Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CFC1 Gene

Aliases for CFC1 Gene

  • Cripto, FRL-1, Cryptic Family 1 2 3 5
  • Heterotaxy 2 (Autosomal Dominant) 2 3
  • Cryptic Family Protein 1 3 4
  • Cryptic Protein 3
  • CFC1B 3
  • DTGA2 3
  • HTX2 3

External Ids for CFC1 Gene

Previous HGNC Symbols for CFC1 Gene

  • HTX2

Previous GeneCards Identifiers for CFC1 Gene

  • GC02P131372
  • GC02M131066
  • GC02M131350
  • GC02M123494

Summaries for CFC1 Gene

Entrez Gene Summary for CFC1 Gene

  • This gene encodes a member of the epidermal growth factor (EGF)- Cripto, Frl-1, and Cryptic (CFC) family, which are involved in signalling during embryonic development. Proteins in this family share a variant EGF-like motif, a conserved cysteine-rich domain, and a C-terminal hydrophobic region. The protein encoded by this gene is necessary for patterning the left-right embryonic axis. Mutations in this gene are associated with defects in organ development, including autosomal visceral heterotaxy and congenital heart disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]

GeneCards Summary for CFC1 Gene

CFC1 (Cripto, FRL-1, Cryptic Family 1) is a Protein Coding gene. Diseases associated with CFC1 include Heterotaxy, Visceral, 2, Autosomal and Transposition Of The Great Arteries, Dextro-Looped 2. Among its related pathways are Signaling by NODAL and Human Embryonic Stem Cell Pluripotency. GO annotations related to this gene include nodal binding. An important paralog of this gene is CFC1B.

UniProtKB/Swiss-Prot for CFC1 Gene

  • NODAL coreceptor involved in the correct establishment of the left-right axis. May play a role in mesoderm and/or neural patterning during gastrulation.

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CFC1 Gene

Genomics for CFC1 Gene

Regulatory Elements for CFC1 Gene

Enhancers for CFC1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH02G130595 0.4 dbSUPER 0.7 +1.3 1341 6.2 RNF2 EZH2 CFC1 GC02P130597
GH02G130601 0.2 dbSUPER 0.7 -2.5 -2532 1.4 CFC1 ENSG00000277668
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around CFC1 on UCSC Golden Path with GeneCards custom track

Genomic Location for CFC1 Gene

130,592,165 bp from pter
130,599,575 bp from pter
7,411 bases
Minus strand

Genomic View for CFC1 Gene

Genes around CFC1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CFC1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CFC1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CFC1 Gene

Proteins for CFC1 Gene

  • Protein details for CFC1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Cryptic protein
    Protein Accession:
    Secondary Accessions:
    • B2RCY0
    • B9EJD3
    • Q53T05
    • Q9GZR3

    Protein attributes for CFC1 Gene

    223 amino acids
    Molecular mass:
    24612 Da
    Quaternary structure:
    No Data Available

neXtProt entry for CFC1 Gene

Post-translational modifications for CFC1 Gene

Other Protein References for CFC1 Gene

No data available for DME Specific Peptides for CFC1 Gene

Domains & Families for CFC1 Gene

Protein Domains for CFC1 Gene

Suggested Antigen Peptide Sequences for CFC1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with CFC1: view

No data available for Gene Families and UniProtKB/Swiss-Prot for CFC1 Gene

Function for CFC1 Gene

Molecular function for CFC1 Gene

UniProtKB/Swiss-Prot Function:
NODAL coreceptor involved in the correct establishment of the left-right axis. May play a role in mesoderm and/or neural patterning during gastrulation.

Gene Ontology (GO) - Molecular Function for CFC1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
GO:0038100 nodal binding IPI 12052855
genes like me logo Genes that share ontologies with CFC1: view

Phenotypes for CFC1 Gene

genes like me logo Genes that share phenotypes with CFC1: view

Human Phenotype Ontology for CFC1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for CFC1 Gene

Localization for CFC1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CFC1 Gene

Cell membrane; Lipid-anchor, GPI-anchor. Secreted. Note=Does not exhibit a typical GPI-signal sequence. The C-ter hydrophilic extension of the GPI-signal sequence reduces the efficiency of processing and could lead to the production of an secreted unprocessed form. This extension is found only in primates.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CFC1 gene
Compartment Confidence
extracellular 4
plasma membrane 3
cytosol 1

Gene Ontology (GO) - Cellular Components for CFC1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005575 cellular_component ND --
GO:0005576 extracellular region IEA --
GO:0005886 plasma membrane IEA --
GO:0016020 membrane IEA --
GO:0031225 anchored component of membrane IEA --
genes like me logo Genes that share ontologies with CFC1: view

Pathways & Interactions for CFC1 Gene

genes like me logo Genes that share pathways with CFC1: view

Pathways by source for CFC1 Gene

Gene Ontology (GO) - Biological Process for CFC1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007275 multicellular organism development IEA --
GO:0007368 determination of left/right symmetry NAS 11062482
GO:0007369 gastrulation IEA --
GO:0038092 nodal signaling pathway IMP 12052855
genes like me logo Genes that share ontologies with CFC1: view

No data available for SIGNOR curated interactions for CFC1 Gene

Drugs & Compounds for CFC1 Gene

No Compound Related Data Available

Transcripts for CFC1 Gene

Unigene Clusters for CFC1 Gene

Cripto, FRL-1, cryptic family 1:
Representative Sequences:

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for CFC1 Gene

No ASD Table

Relevant External Links for CFC1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for CFC1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CFC1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for CFC1 Gene

This gene is overexpressed in Pituitary (x21.2), Pancreas (x14.3), and Brain - Hypothalamus (x9.4).

Protein differential expression in normal tissues from HIPED for CFC1 Gene

This gene is overexpressed in Pancreas (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for CFC1 Gene

Protein tissue co-expression partners for CFC1 Gene

NURSA nuclear receptor signaling pathways regulating expression of CFC1 Gene:


SOURCE GeneReport for Unigene cluster for CFC1 Gene:


Evidence on tissue expression from TISSUES for CFC1 Gene

  • Nervous system(4.4)
  • Lung(4)
  • Pancreas(3.1)
  • Heart(2.3)

Phenotype-based relationships between genes and organs from Gene ORGANizer for CFC1 Gene

Germ Layers:
  • endoderm
  • mesoderm
  • cardiovascular
  • digestive
  • lymphatic
  • reproductive
  • respiratory
  • skeleton
  • urinary
Head and neck:
  • ear
  • aorta
  • heart
  • heart valve
  • intestine
  • kidney
  • large intestine
  • liver
  • pancreas
  • small intestine
  • spleen
  • stomach
  • uterus
  • digit
  • finger
  • foot
  • hand
  • lower limb
  • toe
  • upper limb
  • blood
  • blood vessel
genes like me logo Genes that share expression patterns with CFC1: view

Primer Products

No data available for mRNA Expression by UniProt/SwissProt for CFC1 Gene

Orthologs for CFC1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for CFC1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia CFC1 34
  • 98.95 (n)
-- 35
  • 98 (a)
(Canis familiaris)
Mammalia LOC609557 34
  • 78.99 (n)
-- 35
  • 48 (a)
(Mus musculus)
Mammalia Cfc1 34 35
  • 65.5 (n)
(Rattus norvegicus)
Mammalia Cfc1 34
  • 64.65 (n)
(Monodelphis domestica)
Mammalia -- 35
  • 37 (a)
(Gallus gallus)
Aves CFC1B 34
  • 51.43 (n)
CFC1 35
  • 34 (a)
(Anolis carolinensis)
Reptilia -- 35
  • 31 (a)
(Danio rerio)
Actinopterygii oep 35
  • 29 (a)
Species where no ortholog for CFC1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • cow (Bos Taurus)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CFC1 Gene

Gene Tree for CFC1 (if available)
Gene Tree for CFC1 (if available)

Paralogs for CFC1 Gene

Paralogs for CFC1 Gene

(1) SIMAP similar genes for CFC1 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with CFC1: view

Variants for CFC1 Gene

Sequence variations from dbSNP and Humsavar for CFC1 Gene

SNP ID Clin Chr 02 pos Sequence Context AA Info Type
rs104893611 Pathogenic, Heterotaxy, visceral, 2, autosomal (HTX2) [MIM:605376] 130,597,896(-) CCGGC(C/T)GCTAC intron-variant, downstream-variant-500B, reference, missense
rs746231039 Pathogenic 130,593,027(+) GGCGC(-/G)CCCCC intron-variant, reference, frameshift-variant
rs863223280 Pathogenic 130,597,850(-) GTGCG(-/CAGGTGGGCACAGGGGTGCG)CGGGG intron-variant, downstream-variant-500B
rs199607550 Benign 130,598,922(+) CAAAT(G/T)GATGA intron-variant, reference, missense
rs199715380 Benign 130,597,533(+) CAGGG(C/T)CCCGA intron-variant, downstream-variant-500B, reference, synonymous-codon, missense

Structural Variations from Database of Genomic Variants (DGV) for CFC1 Gene

Variant ID Type Subtype PubMed ID
dgv2032n106 OTHER inversion 24896259
dgv2035n106 CNV duplication 24896259
dgv4074n100 CNV gain 25217958
esv2759092 CNV gain+loss 17122850
esv3592455 CNV loss 21293372
nsv1005664 CNV loss 25217958
nsv1147463 OTHER inversion 26484159
nsv1148026 CNV duplication 26484159
nsv428403 CNV loss 18775914
nsv583134 CNV loss 21841781
nsv7327 OTHER inversion 18451855
nsv961509 CNV duplication 23825009

Variation tolerance for CFC1 Gene

Gene Damage Index Score: 1.18; 23.74% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for CFC1 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CFC1 Gene

Disorders for CFC1 Gene

MalaCards: The human disease database

(14) MalaCards diseases for CFC1 Gene - From: OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search CFC1 in MalaCards View complete list of genes associated with diseases


  • Heterotaxy, visceral, 2, autosomal (HTX2) [MIM:605376]: A form of visceral heterotaxy, a complex disorder due to disruption of the normal left-right asymmetry of the thoracoabdominal organs. Visceral heterotaxy or situs ambiguus results in randomization of the placement of visceral organs, including the heart, lungs, liver, spleen, and stomach. The organs are oriented randomly with respect to the left-right axis and with respect to one another. It can been associated with variety of congenital defects including cardiac malformations. {ECO:0000269 PubMed:11062482, ECO:0000269 PubMed:11799476}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for CFC1

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with CFC1: view

No data available for Genatlas for CFC1 Gene

Publications for CFC1 Gene

  1. Loss-of-function mutations in the EGF-CFC gene CFC1 are associated with human left-right laterality defects. (PMID: 11062482) Bamford R.N. … Casey B. (Nat. Genet. 2000) 2 3 4 22 46 64
  2. CFC1 mutations in patients with transposition of the great arteries and double-outlet right ventricle. (PMID: 11799476) Goldmuntz E. … Muenke M. (Am. J. Hum. Genet. 2002) 3 4 22 64
  3. CFC1 mutations in Chinese children with congenital heart disease. (PMID: 19853937) Wang B. … Ma X. (Int. J. Cardiol. 2011) 3 46 64
  4. Maternal genes and facial clefts in offspring: a comprehensive search for genetic associations in two population-based cleft studies from Scandinavia. (PMID: 20634891) Jugessur A. … Murray J.C. (PLoS ONE 2010) 3 46 64
  5. Characterization of the glycosylphosphatidylinositol-anchor signal sequence of human Cryptic with a hydrophilic extension. (PMID: 18930707) Watanabe K. … Salomon D.S. (Biochim. Biophys. Acta 2008) 3 4 64

Products for CFC1 Gene

Sources for CFC1 Gene

Loading form....