9), Lung (16.6), Placenta (11.1), and Testis (6.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for CNEP1R1 Gene



NURSA nuclear receptor signaling pathways regulating expression of CNEP1R1 Gene:

CNEP1R1

SOURCE GeneReport for Unigene cluster for CNEP1R1 Gene:

Hs.59134

mRNA Expression by UniProt/SwissProt for CNEP1R1 Gene:

Q8N9A8-NEPR1_HUMAN
Tissue specificity: Muscle specific with lower expression in other metabolic tissues.

Evidence on tissue expression from TISSUES for CNEP1R1 Gene

  • Nervous system(4.2)
genes like me logo Genes that share expression patterns with CNEP1R1: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein tissue co-expression partners and Phenotype-based relationships between genes and organs from Gene ORGANizer for CNEP1R1 Gene

Orthologs for CNEP1R1 Gene

This gene was present in the common ancestor of animals.

Orthologs for CNEP1R1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia TMEM188 35
  • 100 (a)
OneToOne
CNEP1R1 34
  • 99.77 (n)
mouse
(Mus musculus)
Mammalia Cnep1r1 34 16 35
  • 94.13 (n)
cow
(Bos Taurus)
Mammalia CNEP1R1 34 35
  • 93.87 (n)
rat
(Rattus norvegicus)
Mammalia Cnep1r1 34
  • 92.53 (n)
dog
(Canis familiaris)
Mammalia CNEP1R1 34 35
  • 90.85 (n)
chicken
(Gallus gallus)
Aves CNEP1R1 34 35
  • 89.6 (n)
lizard
(Anolis carolinensis)
Reptilia CNEP1R1 35
  • 96 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia cnep1r1 34
  • 82.13 (n)
Str.1469 34
African clawed frog
(Xenopus laevis)
Amphibia flj38101-prov 34
zebrafish
(Danio rerio)
Actinopterygii cnep1r1 34 35
  • 78.67 (n)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.10209 34
fruit fly
(Drosophila melanogaster)
Insecta CG8009 34 35
  • 57.39 (n)
CG41106 35
  • 32 (a)
OneToMany
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP005430 34
  • 52.94 (n)
worm
(Caenorhabditis elegans)
Secernentea nepr-1 35
  • 32 (a)
OneToOne
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 70 (a)
OneToOne
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.4360 34
Species where no ortholog for CNEP1R1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for CNEP1R1 Gene

ENSEMBL:
Gene Tree for CNEP1R1 (if available)
TreeFam:
Gene Tree for CNEP1R1 (if available)

Paralogs for CNEP1R1 Gene

(1) SIMAP similar genes for CNEP1R1 Gene using alignment to 5 proteins:

Pseudogenes.org Pseudogenes for CNEP1R1 Gene

genes like me logo Genes that share paralogs with CNEP1R1: view

No data available for Paralogs for CNEP1R1 Gene

Variants for CNEP1R1 Gene

Sequence variations from dbSNP and Humsavar for CNEP1R1 Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
rs1000412326 -- 50,027,604(+) GCTGT(-/AGTGAGCTATGTAGTGAGCTA)AGTGA intron-variant
rs1000466731 -- 50,025,201(+) GCGAC(A/G)GGGAG upstream-variant-2KB
rs1000477184 -- 50,027,350(+) TAAAA(A/C)TAAAA intron-variant
rs1000604642 -- 50,023,251(+) CCTCC(-/TGAG)TATCT upstream-variant-2KB
rs1000616365 -- 50,027,573(+) TGGGA(A/G)GATCA intron-variant

Structural Variations from Database of Genomic Variants (DGV) for CNEP1R1 Gene

Variant ID Type Subtype PubMed ID
esv3892857 CNV gain 25118596
nsv1063991 CNV gain 25217958
nsv1066081 CNV gain 25217958
nsv572591 CNV gain 21841781

Variation tolerance for CNEP1R1 Gene

Residual Variation Intolerance Score: 64.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.88; 18.32% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for CNEP1R1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
CNEP1R1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CNEP1R1 Gene

Disorders for CNEP1R1 Gene

Relevant External Links for CNEP1R1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
CNEP1R1

No disorders were found for CNEP1R1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for CNEP1R1 Gene

Publications for CNEP1R1 Gene

  1. Nuclear envelope phosphatase-regulatory subunit 1 (formerly TMEM188) is the metazoan SPO7 ortholog and functions in the lipin activation pathway. (PMID: 22134922) Han S. … Goodman J.M. (J. Biol. Chem. 2012) 2 3 4 64
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4 64
  3. The endoplasmic reticulum adaptor protein ERAdP initiates NK cell activation via the Ubc13-mediated NF-I_B pathway. (PMID: 25548215) Chen J. … Fan Z. (J. Immunol. 2015) 3 64
  4. N-terminal acetylome analyses and functional insights of the N- terminal acetyltransferase NatB. (PMID: 22814378) Van Damme P. … Aldabe R. (Proc. Natl. Acad. Sci. U.S.A. 2012) 4 64
  5. Ubiquitin-mediated proteolysis of HuR by heat shock. (PMID: 19322201) Abdelmohsen K. … Gorospe M. (EMBO J. 2009) 3 64

Products for CNEP1R1 Gene

Sources for CNEP1R1 Gene

Content
Loading form....