Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

CLSTN3 Gene

protein-coding   GIFtS: 53
GCID: GC12P007282

calsyntenin 3

 Explore 1 disease affiliated with
CLSTN3 via our new
 Human Malady Compendium 
Biological research products
for CLSTN3
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Calsyntenin 31 2     Alcbeta1
CDHR141 2     Cadherin-Related Family Member 142
CSTN31 2     Calsyntenin-31
KIAA07261 3     Alc-Beta1
Alc-Beta1     Alcadein-Beta1
Alcadein Beta2     CS33
Alcadein-Beta1     

External Ids:    HGNC: 183711   Entrez Gene: 97462   Ensembl: ENSG000001391827   OMIM: 6113245   UniProtKB: Q9BQT93   

Export aliases for CLSTN3 gene to outside databases

Previous GC identifers: GC12P007242 GC12P007418 GC12P007174 GC12P007095


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

UniProtKB/Swiss-Prot: CSTN3_HUMAN, Q9BQT9
Function: May modulate calcium-mediated postsynaptic signals (By similarity). Complex formation with APBA2 and APP,
stabilizes APP metabolism and enhances APBA2-mediated suppression of beta-APP40 secretion, due to the retardation of
intracellular APP maturation (By similarity)




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000012.11  NC_018923.1  NT_009714.17  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the CLSTN3 gene promoter:
         MZF-1   PPAR-gamma1   ISGF-3   AML1a   RREB-1   ARP-1   HNF-4alpha2   PPAR-gamma2   HNF-4alpha1   RORalpha2   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidCLSTN3 promoter sequence
   Search SABiosciences Chromatin IP Primers for CLSTN3

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat CLSTN3


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 12p13.31   Ensembl cytogenetic band:  12p13.31   HGNC cytogenetic band: 12p13.31

CLSTN3 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
CLSTN3 gene location

GeneLoc information about chromosome 12         GeneLoc Exon Structure

GeneLoc location for GC12P007282:  view genomic region     (about GC identifiers)

Start:
7,282,294 bp from pter      End:
7,311,541 bp from pter
Size:
29,248 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: CSTN3_HUMAN, Q9BQT9 (See protein sequence)
Recommended Name: Calsyntenin-3 precursor  
Size: 956 amino acids; 106098 Da
Subunit: Directly interacts with APBA2. Forms a tripartite complex with APBA2 and APP. Interacts with low affinity with
KLC1 (By similarity)
Subcellular location: Cell membrane; Single-pass type I membrane protein (Potential). Endoplasmic reticulum membrane.
Golgi apparatus membrane. Note=Most prominent in the postsynaptic specializations of asymmetric (type I) synapses with
both axodendritic and axospinous localization (By similarity)
Sequence caution: Sequence=BAA34446.2; Type=Erroneous initiation; Note=Translation N-terminally shortened;
Secondary accessions: D3DUT6 O94831 Q2T9J5 Q5UE57
Alternative splicing: 2 isoforms:  Q9BQT9-1   Q9BQT9-2   

Explore the universe of human proteins at neXtProt for CLSTN3: NX_Q9BQT9

Post-translational modifications:

  • Proteolytically processed under normal cellular conditions. A primary zeta-cleavage generates a large extracellular
  • (soluble) N-terminal domain (sAlc) and a short C-terminal transmembrane fragment (CTF1). A secondary cleavage
    catalyzed by gamma-secretase within the transmembrane domain releases the beta-Alc-beta chain in the extracellular
    milieu and produces an intracellular fragment (AlcICD). This processing is strongly suppressed in the tripartite
    complex formed with APBA2 and APP, which seems to prevent the association with gamma-secretase (By similarity)1
  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q9BQT9

  • CLSTN3 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins: NP_055533.2  
    ENSEMBL proteins: 
     ENSP00000443959   ENSP00000266546   ENSP00000442612   ENSP00000443468   ENSP00000443490  
     ENSP00000442801   ENSP00000440679  

    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom Protein Services for CLSTN3 
    GenScript Custom Purified and Recombinant Proteins Services for CLSTN3
    Novus Biologicals CLSTN3 Protein
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for CLSTN3

    Gene Ontology (GO): 5 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000139Golgi membrane IEA--
    GO:0005789endoplasmic reticulum membrane IEA--
    GO:0005886plasma membrane IEA--
    GO:0016021integral to membrane IEA--
    GO:0045211postsynaptic membrane IEA--


    CLSTN3 for ontologies           About GeneDecksing



    CLSTN3 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    R&D Systems Antibodies for CLSTN3 (Calsyntenin-3)
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for CLSTN3 
    GenScript Custom Superior Antibodies Services for CLSTN3
    Novus Biologicals CLSTN3 Antibodies
    Search for Antibodies for CLSTN3 at Abcam  
    Uscn Antibodies for CLSTN3
    Search ThermoFisher Antibodies for CLSTN3

    Assay Products for CLSTN3: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for CLSTN3
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for CLSTN3


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    CLSTN3 for domains           About GeneDecksing

    5 InterPro domains/families:
     IPR026914 Calsyntenin
     IPR013320 ConA-like_subgrp
     IPR015919 Cadherin-like
     IPR002126 Cadherin
     IPR008985 ConA-like_lec_gl_sf

    Graphical View of Domain Structure for InterPro Entry Q9BQT9

    ProtoNet protein and cluster: Q9BQT9

    1 Blocks protein family: IPB002126 Cadherin

    UniProtKB/Swiss-Prot: CSTN3_HUMAN, Q9BQT9
    Domain: Binds synaptic Ca(2+) with its cytoplasmic domain (By similarity)
    Similarity: Contains 2 cadherin domains


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: CSTN3_HUMAN, Q9BQT9
    Function: May modulate calcium-mediated postsynaptic signals (By similarity). Complex formation with APBA2 and APP,
    stabilizes APP metabolism and enhances APBA2-mediated suppression of beta-APP40 secretion, due to the retardation of
    intracellular APP maturation (By similarity)

    miRNA
    Products:
        
    OriGene 3'-UTR Clone: CLSTN3
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat CLSTN3
    6 QIAGEN miScript miRNA Assays for microRNAs that regulate CLSTN3:
    hsa-miR-323-3p hsa-miR-203 hsa-miR-2355-5p hsa-miR-558 hsa-miR-570 hsa-miR-3160-3p
    SwitchGear 3'UTR luciferase reporter plasmidCLSTN3 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for CLSTN3 (see all 7)
    OriGene shRNA RFP: CLSTN3
    OriGene siRNA: CLSTN3
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat CLSTN3

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for CLSTN3

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for CLSTN3 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for CLSTN3
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: CLSTN3 (NM_014718)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for CLSTN3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CLSTN3 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for CLSTN3
    Search LifeMap BioReagents cell lines for CLSTN3

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CLSTN3

    Gene Ontology (GO): 1 molecular function term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005509calcium ion binding IEA--


    CLSTN3 for ontologies           About GeneDecksing


    3 GenomeRNAi human phenotypes for CLSTN3:
     Decreased influenza A H1N1 (A/  Decreased influenza A/WSN/33 r  Synthetic lethal with Ras 


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section



    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for CLSTN3

    STRING Interaction Network Preview (showing 1 interactants - click image to see more details)

    3 Interacting proteins for CLSTN3 (Q9BQT93 ENSP000002665464) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    APBA2Q997673I2D: score=1 
    APPP050673I2D: score=1 
    --ENSP000002198654STRING: ENSP00000219865
    About this table

    Gene Ontology (GO): 1 biological process term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0007156homophilic cell adhesion IEA--


    CLSTN3 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for CLSTN3

    1 HMDB Compound for CLSTN3    About this table
    CompoundSynonyms CAS #PubMed Ids
    CalciumCa (see all 2)7440-70-2--
    Search CenterWatch for drugs/clinical trials and news about CLSTN3 / CSTN3 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for CLSTN3 gene: 
    NM_014718.3  

    Unigene Cluster for CLSTN3:

    Calsyntenin 3
    Hs.535378  [show with all ESTs]
    Unigene Representative Sequence: BC111491
    16 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000541953 ENST00000266546(uc001qsr.3) ENST00000541667 ENST00000545663
    ENST00000535452 ENST00000534830 ENST00000539982 ENST00000537408(uc001qss.3)
    ENST00000538933 ENST00000540931 ENST00000535668 ENST00000544584 ENST00000541770
    ENST00000542663 ENST00000331148(uc001qst.3) ENST00000535313

    miRNA
    Products:
         
    OriGene 3'-UTR Clone: CLSTN3
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat CLSTN3
    6 QIAGEN miScript miRNA Assays for microRNAs that regulate CLSTN3:
    hsa-miR-323-3p hsa-miR-203 hsa-miR-2355-5p hsa-miR-558 hsa-miR-570 hsa-miR-3160-3p
    SwitchGear 3'UTR luciferase reporter plasmidCLSTN3 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for CLSTN3 (see all 7)
    OriGene shRNA RFP: CLSTN3
    OriGene siRNA: CLSTN3
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat CLSTN3
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for CLSTN3 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for CLSTN3
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: CLSTN3 (NM_014718)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for CLSTN3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CLSTN3 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for CLSTN3
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat CLSTN3
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat CLSTN3
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat CLSTN3

    Additional cDNA sequence: 

    AJ277460.1 AK299177.1 AK299246.1 AK316059.1 AY753302.1 BC039075.1 BC104767.1 BC111491.1 
    BC112283.1 BC148258.1 

    21 DOTS entries:

    DT.92428328  DT.210859  DT.121182122  DT.100744691  DT.75108920  DT.121182118  DT.91825939  DT.97843682 
    DT.100647085  DT.100831074  DT.121182151  DT.121182162  DT.70102260  DT.75111753  DT.91746497  DT.92428326 
    DT.95075153  DT.97807651  DT.40112905  DT.91680679  DT.95075143 

    24/161 AceView cDNA sequences (see all 161):

    AA318791 BM710970 CR621580 BQ923458 AA325248 BQ416712 AA339760 BX452281 
    AA322750 T30908 AJ277460 BG742627 BQ717902 BM683655 CA397727 BM702421 
    T33896 BM711571 AL522578 Z42954 BX954468 NM_014718 BI756741 M78932 

    GeneLoc Exon Structure

    5/14 Alternative Splicing Database (ASD) splice patterns (SP) for CLSTN3 (see all 14)    About this scheme

    ExUns: 1a · 1b · 1c · 1d ^ 2 ^ 3 ^ 4 ^ 5 ^ 6a · 6b · 6c ^ 7 ^ 8a · 8b ^ 9a · 9b · 9c · 9d ^ 10 ^ 11 ^ 12a · 12b ^ 13 ^ 14 ^ 15 ^ 16 ^
    SP1:                          -     -     -     -     -     -                       -                                               -           -               
    SP2:                                                                                -                                               -           -               
    SP3:                                                                                                                                                            
    SP4:              -     -     -     -     -     -     -     -     -     -           -                                                                           
    SP5:                                -     -     -     -     -                       -                                                                           

    ExUns: 17 ^ 18a · 18b ^ 19 ^ 20 ^ 21 ^ 22a · 22b ^ 23a · 23b ^ 24a · 24b ^ 25a · 25b · 25c · 25d
    SP1:                                            -     -     -           -                           
    SP2:                                            -     -     -           -                           
    SP3:                                                                                                
    SP4:                                                                                                
    SP5:                                                                                                


    ECgene alternative splicing isoforms for CLSTN3

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    CLSTN3 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: TCCTGGGGCA

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image
    See CLSTN3 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for CLSTN3

    SOURCE GeneReport for Unigene cluster: Hs.535378

    UniProtKB/Swiss-Prot: CSTN3_HUMAN, Q9BQT9
    Tissue specificity: According to PubMed:12498782, expressed predominantly in the brain and in kidney. Low levels in
    heart, skeletal muscle, liver, placenta, pancreas and lung. According to PubMed:12972431, predominant expression in
    brain, and only marginal in kidney. In brain, present throughout all cortical layers, highest levels in GABAergic
    neurons (based on morphology and distribution pattern)

        SABiosciences Custom PCR Arrays for CLSTN3
    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for CLSTN3
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat CLSTN3
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat CLSTN3
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat CLSTN3
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CLSTN3

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for CLSTN3 gene from 7/19 species (see all 19)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Clstn31 , 5 calsyntenin 31, 5 89.82(n)1
    95.71(a)1
      6 (59.15 cM)5
    2323701  NM_153508.41  NP_705728.11 
     1244307595 
    chicken
    (Gallus gallus)
    Aves CLSTN31 calsyntenin 3 77.14(n)
    83.54(a)
      418297  XM_416520.3  XP_416520.3 
    lizard
    (Anolis carolinensis)
    Reptilia CLSTN36
    --
    70(a)
    1 ↔ 1
    GL343218.1(166906-200181)
    tropical clawed frog
    (Xenopus tropicalis)
    Amphibia Str.132952 Transcribed sequence with moderate similarity to protein more 75.13(n)    BX726645.1 
    zebrafish
    (Danio rerio)
    Actinopterygii LOC5556271 calsyntenin-3-like 65.3(n)
    63.78(a)
      555627  XM_678194.5  XP_683286.4 
    fruit fly
    (Drosophila melanogaster)
    Insecta calsyntenin-13 calcium-dependent cell-cell adhesion
    calcium-dependent more
    27(a)   102D4   --
    worm
    (Caenorhabditis elegans)
    Secernentea casy-16
    CAlSYntenin/Alcadein homolog family member (casy-1...
    23(a)
    1 → many
    II(5945381-5956660)


    ENSEMBL Gene Tree for CLSTN3 (if available)
    TreeFam Gene Tree for CLSTN3 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for CLSTN3 gene
    CLSTN22  CLSTN12  
    2 SIMAP similar genes for CLSTN3 using alignment to 7 protein entries:     CSTN3_HUMAN (see all proteins):
    CLSTN1    CLSTN2

    CLSTN3 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/615 NCBI SNPs in CLSTN3 are shown (see all 615    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 12 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1511660271,2
    --7281209(+) AACCCC/TGGGCA 2 -- int1 us2k10--------
    rs1162848981,2
    C,F,--7281287(+) GAGGGC/TGAGGC 2 -- int1 us2k11Minor allele frequency- T:0.02WA 118
    rs1176254511,2
    --7281422(+) AGGAGG/AGGGTG 2 -- ut51 us2k11Minor allele frequency- A:0.01EA 120
    rs1168796951,2
    --7281424(+) GAGGGG/TGTGTT 2 -- us2k1 ut511Minor allele frequency- T:0.01EA 120
    rs1878741021,2
    --7281494(+) ATGGCC/TGGGTT 2 -- us2k10--------
    rs169168521,2
    C,F,H,--7281613(-) AAATCC/TCTGCC 2 -- us2k119Minor allele frequency- T:0.10MN EA NS NA 2578
    rs1488942721,2
    C,--7281645(+) GGCTT-/TTCCTGAGGAAGGA
    ACCTGGAGCAGGATCC
    TTCCT
    2 -- us2k10--------
    rs61446021,2
    C--7281674(+) GGATC-/CTTCCTGAGGAAGG
    AACCTGGAGCAGGATC
    TGGGG
    2 -- us2k11Minor allele frequency- CTTCCTGAGGAAGGAACCTGGAGCAGGATC:0.00NA 2
    rs1498779661,2
    --7281791(+) CCCAGG/TGCCTG 2 -- us2k10--------
    rs1919636521,2
    --7282126(+) AGAATG/TTTATT 2 -- us2k10--------

    HapMap Linkage Disequilibrium report for CLSTN3 (7282294 - 7311541 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 2 variations for CLSTN3
         2 CNVs: 9680 86173

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing CLSTN3
    DNA2.0 Custom Variant and Variant Library Synthesis for CLSTN3

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    CLSTN3 for disorders           About GeneDecksing

    OMIM gene information: 611324    OMIM disorders: --

    1 disease for CLSTN3:    About MalaCards
    neuronitis


    Export disorders for CLSTN3 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for CLSTN3 gene integrated from 9 sources:
    (articles sorted by number of sources associating them with CLSTN3)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. The calsyntenins - a family of postsynaptic membrane proteins with distinct neuronal expression patterns. (PubMed id 12498782)1, 2, 3 Hintsch G.... Sonderegger P. (2002)
    2. Coordinated metabolism of Alcadein and amyloid beta-protein precursor regulates FE65-dependent gene transactivation. (PubMed id 15037614)1, 2 Araki Y.... Suzuki T. (2004)
    3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    4. Novel cadherin-related membrane proteins, Alcadeins, enhance the X11- like protein-mediated stabilization of amyloid beta-protein precursor metabolism. (PubMed id 12972431)1, 2 Araki Y....Suzuki T. (2003)
    5. Prediction of the coding sequences of unidentified human genes. XI. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. (PubMed id 9872452)1, 2 Nagase T.... Ohara O. (1998)
    6. The consensus coding sequences of human breast and colorectal cancers. (PubMed id 16959974)2 Sjoeblom T.... Velculescu V.E. (2006)
    7. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PubMed id 16344560)1 Kimura K.... Sugano S. (2006)
    8. The finished DNA sequence of human chromosome 12. (PubMed id 16541075)2 Scherer S.E.... Gibbs R.A. (2006)
    9. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (2002)
    10. [The family of calsyntenins: learning and memory related genes] (PubMed id 17009726)9 Cheng X.R....Zhang Y.X. (2006)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 9746 HGNC: 18371 AceView: CLSTN3 Ensembl:ENSG00000139182 euGenes: HUgn9746
    ECgene: CLSTN3 H-InvDB: CLSTN3

    (According to HUGE)
    About This Section
    HUGE: KIAA0726

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for CLSTN3 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for CLSTN3 gene:
    Search GeneIP for patents involving CLSTN3

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Antibodies for CLSTN3 (Calsyntenin-3)   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     Browse OriGene Antibodies   OriGene shRNA RFP for CLSTN3  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for CLSTN3   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for CLSTN3  
     Browse OriGene Protein Over-expression Lysates   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for CLSTN3   OriGene 3'-UTR Clone for CLSTN3  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for CLSTN3   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for CLSTN3  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for CLSTN3   OriGene Custom Protein Services for CLSTN3  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat CLSTN3
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing CLSTN3
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat CLSTN3
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat CLSTN3
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat CLSTN3
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat CLSTN3
     GenScript Custom Purified and Recombinant Proteins Services for CLSTN3 GenScript cDNA clones with any tag delivered in your preferred vector for CLSTN3
     GenScript Custom Assay Services for CLSTN3 GenScript Custom Superior Antibodies Services for CLSTN3
     GenScript Custom overexpressing Cell Line Services for CLSTN3 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in CLSTN3 promoter
     Search Chromatin IP Primers for CLSTN3
     RT2 qPCR Primer Assay in human, mouse, rat CLSTN3
     Search GNC Networks for CLSTN3
     SABiosciences Custom PCR Arrays for CLSTN3
     Search Tocris compounds for CLSTN3
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     CLSTN3 antibodies
     CLSTN3 proteins
     Search for Antibodies for CLSTN3 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for CLSTN3
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     CLSTN3 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for CLSTN3
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CLSTN3
     SwitchGear 3'UTR luciferase reporter plasmids for CLSTN3
     SwitchGear Promoter luciferase reporter plasmids for CLSTN3
     Search ThermoFisher Antibodies for CLSTN3
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CLSTN3
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      CLSTN3 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 100 solr: 1.4