Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CHIT1 Gene

Aliases for CHIT1 Gene

  • Chitinase 1 2 3 5
  • Chitinase 1 (Chitotriosidase) 2 3
  • EC 3.2.1.14 4 58
  • Plasma Methylumbelliferyl Tetra-N-Acetylchitotetraoside Hydrolase 3
  • Chitotriosidase-1 3
  • Chitotriosidase 2
  • Chitinase-1 4
  • CHITD 3
  • CHI3 3
  • CHIT 3

External Ids for CHIT1 Gene

Previous GeneCards Identifiers for CHIT1 Gene

  • GC01M200868
  • GC01M198615
  • GC01M199649
  • GC01M200474
  • GC01M199917
  • GC01M201451
  • GC01M174350

Summaries for CHIT1 Gene

Entrez Gene Summary for CHIT1 Gene

  • Chitotriosidase is secreted by activated human macrophages and is markedly elevated in plasma of Gaucher disease patients. The expression of chitotriosidase occurs only at a late stage of differentiation of monocytes to activated macrophages in culture. Human macrophages can synthesize a functional chitotriosidase, a highly conserved enzyme with a strongly regulated expression. This enzyme may play a role in the degradation of chitin-containing pathogens. Several alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2012]

GeneCards Summary for CHIT1 Gene

CHIT1 (Chitinase 1) is a Protein Coding gene. Diseases associated with CHIT1 include Chitotriosidase Deficiency and Gaucher's Disease. Among its related pathways are Metabolism and Amino sugar and nucleotide sugar metabolism. GO annotations related to this gene include hydrolase activity, hydrolyzing O-glycosyl compounds and chitinase activity. An important paralog of this gene is CHIA.

UniProtKB/Swiss-Prot for CHIT1 Gene

  • Degrades chitin, chitotriose and chitobiose. May participate in the defense against nematodes and other pathogens. Isoform 3 has no enzymatic activity.

Additional gene information for CHIT1 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CHIT1 Gene

Genomics for CHIT1 Gene

Regulatory Elements for CHIT1 Gene

Enhancers for CHIT1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH01H203338 1.4 Ensembl ENCODE dbSUPER 12.9 -66.0 -65971 2 HDGF NFIB RB1 KLF17 ZNF2 RAD21 RFX5 YY1 ZNF143 ZNF391 CHIT1 LINC01136 BTG2 RNU6-487P OPTC PRELP ATP2B4 ADORA1 ENSG00000224671 FMOD
GH01H203272 1.9 FANTOM5 Ensembl ENCODE dbSUPER 9.1 -0.7 -738 3 HDGF ATF1 ARNT SIN3A FEZF1 ZNF2 ZBTB7B ZNF121 ZNF143 ZNF207 BTG2 LINC01136 RNU6-487P FMOD LOC100131747 OPTC PRELP CHIT1 LINC01353
GH01H203295 1.3 FANTOM5 Ensembl ENCODE dbSUPER 12.1 -22.9 -22877 2 POLR2A IKZF1 EBF1 GLI4 EZH2 RNU6-487P CHIT1 BTG2 LINC01353 LINC01136
GH01H203268 1.4 Ensembl ENCODE dbSUPER 7.8 +4.5 4538 1 HDAC1 HDGF PKNOX1 ATF1 RB1 TBL1XR1 ARNT SIN3A ZNF2 RAD21 BTG2 LINC01136 RNU6-487P OPTC LOC100131747 FMOD PRELP CHIT1 GC01P203263
GH01H203270 1.3 Ensembl ENCODE dbSUPER 8.1 +2.4 2381 0 ATF1 YY1 RFX5 ETS1 EGR1 ZNF143 RUNX3 CREM THAP11 SP3 SNRPE ZC3H11A ZBED6 SOX13 CHIT1 GC01P203263
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around CHIT1 on UCSC Golden Path with GeneCards custom track

Genomic Location for CHIT1 Gene

Chromosome:
1
Start:
203,212,823 bp from pter
End:
203,273,641 bp from pter
Size:
60,819 bases
Orientation:
Minus strand

Genomic View for CHIT1 Gene

Genes around CHIT1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CHIT1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CHIT1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CHIT1 Gene

Proteins for CHIT1 Gene

  • Protein details for CHIT1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q13231-CHIT1_HUMAN
    Recommended name:
    Chitotriosidase-1
    Protein Accession:
    Q13231
    Secondary Accessions:
    • B3KNW6
    • J3KN09
    • Q0VGG5
    • Q0VGG6
    • Q3ZAR1
    • Q6ISC2
    • Q9H3V8
    • Q9UDJ8

    Protein attributes for CHIT1 Gene

    Size:
    466 amino acids
    Molecular mass:
    51681 Da
    Quaternary structure:
    • Monomer.
    Miscellaneous:
    • Very high plasma levels of CHIT1 are found in patients with Gaucher disease type 1 (GD I). Can be used as diagnostic aid and to evaluate the success of treatment that brings levels back to normal.
    SequenceCaution:
    • Sequence=BAG51478.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for CHIT1 Gene

    Alternative splice isoforms for CHIT1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for CHIT1 Gene

Selected DME Specific Peptides for CHIT1 Gene

Q13231:
  • CYFTNWA
  • LCTHLIY
  • DLDWEYP
  • LAIGGWN

Post-translational modifications for CHIT1 Gene

  • Glycosylation at posLast=100100
  • Modification sites at PhosphoSitePlus

Other Protein References for CHIT1 Gene

Antibody Products

  • R&D Systems Antibodies for CHIT1 (Chitotriosidase/CHIT1)
  • Abcam antibodies for CHIT1

Protein Products

  • Abcam proteins for CHIT1

Domains & Families for CHIT1 Gene

Gene Families for CHIT1 Gene

HGNC:
Human Protein Atlas (HPA):
  • Candidate cardiovascular disease genes
  • Enzymes
  • Plasma proteins
  • Predicted secreted proteins

Suggested Antigen Peptide Sequences for CHIT1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q13231

UniProtKB/Swiss-Prot:

CHIT1_HUMAN :
  • Belongs to the glycosyl hydrolase 18 family. Chitinase class II subfamily.
Family:
  • Belongs to the glycosyl hydrolase 18 family. Chitinase class II subfamily.
genes like me logo Genes that share domains with CHIT1: view

Function for CHIT1 Gene

Molecular function for CHIT1 Gene

GENATLAS Biochemistry:
chitinase 1,expressed by macrophages,may be involved in the degradation of chitin containing pathogens,markedly elevated in plasma of Gaucher patients,deficiency in individuals homozygous for a duplication in exon 10.
UniProtKB/Swiss-Prot CatalyticActivity:
Random endo-hydrolysis of N-acetyl-beta-D-glucosaminide (1->4)-beta-linkages in chitin and chitodextrins.
UniProtKB/Swiss-Prot Function:
Degrades chitin, chitotriose and chitobiose. May participate in the defense against nematodes and other pathogens. Isoform 3 has no enzymatic activity.

Enzyme Numbers (IUBMB) for CHIT1 Gene

Phenotypes From GWAS Catalog for CHIT1 Gene

Gene Ontology (GO) - Molecular Function for CHIT1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004553 hydrolase activity, hydrolyzing O-glycosyl compounds IEA,TAS --
GO:0004568 chitinase activity TAS 9748235
GO:0008061 chitin binding TAS,IEA 9748235
GO:0008843 endochitinase activity IDA 19725875
GO:0016787 hydrolase activity IEA --
genes like me logo Genes that share ontologies with CHIT1: view
genes like me logo Genes that share phenotypes with CHIT1: view

Animal Models for CHIT1 Gene

MGI Knock Outs for CHIT1:

Animal Model Products

  • Taconic Biosciences Mouse Models for CHIT1

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Applied Biological Materials Clones for CHIT1
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

No data available for Human Phenotype Ontology , miRNA , Transcription Factor Targets and HOMER Transcription for CHIT1 Gene

Localization for CHIT1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CHIT1 Gene

Secreted. Lysosome. Note=A small proportion is lysosomal.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CHIT1 gene
Compartment Confidence
extracellular 5
lysosome 5
mitochondrion 1
peroxisome 1
nucleus 1
cytosol 1

Gene Ontology (GO) - Cellular Components for CHIT1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region TAS --
GO:0005615 extracellular space TAS,IDA 19725875
GO:0005764 lysosome IEA --
GO:0035580 specific granule lumen TAS --
GO:1904724 tertiary granule lumen TAS --
genes like me logo Genes that share ontologies with CHIT1: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for CHIT1 Gene

Pathways & Interactions for CHIT1 Gene

genes like me logo Genes that share pathways with CHIT1: view

Pathways by source for CHIT1 Gene

Gene Ontology (GO) - Biological Process for CHIT1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000272 polysaccharide catabolic process IEA --
GO:0005975 carbohydrate metabolic process IEA --
GO:0006030 chitin metabolic process IEA --
GO:0006032 chitin catabolic process TAS 9748235
GO:0006955 immune response NAS 9748235
genes like me logo Genes that share ontologies with CHIT1: view

No data available for SIGNOR curated interactions for CHIT1 Gene

Drugs & Compounds for CHIT1 Gene

(13) Drugs for CHIT1 Gene - From: DrugBank, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Isopropyl alcohol Approved Pharma Target 0
N-Acetyl-D-glucosamine Approved Nutra 0
Water Approved Pharma 0
2-(Acetylamino)-2-Deoxy-6-O-Methyl-Alpha-D-Allopyranose Experimental Pharma Target 0
Allosamizoline Experimental Pharma Target 0

(7) Additional Compounds for CHIT1 Gene - From: Novoseek and HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
Chitobiose
  • CBS
  • Chitodextrin
  • Diacetylchitobiose
577-76-4
genes like me logo Genes that share compounds with CHIT1: view

Transcripts for CHIT1 Gene

Unigene Clusters for CHIT1 Gene

Chitinase 1 (chitotriosidase):
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Applied Biological Materials Clones for CHIT1
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

Alternative Splicing Database (ASD) splice patterns (SP) for CHIT1 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7a · 7b ^ 8a · 8b ^ 9 ^ 10 ^ 11 ^ 12a · 12b
SP1: -
SP2: - -
SP3: - - -
SP4: - - -
SP5:
SP6: - - - -

Relevant External Links for CHIT1 Gene

GeneLoc Exon Structure for
CHIT1
ECgene alternative splicing isoforms for
CHIT1

Expression for CHIT1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CHIT1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for CHIT1 Gene

This gene is overexpressed in Whole Blood (x17.2), Lung (x7.9), and Adipose - Subcutaneous (x5.1).

Protein differential expression in normal tissues from HIPED for CHIT1 Gene

This gene is overexpressed in Neutrophil (48.4) and Serum (9.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for CHIT1 Gene



NURSA nuclear receptor signaling pathways regulating expression of CHIT1 Gene:

CHIT1

SOURCE GeneReport for Unigene cluster for CHIT1 Gene:

Hs.201688

mRNA Expression by UniProt/SwissProt for CHIT1 Gene:

Q13231-CHIT1_HUMAN
Tissue specificity: Detected in spleen. Secreted by cultured macrophages.

Evidence on tissue expression from TISSUES for CHIT1 Gene

  • Spleen(4)
  • Blood(2.1)
genes like me logo Genes that share expression patterns with CHIT1: view

Primer Products

No data available for Protein tissue co-expression partners and Phenotype-based relationships between genes and organs from Gene ORGANizer for CHIT1 Gene

Orthologs for CHIT1 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for CHIT1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia CHIT1 33 34
  • 99.07 (n)
rat
(Rattus norvegicus)
Mammalia Chit1 33
  • 79.91 (n)
mouse
(Mus musculus)
Mammalia Chit1 33 16 34
  • 79.53 (n)
cow
(Bos Taurus)
Mammalia CHIT1 33
  • 78.4 (n)
-- 34
  • 44 (a)
ManyToMany
platypus
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 70 (a)
OneToMany
-- 34
  • 65 (a)
OneToMany
-- 34
  • 64 (a)
OneToMany
-- 34
  • 55 (a)
OneToMany
oppossum
(Monodelphis domestica)
Mammalia CHIT1 34
  • 65 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia -- 34
  • 56 (a)
ManyToMany
tropical clawed frog
(Silurana tropicalis)
Amphibia chit1 33
  • 57.28 (n)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.12601 33
fruit fly
(Drosophila melanogaster)
Insecta Cht7 33 34
  • 58.22 (n)
CG1869 35
  • 52 (a)
CG2989 35
  • 41 (a)
CG9307 35
  • 40 (a)
CG10531 35
  • 39 (a)
Cht1 35
  • 39 (a)
Cht3 35
  • 39 (a)
CG9357 35
  • 37 (a)
Cht2 35
  • 34 (a)
CG3044 35
  • 32 (a)
Idgf1 35
  • 29 (a)
Idgf2 35
  • 28 (a)
Chit 35
  • 27 (a)
Idgf3 35
  • 27 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP006898 33
  • 52.76 (n)
worm
(Caenorhabditis elegans)
Secernentea cht-1 35 33 34
  • 50.47 (n)
T01C4.1 35
  • 29 (a)
F07G11.9 35
  • 28 (a)
T13H5.3 35
  • 28 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes CTS2 34
  • 22 (a)
OneToMany
thale cress
(Arabidopsis thaliana)
eudicotyledons AT4G19810 33
  • 44.55 (n)
rice
(Oryza sativa)
Liliopsida Os04g0376400 33
  • 47.12 (n)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.8046 34
  • 29 (a)
OneToMany
Species where no ortholog for CHIT1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • zebrafish (Danio rerio)

Evolution for CHIT1 Gene

ENSEMBL:
Gene Tree for CHIT1 (if available)
TreeFam:
Gene Tree for CHIT1 (if available)

Paralogs for CHIT1 Gene

Paralogs for CHIT1 Gene

(5) SIMAP similar genes for CHIT1 Gene using alignment to 3 proteins:

Pseudogenes.org Pseudogenes for CHIT1 Gene

genes like me logo Genes that share paralogs with CHIT1: view

Variants for CHIT1 Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for CHIT1 Gene

CHIT1_HUMAN-Q13231
A 24 bp duplication in exon 10 leads to the activation of an alternative splice site and the production of an inactive protein resulting in chitotriosidase deficiency [MIM:614122]. About 6% of the population are deficient for CHIT1 activity, while 35% are carriers and show reduced enzyme levels. People with CHIT1 deficiency appear perfectly healthy.

Sequence variations from dbSNP and Humsavar for CHIT1 Gene

SNP ID Clin Chr 01 pos Sequence Context AA Info Type
rs1065761 Likely benign 203,216,965(-) TGCAG(A/C/G/T)GGGGC nc-transcript-variant, reference, missense
rs115551220 Likely benign 203,229,717(+) TGTCC(C/T)ACCCC nc-transcript-variant, utr-variant-5-prime
rs150192398 Likely benign 203,217,822(+) TGCCC(-/AGACCATGGCCCCGCCCAGTCCCT/AGACCATGGCCCCGCCCAGTCTCT/AGACCATGGCCCTGCCCAGTCCCT/GGACCATGGCCCCGCCCAGTCCCT)AGACC intron-variant, nc-transcript-variant, cds-indel
rs73066394 Likely benign 203,216,355(+) GCTTA(A/C)ATCAG nc-transcript-variant, utr-variant-3-prime
rs116389839 Uncertain significance 203,225,878(+) GGCCC(A/G)TTGGA intron-variant

Structural Variations from Database of Genomic Variants (DGV) for CHIT1 Gene

Variant ID Type Subtype PubMed ID
nsv549005 CNV loss 21841781

Variation tolerance for CHIT1 Gene

Residual Variation Intolerance Score: 96.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 16.32; 97.67% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for CHIT1 Gene

Human Gene Mutation Database (HGMD)
CHIT1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
CHIT1

Disorders for CHIT1 Gene

MalaCards: The human disease database

(16) MalaCards diseases for CHIT1 Gene - From: HGMD, GeneTests, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
chitotriosidase deficiency
  • chitotriosidase
gaucher's disease
  • acid beta-glucosidase deficiency
gaucher disease, type i
  • gaucher's disease type i
filariasis
  • disease due to superfamily filarioidea
mycetoma
  • madura foot
- elite association - COSMIC cancer census association via MalaCards
Search CHIT1 in MalaCards View complete list of genes associated with diseases

Relevant External Links for CHIT1

Genetic Association Database (GAD)
CHIT1
Human Genome Epidemiology (HuGE) Navigator
CHIT1
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
CHIT1
genes like me logo Genes that share disorders with CHIT1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for CHIT1 Gene

Publications for CHIT1 Gene

  1. The human chitotriosidase gene. Nature of inherited enzyme deficiency. (PMID: 9748235) Boot RG … Aerts JM (The Journal of biological chemistry 1998) 2 3 4 22 60
  2. Human chitotriosidase polymorphism is associated with human longevity in Mediterranean nonagenarians and centenarians. (PMID: 19881466) Malaguarnera L … Malaguarnera M (Journal of human genetics 2010) 3 22 45 60
  3. Common G102S polymorphism in chitotriosidase differentially affects activity towards 4-methylumbelliferyl substrates. (PMID: 19725875) Bussink AP … Boot RG (The FEBS journal 2009) 3 4 22 60
  4. 24 bp duplication of CHIT1 gene is not correlated with coronary artery disease in Corsica Island (France). (PMID: 17916351) Piras I … Vona G (Experimental and molecular pathology 2007) 3 22 45 60
  5. Human chitotriosidase polymorphisms G354R and A442V associated with reduced enzyme activity. (PMID: 17693102) Lee P … Beutler E (Blood cells, molecules & diseases 2007) 3 22 45 60

Products for CHIT1 Gene

Sources for CHIT1 Gene

Content
Loading form....