Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CECR1 Gene

Aliases for CECR1 Gene

  • Cat Eye Syndrome Chromosome Region, Candidate 1 2 3
  • Cat Eye Syndrome Critical Region Protein 1 3 4
  • IDGFL 3 4
  • ADA2 3 4
  • ADGF 3 4
  • PAN 3 6
  • Adenosine Deaminase CECR1 3
  • Adenosine Deaminase 2 3
  • EC 3.5.4.4 4
  • SNEDS 3

External Ids for CECR1 Gene

Previous HGNC Symbols for CECR1 Gene

  • IDGFL

Previous GeneCards Identifiers for CECR1 Gene

  • GC22M014604
  • GC22M016034
  • GC22M017660
  • GC22M001478

Summaries for CECR1 Gene

Entrez Gene Summary for CECR1 Gene

  • This gene encodes a member of a subfamily of the adenosine deaminase protein family. The encoded protein is one of two adenosine deaminases found in humans, which regulate levels of the signaling molecule, adenosine. The encoded protein is secreted from monocytes undergoing differentiation and may regulate cell proliferation and differentiation. This gene may be responsible for some of the phenotypic features associated with cat eye syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

GeneCards Summary for CECR1 Gene

CECR1 (Cat Eye Syndrome Chromosome Region, Candidate 1) is a Protein Coding gene. Diseases associated with CECR1 include polyarteritis nodosa, childhood-onset and sneddon syndrome. GO annotations related to this gene include protein homodimerization activity and heparin binding.

UniProtKB/Swiss-Prot for CECR1 Gene

  • Adenosine deaminase that may contribute to the degradation of extracellular adenosine, a signaling molecule that controls a variety of cellular responses. Requires elevated adenosine levels for optimal enzyme activity. Binds to cell surfaces via proteoglycans and may play a role in the regulation of cell proliferation and differentiation, independently of its enzyme activity.

Gene Wiki entry for CECR1 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CECR1 Gene

Genomics for CECR1 Gene

Regulatory Elements for CECR1 Gene

Genomic Location for CECR1 Gene

Start:
17,178,790 bp from pter
End:
17,221,989 bp from pter
Size:
43,200 bases
Orientation:
Minus strand

Genomic View for CECR1 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for CECR1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CECR1 Gene

Proteins for CECR1 Gene

  • Protein details for CECR1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9NZK5-CECR1_HUMAN
    Recommended name:
    Adenosine deaminase CECR1
    Protein Accession:
    Q9NZK5
    Secondary Accessions:
    • A8K9H4
    • Q6ICF1
    • Q86UB6
    • Q8NCJ2
    • Q96K41

    Protein attributes for CECR1 Gene

    Size:
    511 amino acids
    Molecular mass:
    58934 Da
    Cofactor:
    Name=Zn(2+); Xref=ChEBI:CHEBI:29105; Note=Binds 1 zinc ion per subunit.;
    Quaternary structure:
    • Homodimer. Interacts with adenosine receptors. Binds heparin.
    Miscellaneous:
    • Candidate gene for the Cat Eye Syndrome (CES), a developmental disorder associated with the duplication of a 2 Mb region of 22q11.2. Duplication usually takes in the form of a surpernumerary bisatellited isodicentric chromosome, resulting in four copies of the region (represents an inv dup(22)(q11)). CES is characterized clinically by the combination of coloboma of the iris and anal atresia with fistula, downslanting palpebral fissures, preauricular tags and/or pits, frequent occurrence of heart and renal malformations, and normal or near-normal mental development

    Three dimensional structures from OCA and Proteopedia for CECR1 Gene

    Alternative splice isoforms for CECR1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for CECR1 Gene

Proteomics data for CECR1 Gene at MOPED

Post-translational modifications for CECR1 Gene

  • Ubiquitination at Lys55 and Lys296
  • Glycosylation at Asn127, Asn174, Asn185, and Asn378
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for CECR1 Gene

Domains for CECR1 Gene

Protein Domains for CECR1 Gene

Suggested Antigen Peptide Sequences for CECR1 Gene

Graphical View of Domain Structure for InterPro Entry

Q9NZK5

UniProtKB/Swiss-Prot:

CECR1_HUMAN :
  • Q9NZK5
Domain:
  • The PRB domain is involved in receptor binding, and may be responsible for the cytokine-like growth factor activity due to its sharing of several structural properties with chemokines.
  • High-affinity binding to heparin/glycosaminoclycan (GAG) is mediated by a large, highly positively charged surface at the interface of dimers subunits involving approximately residues 30-45, 389-396, and 422-428.
Family:
  • Belongs to the adenosine and AMP deaminases family. ADGF subfamily.
genes like me logo Genes that share domains with CECR1: view

No data available for Gene Families for CECR1 Gene

Function for CECR1 Gene

Molecular function for CECR1 Gene

UniProtKB/Swiss-Prot BiophysicochemicalProperties: Kinetic parameters: KM=2.25 mM for adenosine {ECO:0000269 PubMed:15926889}; pH dependence: Optimum pH is 6.6. {ECO:0000269 PubMed:15926889};
UniProtKB/Swiss-Prot CatalyticActivity: Adenosine + H(2)O = inosine + NH(3).
UniProtKB/Swiss-Prot Function: Adenosine deaminase that may contribute to the degradation of extracellular adenosine, a signaling molecule that controls a variety of cellular responses. Requires elevated adenosine levels for optimal enzyme activity. Binds to cell surfaces via proteoglycans and may play a role in the regulation of cell proliferation and differentiation, independently of its enzyme activity.

Enzyme Numbers (IUBMB) for CECR1 Gene

Gene Ontology (GO) - Molecular Function for CECR1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004000 adenosine deaminase activity IDA 20147294
GO:0008083 growth factor activity NAS 10756095
GO:0008201 heparin binding IEA --
GO:0008270 zinc ion binding IDA 20147294
GO:0019239 deaminase activity --
genes like me logo Genes that share ontologies with CECR1: view
genes like me logo Genes that share phenotypes with CECR1: view

Animal Model Products

CRISPR Products

No data available for Animal Models , miRNA , Transcription Factor Targeting and HOMER Transcription for CECR1 Gene

Localization for CECR1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CECR1 Gene

Secreted.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for CECR1 Gene COMPARTMENTS Subcellular localization image for CECR1 gene
Compartment Confidence
extracellular 5
golgi apparatus 4
lysosome 1

Gene Ontology (GO) - Cellular Components for CECR1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005615 extracellular space IDA 20147294
GO:0005829 NOT cytosol IRD --
genes like me logo Genes that share ontologies with CECR1: view

Pathways for CECR1 Gene

SuperPathways for CECR1 Gene

No Data Available

PCR Array Products

  • Pathway & Disease-focused RT² Profiler PCR Arrays
    • Growth Factors in human,mouse,rat

Gene Ontology (GO) - Biological Process for CECR1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006154 adenosine catabolic process IDA 20147294
GO:0007275 multicellular organismal development NAS 10756095
GO:0008152 metabolic process --
GO:0043103 hypoxanthine salvage IBA --
GO:0046103 inosine biosynthetic process IBA --
genes like me logo Genes that share ontologies with CECR1: view

No data available for Pathways by source for CECR1 Gene

Transcripts for CECR1 Gene

Unigene Clusters for CECR1 Gene

Cat eye syndrome chromosome region, candidate 1:
Representative Sequences:

CRISPR Products

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for CECR1

Primer Products

  • QuantiTect SYBR Green Assays in human,mouse,rat
  • Pre-validated RT² qPCR Primer Assay in human,mouse,rat
  • QuantiFast Probe-based Assays in human,mouse,rat

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for CECR1 Gene

No ASD Table

Relevant External Links for CECR1 Gene

GeneLoc Exon Structure for
CECR1
ECgene alternative splicing isoforms for
CECR1

Expression for CECR1 Gene

mRNA expression in normal human tissues for CECR1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for CECR1 Gene

This gene is overexpressed in Whole Blood (7.9) and Spleen (5.4).

Integrated Proteomics: protein expression from ProteomicsDB, PaxDb, MOPED, and MaxQB for CECR1 Gene

SOURCE GeneReport for Unigene cluster for CECR1 Gene Hs.170310

mRNA Expression by UniProt/SwissProt for CECR1 Gene

Q9NZK5-CECR1_HUMAN
Tissue specificity: Detected in blood plasma (at protein level). Widely expressed, with most abundant expression in human adult heart, lung, lymphoblasts, and placenta as well as fetal lung, liver, and kidney. In embryo, expressed in the outflow tract and atrium of the developing heart, the VII/VIII cranial nerve ganglion, and the notochord.
genes like me logo Genes that share expressions with CECR1: view

In Situ Assay Products

Orthologs for CECR1 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for CECR1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia CECR1 35
  • 99.28 (n)
  • 99.02 (a)
CECR1 36
  • 99 (a)
OneToOne
cow
(Bos Taurus)
Mammalia CECR1 36
  • 67 (a)
OneToOne
dog
(Canis familiaris)
Mammalia CECR1 35
  • 81.04 (n)
  • 72.05 (a)
CECR1 36
  • 71 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia CECR1 36
  • 65 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia CECR1 36
  • 49 (a)
OneToOne
chicken
(Gallus gallus)
Aves CECR1 35
  • 66.59 (n)
  • 59.78 (a)
CECR1 36
  • 56 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia CECR1 36
  • 54 (a)
OneToOne
African clawed frog
(Xenopus laevis)
Amphibia Xl.9687 35
tropical clawed frog
(Silurana tropicalis)
Amphibia cecr1 35
  • 66.38 (n)
  • 63.64 (a)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.12034 35
zebrafish
(Danio rerio)
Actinopterygii cecr1 35
cecr1a 35
  • 57.91 (n)
  • 52.78 (a)
cecr1a 36
  • 50 (a)
OneToMany
cecr1b 36
  • 46 (a)
OneToMany
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP005283 35
  • 48.1 (n)
  • 37.34 (a)
fruit fly
(Drosophila melanogaster)
Insecta Adgf-A 36
  • 37 (a)
OneToMany
Adgf-B 36
  • 36 (a)
OneToMany
Adgf-C 36
  • 37 (a)
OneToMany
Adgf-D 35
  • 51.65 (n)
  • 40.74 (a)
Adgf-D 36
  • 37 (a)
OneToMany
Adgf-E 36
  • 34 (a)
OneToMany
Msi 36
  • 28 (a)
OneToMany
Adgf-C 37
  • 38 (a)
Adgf-B 37
  • 39 (a)
Msi 37
  • 32 (a)
Adgf-A 37
  • 41 (a)
Adgf-D 37
  • 44 (a)
Adgf-E 37
  • 38 (a)
bread mold
(Neurospora crassa)
Ascomycetes NCU04642 35
  • 45.76 (n)
  • 32.87 (a)
Species with no ortholog for CECR1:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • mouse (Mus musculus)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CECR1 Gene

ENSEMBL:
Gene Tree for CECR1 (if available)
TreeFam:
Gene Tree for CECR1 (if available)

Paralogs for CECR1 Gene

No data available for Paralogs for CECR1 Gene

Variants for CECR1 Gene

Sequence variations from dbSNP and Humsavar for CECR1 Gene

SNP ID Clin Chr 22 pos Sequence Context AA Info Type MAF
rs14332 -- 17,179,611(+) ggaat(C/G)ttcca utr-variant-3-prime
rs361858 -- 17,205,143(+) ctccc(C/G)agtag intron-variant
rs361895 -- 17,206,413(+) GATCA(-/GGCTGCTGTGAGCCAAGATCA)CGCCA intron-variant
rs362047 -- 17,206,719(+) actgt(C/G)gcctc intron-variant
rs362129 -- 17,209,519(+) TTGGT(A/G)TTCAG reference, synonymous-codon, intron-variant, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for CECR1 Gene

Variant ID Type Subtype PubMed ID
nsv509805 CNV Insertion 20534489
nsv528777 CNV Loss 19592680
esv2723945 CNV Deletion 23290073
nsv191229 CNV Loss 16902084
esv1443377 CNV Deletion 17803354
esv2673573 CNV Deletion 23128226
nsv519933 CNV Loss 19592680
nsv191400 CNV Loss 16902084

Relevant External Links for CECR1 Gene

HapMap Linkage Disequilibrium report
CECR1
Human Gene Mutation Database (HGMD)
CECR1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CECR1 Gene

Disorders for CECR1 Gene

(1) OMIM Diseases for CECR1 Gene (607575)

UniProtKB/Swiss-Prot

CECR1_HUMAN
  • Polyarteritis nodosa (PAN) [MIM:615688]: A systemic necrotizing vasculitis that affects medium and small arteries. The ensuing tissue ischemia can affect any organ, including the skin, musculoskeletal system, kidneys, gastrointestinal tract, and the cardiovascular and nervous systems. Organ involvement and disease severity are highly variable. Clinical features include recurrent ischemic stroke affecting the small vessels of the brain and resulting in neurologic dysfunction, recurrent fever, myalgias, livedoid rash, gastrointestinal pain and hepatosplenomegaly. {ECO:0000269 PubMed:24552284, ECO:0000269 PubMed:24552285}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Sneddon syndrome (SNDDS) [MIM:182410]: A systemic non-inflammatory thrombotic vasculopathy characterized by the association of livedo racemosa, and in some cases livedo reticularis, with cerebrovascular disease. Livedo racemosa is a persistent net-like violaceous-cyanotic, mottled discoloration of the skin affecting the legs, the arms, the buttocks and the trunk; livedo reticularis is limited to the extremities and is visible only in the cold. Cerebrovascular features include recurrent transient ischemic attacks, infarcts, and rarely spinal strokes or intracranial or subarachnoid hemorrhages. Headache and vertigo may precede the onset of livedo racemosa and cerebrovascular manifestations by several years. Rare neurologic symptoms include seizures, chorea, or myelopathies. {ECO:0000269 PubMed:25075847}. Note=The disease is caused by mutations affecting the gene represented in this entry.

(1) University of Copenhagen DISEASES for CECR1 Gene

Relevant External Links for CECR1

Genetic Association Database (GAD)
CECR1
Human Genome Epidemiology (HuGE) Navigator
CECR1
genes like me logo Genes that share disorders with CECR1: view

Publications for CECR1 Gene

  1. The human homolog of insect-derived growth factor, CECR1, is a candidate gene for features of cat eye syndrome. (PMID: 10756095) Riazi M.A. … McDermid H.E. (Genomics 2000) 2 3 4 23
  2. Structural basis for the growth factor activity of human adenosine deaminase ADA2. (PMID: 20147294) Zavialov A.V. … Zavialov A.V. (J. Biol. Chem. 2010) 3 4
  3. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose J.E. … Uhl G.R. (Mol. Med. 2010) 3 48
  4. Human adenosine deaminase 2 induces differentiation of monocytes into macrophages and stimulates proliferation of T helper cells and macrophages. (PMID: 20453107) Zavialov A.V. … Lauvau G. (J. Leukoc. Biol. 2010) 3 4
  5. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4

Products for CECR1 Gene

Sources for CECR1 Gene

Back to Top

Content