Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CEMP1 Gene

Aliases for CEMP1 Gene

  • Cementum Protein 1 2 3 4 5
  • Cementum Protein-23 2 3
  • Cementum Protein 23 3 4
  • CP-23 3 4
  • CP23 3 4

External Ids for CEMP1 Gene

Summaries for CEMP1 Gene

GeneCards Summary for CEMP1 Gene

CEMP1 (Cementum Protein 1) is a Protein Coding gene. Diseases associated with CEMP1 include coccidiosis and type c thymoma.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CEMP1 Gene

Genomics for CEMP1 Gene

Regulatory Elements for CEMP1 Gene

Enhancers for CEMP1 Gene
GeneHancer Identifier Score Enhancer Sources TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Other Gene Targets for Enhancer

Enhancers around CEMP1 on UCSC Golden Path with GeneCards custom track

Promoters for CEMP1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around CEMP1 on UCSC Golden Path with GeneCards custom track

Genomic Location for CEMP1 Gene

2,530,035 bp from pter
2,531,417 bp from pter
1,383 bases
Minus strand

Genomic View for CEMP1 Gene

Genes around CEMP1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CEMP1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CEMP1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CEMP1 Gene

Proteins for CEMP1 Gene

  • Protein details for CEMP1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Cementoblastoma-derived protein 1
    Protein Accession:
    Secondary Accessions:
    • B2RUY1

    Protein attributes for CEMP1 Gene

    247 amino acids
    Molecular mass:
    25959 Da
    Quaternary structure:
    No Data Available

neXtProt entry for CEMP1 Gene

Proteomics data for CEMP1 Gene at MOPED

Post-translational modifications for CEMP1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for CEMP1 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

No data available for DME Specific Peptides for CEMP1 Gene

Domains & Families for CEMP1 Gene

Protein Domains for CEMP1 Gene


Suggested Antigen Peptide Sequences for CEMP1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with CEMP1: view

No data available for Gene Families and UniProtKB/Swiss-Prot for CEMP1 Gene

Function for CEMP1 Gene

Phenotypes for CEMP1 Gene

GenomeRNAi human phenotypes for CEMP1:
genes like me logo Genes that share phenotypes with CEMP1: view

Animal Model Products

CRISPR Products

miRNA for CEMP1 Gene

miRTarBase miRNAs that target CEMP1

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for CEMP1 Gene

Localization for CEMP1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CEMP1 Gene


Subcellular locations from

Jensen Localization Image for CEMP1 Gene COMPARTMENTS Subcellular localization image for CEMP1 gene
Compartment Confidence
extracellular 2
chloroplast 1
cytosol 1
nucleus 1
peroxisome 1

No data available for Gene Ontology (GO) - Cellular Components for CEMP1 Gene

Pathways & Interactions for CEMP1 Gene

SuperPathways for CEMP1 Gene

No Data Available

Interacting Proteins for CEMP1 Gene

Gene Ontology (GO) - Biological Process for CEMP1 Gene


No data available for Pathways by source and SIGNOR curated interactions for CEMP1 Gene

Drugs & Compounds for CEMP1 Gene

No Compound Related Data Available

Transcripts for CEMP1 Gene

mRNA/cDNA for CEMP1 Gene

(1) REFSEQ mRNAs :
(4) Additional mRNA sequences :
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for CEMP1 Gene

Cementum protein 1:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for CEMP1 Gene

No ASD Table

Relevant External Links for CEMP1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for CEMP1 Gene

mRNA expression in normal human tissues for CEMP1 Gene

Protein differential expression in normal tissues from HIPED for CEMP1 Gene

This gene is overexpressed in Plasma (35.1), Serum (26.6), and Pancreatic juice (7.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for CEMP1 Gene

SOURCE GeneReport for Unigene cluster for CEMP1 Gene Hs.433499

mRNA Expression by UniProt/SwissProt for CEMP1 Gene

Tissue specificity: Detected in periodontal ligament, cementum, cementoblasts and cementoblastoma.
genes like me logo Genes that share expression patterns with CEMP1: view

Protein tissue co-expression partners for CEMP1 Gene

Primer Products

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for CEMP1 Gene

Orthologs for CEMP1 Gene

This gene was present in the common ancestor of human and chimp.

Orthologs for CEMP1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia CEMP1 35
  • 98.52 (n)
  • 96.76 (a)
  • 97 (a)
Species with no ortholog for CEMP1:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • cow (Bos Taurus)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • mouse (Mus musculus)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for CEMP1 Gene

Gene Tree for CEMP1 (if available)
Gene Tree for CEMP1 (if available)

Paralogs for CEMP1 Gene

No data available for Paralogs for CEMP1 Gene

Variants for CEMP1 Gene

Sequence variations from dbSNP and Humsavar for CEMP1 Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
VAR_050792 -
rs747325493 -- 2,530,742(+) TGCCT(-/GGGCAGGGCCTCGCCTGAGGGAGGGCCTG)GGGCA reference, frameshift-variant

Structural Variations from Database of Genomic Variants (DGV) for CEMP1 Gene

Variant ID Type Subtype PubMed ID
esv2422427 CNV Duplication 17116639
dgv2545n71 CNV Loss 21882294
nsv905139 CNV Loss 21882294
dgv2569n71 CNV Loss 21882294
dgv2570n71 CNV Loss 21882294
nsv905149 CNV Loss 21882294
nsv905152 CNV Loss 21882294
nsv905153 CNV Loss 21882294
dgv793e1 CNV Complex 17122850
nsv833122 CNV Loss 17160897
dgv2571n71 CNV Loss 21882294

Variation tolerance for CEMP1 Gene

Residual Variation Intolerance Score: 63.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.04; 37.49% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for CEMP1 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CEMP1 Gene

Disorders for CEMP1 Gene

MalaCards: The human disease database

(2) MalaCards diseases for CEMP1 Gene - From: DISEASES

Disorder Aliases PubMed IDs
  • intestinal coccidiosis
type c thymoma
  • thymoma, type c
- elite association - COSMIC cancer census association via MalaCards
Search CEMP1 in MalaCards View complete list of genes associated with diseases

Relevant External Links for CEMP1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with CEMP1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for CEMP1 Gene

Publications for CEMP1 Gene

  1. Molecular cloning, expression and immunolocalization of a novel human cementum-derived protein (CP-23). (PMID: 16263347) Alvarez-Perez M.A. … Arzate H. (Bone 2006) 2 3 4 67
  2. CEMP1 Induces Transformation in Human Gingival Fibroblasts. (PMID: 26011628) BermA_dez M. … Mercado-Celis G.E. (PLoS ONE 2015) 3
  3. Hypoxia Promotes CEMP1 Expression and Induces Cementoblastic Differentiation of Human Dental Stem Cells in an HIF-1-Dependent Manner. (PMID: 24117017) Choi H. … Choung P.H. (Tissue Eng Part A 2014) 3
  4. Cementum protein 1 (CEMP1) induces a cementoblastic phenotype and reduces osteoblastic differentiation in periodontal ligament cells. (PMID: 21465469) Komaki M. … Morita I. (J. Cell. Physiol. 2012) 3
  5. Human primary cementoblasts respond to combined IL-1I^ stimulation and compression with an impaired BSP and CEMP-1 expression. (PMID: 22349547) Diercke K. … Erber R. (Eur. J. Cell Biol. 2012) 3

Products for CEMP1 Gene

Sources for CEMP1 Gene
