Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CLDN6 Gene

Aliases for CLDN6 Gene

  • Claudin 6 2 3 5
  • Skullin 3 4
  • Claudin-6 3

External Ids for CLDN6 Gene

Previous GeneCards Identifiers for CLDN6 Gene

  • GC16M003085
  • GC16M003064
  • GC16M003004
  • GC16M003036
  • GC16M003056

Summaries for CLDN6 Gene

Entrez Gene Summary for CLDN6 Gene

  • Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. This gene encodes a component of tight junction strands, which is a member of the claudin family. The protein is an integral membrane protein and is one of the entry cofactors for hepatitis C virus. The gene methylation may be involved in esophageal tumorigenesis. This gene is adjacent to another family member CLDN9 on chromosome 16.[provided by RefSeq, Aug 2010]

GeneCards Summary for CLDN6 Gene

CLDN6 (Claudin 6) is a Protein Coding gene. Diseases associated with CLDN6 include Monosomy 22 and Hepatitis C Virus. Among its related pathways are Blood-Brain Barrier and Immune Cell Transmigration: VCAM-1/CD106 Signaling Pathways and Tight junction. GO annotations related to this gene include identical protein binding and structural molecule activity. An important paralog of this gene is CLDN9.

UniProtKB/Swiss-Prot for CLDN6 Gene

  • Plays a major role in tight junction-specific obliteration of the intercellular space (By similarity). May act as a coreceptor for HCV entry into hepatic cells.

Gene Wiki entry for CLDN6 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CLDN6 Gene

Genomics for CLDN6 Gene

Regulatory Elements for CLDN6 Gene

Enhancers for CLDN6 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH16F003097 1.8 FANTOM5 Ensembl ENCODE 11.1 -80.0 -80016 6.2 MLX CREB3L1 ZFP64 YY1 SLC30A9 ZNF143 ZNF263 SP3 NFYC TBX21 ZNF205 CREBBP THOC6 ZNF263 ZNF597 SNHG19 LOC105371055 SNORD60 ZNF213-AS1 ENSG00000200059
GH16F003069 1.7 FANTOM5 Ensembl ENCODE 11.7 -54.3 -54309 9.8 HDGF PKNOX1 CREB3L1 ZFP64 ARID4B SIN3A YBX1 ZNF2 YY1 ZNF143 LOC105371058 MMP25 IL32 ZNF205 BICDL2 LOC100128770 CLDN6 THOC6 HCFC1R1 TNFRSF12A
GH16F003052 1.3 Ensembl ENCODE 12.4 -34.5 -34530 4.4 ARID4B SIN3A DMAP1 ZNF2 ZNF302 ZNF143 ZNF207 KLF13 ZNF263 SP3 MMP25 BICDL2 IL32 CLDN6 TNFRSF12A ZNF205 CLDN9 PKMYT1 GC16P003092
GH16F003148 1.4 Ensembl ENCODE 11.3 -131.1 -131115 4.9 CREB3L1 MLX ZFP64 DMAP1 YY1 SLC30A9 ZNF143 ZNF263 SP3 NFYC CREBBP THOC6 ZNF213-AS1 ZNF263 LOC105371055 ZNF205 TRAF7 TIGD7 ZNF597 CLUAP1
GH16F003095 1 Ensembl ENCODE 11.9 -76.0 -76030 1.4 BCOR CTCF MXI1 ZMYM3 RAD21 RELA ZKSCAN1 POLR2A SMC3 NFE2 ZNF213-AS1 RNU1-125P IL32 MMP25 BICDL2 LOC100128770 THOC6 HCFC1R1 CLDN6 TNFRSF12A
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around CLDN6 on UCSC Golden Path with GeneCards custom track

Genomic Location for CLDN6 Gene

3,014,712 bp from pter
3,020,071 bp from pter
5,360 bases
Minus strand

Genomic View for CLDN6 Gene

Genes around CLDN6 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CLDN6 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CLDN6 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CLDN6 Gene

Proteins for CLDN6 Gene

  • Protein details for CLDN6 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein Accession:
    Secondary Accessions:
    • B3KQP9
    • D3DUA5

    Protein attributes for CLDN6 Gene

    220 amino acids
    Molecular mass:
    23292 Da
    Quaternary structure:
    • Directly interacts with TJP1/ZO-1, TJP2/ZO-2 and TJP3/ZO-3.

neXtProt entry for CLDN6 Gene

Post-translational modifications for CLDN6 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for CLDN6 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

No data available for DME Specific Peptides for CLDN6 Gene

Domains & Families for CLDN6 Gene

Gene Families for CLDN6 Gene

Suggested Antigen Peptide Sequences for CLDN6 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the claudin family.
  • Belongs to the claudin family.
genes like me logo Genes that share domains with CLDN6: view

Function for CLDN6 Gene

Molecular function for CLDN6 Gene

GENATLAS Biochemistry:
claudin 6,clostridium perfringens enterotoxin receptor,integral membrane protein,claudin family of major structural components of tight junction (TJ) strands,not detected in adult tissues
UniProtKB/Swiss-Prot Function:
Plays a major role in tight junction-specific obliteration of the intercellular space (By similarity). May act as a coreceptor for HCV entry into hepatic cells.

Gene Ontology (GO) - Molecular Function for CLDN6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005198 structural molecule activity IEA --
GO:0042802 identical protein binding ISS --
genes like me logo Genes that share ontologies with CLDN6: view
genes like me logo Genes that share phenotypes with CLDN6: view

Animal Model Products

  • Taconic Biosciences Mouse Models for CLDN6

miRNA for CLDN6 Gene

miRTarBase miRNAs that target CLDN6

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for CLDN6 Gene

Localization for CLDN6 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CLDN6 Gene

Cell junction, tight junction. Cell membrane; Multi-pass membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CLDN6 gene
Compartment Confidence
plasma membrane 4

Gene Ontology (GO) - Cellular Components for CLDN6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane IEA --
GO:0005923 bicellular tight junction ISS --
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
GO:0016327 apicolateral plasma membrane IEA --
genes like me logo Genes that share ontologies with CLDN6: view

Pathways & Interactions for CLDN6 Gene

genes like me logo Genes that share pathways with CLDN6: view

Gene Ontology (GO) - Biological Process for CLDN6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016032 viral process IEA --
GO:0016338 calcium-independent cell-cell adhesion via plasma membrane cell-adhesion molecules ISS --
GO:0045216 cell-cell junction organization IEA --
genes like me logo Genes that share ontologies with CLDN6: view

No data available for SIGNOR curated interactions for CLDN6 Gene

Transcripts for CLDN6 Gene

mRNA/cDNA for CLDN6 Gene

Unigene Clusters for CLDN6 Gene

Claudin 6:
Representative Sequences:

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for CLDN6 Gene

No ASD Table

Relevant External Links for CLDN6 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for CLDN6 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for CLDN6 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for CLDN6 Gene

This gene is overexpressed in Brain - Putamen (basal ganglia) (x7.0), Brain - Caudate (basal ganglia) (x4.9), Pancreas (x4.8), Brain - Cerebellum (x4.6), and Brain - Cerebellar Hemisphere (x4.3).

Protein differential expression in normal tissues from HIPED for CLDN6 Gene

This gene is overexpressed in Fetal heart (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for CLDN6 Gene

Protein tissue co-expression partners for CLDN6 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of CLDN6 Gene:


SOURCE GeneReport for Unigene cluster for CLDN6 Gene:


mRNA Expression by UniProt/SwissProt for CLDN6 Gene:

Tissue specificity: Expressed in the liver, in peripheral blood mononuclear cells and hepatocarcinoma cell lines.
genes like me logo Genes that share expression patterns with CLDN6: view

Orthologs for CLDN6 Gene

This gene was present in the common ancestor of chordates.

Orthologs for CLDN6 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia CLDN6 34 35
  • 99.24 (n)
(Bos Taurus)
Mammalia CLDN6 34 35
  • 88.03 (n)
(Canis familiaris)
Mammalia CLDN6 34 35
  • 87.27 (n)
(Mus musculus)
Mammalia Cldn6 34 16 35
  • 84.47 (n)
(Rattus norvegicus)
Mammalia Cldn6 34
  • 83.11 (n)
(Monodelphis domestica)
Mammalia CLDN6 35
  • 76 (a)
(Anolis carolinensis)
Reptilia -- 35
  • 60 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100493413 34
  • 69.65 (n)
MGC75756 34
(Danio rerio)
Actinopterygii cldnd 34
  • 65.84 (n)
Species where no ortholog for CLDN6 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CLDN6 Gene

Gene Tree for CLDN6 (if available)
Gene Tree for CLDN6 (if available)

Paralogs for CLDN6 Gene

(18) SIMAP similar genes for CLDN6 Gene using alignment to 2 proteins: Pseudogenes for CLDN6 Gene

genes like me logo Genes that share paralogs with CLDN6: view

Variants for CLDN6 Gene

Sequence variations from dbSNP and Humsavar for CLDN6 Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
rs111438569 -- 3,018,429(+) ACTTA(A/G)GCAGC upstream-variant-2KB
rs111680634 -- 3,014,552(+) ACAGC(C/T)AGGTG downstream-variant-500B
rs111771905 -- 3,017,003(+) GGGTC(-/TCGAACTCCTGACCTCAGGTGA)TCTGC intron-variant
rs111866375 -- 3,017,901(+) GCAGG(A/T)GGGGG intron-variant
rs112001446 -- 3,019,523(+) TACAA(A/C)AAATA upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for CLDN6 Gene

Variant ID Type Subtype PubMed ID
nsv952906 CNV deletion 24416366
nsv833125 CNV loss 17160897
nsv510673 CNV deletion 20534489
nsv509588 CNV insertion 20534489

Variation tolerance for CLDN6 Gene

Residual Variation Intolerance Score: 66.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 7.93; 83.88% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for CLDN6 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CLDN6 Gene

Disorders for CLDN6 Gene

MalaCards: The human disease database

(2) MalaCards diseases for CLDN6 Gene - From: GeneCards

Disorder Aliases PubMed IDs
monosomy 22
  • del(22)
hepatitis c virus
  • hepatitic c virus
- elite association - COSMIC cancer census association via MalaCards
Search CLDN6 in MalaCards View complete list of genes associated with diseases

Relevant External Links for CLDN6

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with CLDN6: view

No data available for UniProtKB/Swiss-Prot and Genatlas for CLDN6 Gene

Publications for CLDN6 Gene

  1. Claudin 6 is a positive marker for atypical teratoid/rhabdoid tumors. (PMID: 19220299) Birks D.K. … Handler M.H. (Brain Pathol. 2010) 3 22 64
  2. Distribution and expression pattern of claudins 6, 7, and 9 in diffuse- and intestinal-type gastric adenocarcinomas. (PMID: 19960275) RendA^n-Huerta E. … MontaA+o L.F. (J Gastrointest Cancer 2010) 3 22 64
  3. Epithelioid versus rhabdoid glioblastomas are distinguished by monosomy 22 and immunohistochemical expression of INI-1 but not claudin 6. (PMID: 20118769) Kleinschmidt-DeMasters B.K. … Lillehei K.O. (Am. J. Surg. Pathol. 2010) 3 22 64
  4. Tight junction protein, claudin-6, downregulates the malignant phenotype of breast carcinoma. (PMID: 20215972) Wu Q. … Quan C. (Eur. J. Cancer Prev. 2010) 3 22 64
  5. [Effects of stable up-regulation of tight junction protein claudin-6 upon biological phenotypes of breast cancer cell MCF-7]. (PMID: 20367941) Wu Q. … Quan C.S. (Zhonghua Yi Xue Za Zhi 2010) 3 22 64

Products for CLDN6 Gene

Sources for CLDN6 Gene

Loading form....