Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CDC16 Gene

Aliases for CDC16 Gene

  • Cell Division Cycle 16 2 3 5
  • Anaphase-Promoting Complex Subunit 6 3 4
  • Cyclosome Subunit 6 3 4
  • CDC16Hs 3 4
  • ANAPC6 3 4
  • APC6 3 4
  • CDC16 (Cell Division Cycle 16, S. Cerevisiae, Homolog) 2
  • CDC16 Cell Division Cycle 16 Homolog (S. Cerevisiae) 2
  • Cell Division Cycle 16 Homolog (S. Cerevisiae) 2
  • Anaphase-Promoting Complex, Subunit 6 3
  • Cell Division Cycle 16 Homolog 3
  • Anaphase-Promoting Complex 2
  • CDC16 Homolog 4
  • Subunit 6 2
  • CUT9 3

External Ids for CDC16 Gene

Previous GeneCards Identifiers for CDC16 Gene

  • GC13P113361
  • GC13P111188
  • GC13P114022
  • GC13P112918
  • GC13P114018
  • GC13P115000
  • GC13P095262

Summaries for CDC16 Gene

Entrez Gene Summary for CDC16 Gene

  • The protein encoded by this gene functions as a protein ubiquitin ligase and is a component of the multiprotein APC complex. The APC complex is a cyclin degradation system that governs exit from mitosis by targeting cell cycle proteins for degredation by the 26S proteasome. Each component protein of the APC complex is highly conserved among eukaryotic organisms. This protein, and other APC complex proteins, contain a tetratricopeptide repeat (TPR) domain; a protein domain that is often involved in protein-protein interactions and the assembly of multiprotein complexes. Multiple alternatively spliced transcript variants, encoding distinct proteins, have been identified. [provided by RefSeq, Jan 2016]

GeneCards Summary for CDC16 Gene

CDC16 (Cell Division Cycle 16) is a Protein Coding gene. Among its related pathways are Immune System and Cellular Senescence.

UniProtKB/Swiss-Prot for CDC16 Gene

  • Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of Lys-11-linked polyubiquitin chains and, to a lower extent, the formation of Lys-48- and Lys-63-linked polyubiquitin chains.

Gene Wiki entry for CDC16 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CDC16 Gene

Genomics for CDC16 Gene

Regulatory Elements for CDC16 Gene

Promoters for CDC16 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around CDC16 on UCSC Golden Path with GeneCards custom track

Genomic Location for CDC16 Gene

Chromosome:
13
Start:
114,234,845 bp from pter
End:
114,272,723 bp from pter
Size:
37,879 bases
Orientation:
Plus strand

Genomic View for CDC16 Gene

Genes around CDC16 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CDC16 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CDC16 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CDC16 Gene

Proteins for CDC16 Gene

  • Protein details for CDC16 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q13042-CDC16_HUMAN
    Recommended name:
    Cell division cycle protein 16 homolog
    Protein Accession:
    Q13042
    Secondary Accessions:
    • A2A365
    • Q5T8C8
    • Q7Z651
    • Q96AE6
    • Q9Y564

    Protein attributes for CDC16 Gene

    Size:
    620 amino acids
    Molecular mass:
    71656 Da
    Quaternary structure:
    • V-shaped homodimer. Interacts with CDC26. The mammalian APC/C is composed of 14 distinct subunits that assemble into a complex of at least 19 chains with a combined molecular mass of around 1.2 MDa. Interacts with PPP5C and CDC20.

    Three dimensional structures from OCA and Proteopedia for CDC16 Gene

    Alternative splice isoforms for CDC16 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for CDC16 Gene

Proteomics data for CDC16 Gene at MOPED

Post-translational modifications for CDC16 Gene

  • Phosphorylated. Phosphorylation on Ser-560 occurs specifically during mitosis.
  • Ubiquitination at Lys 106, Lys 154, and Lys 423
  • Modification sites at PhosphoSitePlus

Antibody Products

  • Cell Signaling Technology (CST) Antibodies for CDC16 (CDC16)

No data available for DME Specific Peptides for CDC16 Gene

Domains & Families for CDC16 Gene

Protein Domains for CDC16 Gene

Suggested Antigen Peptide Sequences for CDC16 Gene

Graphical View of Domain Structure for InterPro Entry

Q13042

UniProtKB/Swiss-Prot:

CDC16_HUMAN :
  • TPR repeats 1-7 mediate homodimerization, while the C-terminal TPR repeats bind to CDC26, burying its hydrophobic N-terminus.
  • Belongs to the APC6/CDC16 family.
  • Contains 14 TPR repeats.
Domain:
  • TPR repeats 1-7 mediate homodimerization, while the C-terminal TPR repeats bind to CDC26, burying its hydrophobic N-terminus.
Family:
  • Belongs to the APC6/CDC16 family.
Similarity:
  • Contains 14 TPR repeats.
genes like me logo Genes that share domains with CDC16: view

Function for CDC16 Gene

Molecular function for CDC16 Gene

UniProtKB/Swiss-Prot Function:
Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of Lys-11-linked polyubiquitin chains and, to a lower extent, the formation of Lys-48- and Lys-63-linked polyubiquitin chains.
genes like me logo Genes that share phenotypes with CDC16: view

Animal Model Products

miRNA for CDC16 Gene

miRTarBase miRNAs that target CDC16

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for CDC16 Gene

Localization for CDC16 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CDC16 Gene

Cytoplasm, cytoskeleton, microtubule organizing center, centrosome. Cytoplasm, cytoskeleton, spindle. Note=Colocalizes with CDC27 to the centrosome at all stages of the cell cycle and to the mitotic spindle.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for CDC16 Gene COMPARTMENTS Subcellular localization image for CDC16 gene
Compartment Confidence
cytoskeleton 5
cytosol 5
nucleus 5
endosome 1
golgi apparatus 1
lysosome 1
mitochondrion 1
plasma membrane 1
vacuole 1

Gene Ontology (GO) - Cellular Components for CDC16 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
GO:0005737 cytoplasm IDA --
GO:0005819 spindle TAS 7736578
GO:0005876 colocalizes_with spindle microtubule IDA 7736578
genes like me logo Genes that share ontologies with CDC16: view

Pathways & Interactions for CDC16 Gene

SuperPathways for CDC16 Gene

Superpath Contained pathways
1 CDK-mediated phosphorylation and removal of Cdc6
2 APC-Cdc20 mediated degradation of Nek2A
3 Cellular Senescence
4 Cell Cycle, Mitotic
.61
5 Mitotic Metaphase and Anaphase
genes like me logo Genes that share pathways with CDC16: view

UniProtKB/Swiss-Prot Q13042-CDC16_HUMAN

  • Pathway: Protein modification; protein ubiquitination.

SIGNOR curated interactions for CDC16 Gene

Is activated by:

Gene Ontology (GO) - Biological Process for CDC16 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007067 mitotic nuclear division IEA --
GO:0007088 regulation of mitotic nuclear division TAS 7736578
GO:0031145 anaphase-promoting complex-dependent catabolic process TAS --
GO:0042787 protein ubiquitination involved in ubiquitin-dependent protein catabolic process TAS --
GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process TAS --
genes like me logo Genes that share ontologies with CDC16: view

Drugs & Compounds for CDC16 Gene

No Compound Related Data Available

Transcripts for CDC16 Gene

Unigene Clusters for CDC16 Gene

Cell division cycle 16:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for CDC16 Gene

ExUns: 1a · 1b · 1c ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8a · 8b ^ 9a · 9b ^ 10 ^ 11 ^ 12a · 12b ^ 13a · 13b ^ 14a · 14b ^ 15a · 15b ^ 16 ^ 17a ·
SP1: - - - - - -
SP2: - - - - - - -
SP3: - - - - - - -
SP4: - - - - - - - - -
SP5: - - - -
SP6: - - - - -
SP7: - - - -
SP8: -
SP9: -
SP10: - - -
SP11: -
SP12:
SP13:
SP14:

ExUns: 17b · 17c · 17d ^ 18a · 18b ^ 19a · 19b · 19c · 19d ^ 20
SP1: - -
SP2: - -
SP3: - -
SP4: - -
SP5: -
SP6: - -
SP7: - - -
SP8:
SP9: - -
SP10: - -
SP11: - -
SP12: -
SP13: - -
SP14:

Relevant External Links for CDC16 Gene

GeneLoc Exon Structure for
CDC16
ECgene alternative splicing isoforms for
CDC16

Expression for CDC16 Gene

mRNA expression in normal human tissues for CDC16 Gene

Protein differential expression in normal tissues from HIPED for CDC16 Gene

This gene is overexpressed in Breast (14.9), NK cells (8.2), and Lung (8.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MOPED, and MaxQB for CDC16 Gene



SOURCE GeneReport for Unigene cluster for CDC16 Gene Hs.374127

genes like me logo Genes that share expression patterns with CDC16: view

Protein tissue co-expression partners for CDC16 Gene

- Elite partner

Primer Products

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for CDC16 Gene

Orthologs for CDC16 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for CDC16 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia CDC16 35
  • 99.3 (n)
  • 100 (a)
CDC16 36
  • 100 (a)
OneToOne
cow
(Bos Taurus)
Mammalia CDC16 36
  • 98 (a)
OneToOne
CDC16 35
  • 90.75 (n)
  • 97.58 (a)
dog
(Canis familiaris)
Mammalia CDC16 35
  • 91.34 (n)
  • 97.9 (a)
CDC16 36
  • 98 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Cdc16 16
Cdc16 35
  • 88.23 (n)
  • 95.48 (a)
Cdc16 36
  • 95 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia CDC16 36
  • 95 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia -- 36
  • 95 (a)
OneToMany
-- 36
  • 92 (a)
OneToMany
rat
(Rattus norvegicus)
Mammalia Cdc16 35
  • 87.1 (n)
  • 95.97 (a)
chicken
(Gallus gallus)
Aves CDC16 36
  • 92 (a)
OneToOne
CDC16 35
  • 83.23 (n)
  • 92.1 (a)
lizard
(Anolis carolinensis)
Reptilia CDC16 36
  • 86 (a)
OneToOne
African clawed frog
(Xenopus laevis)
Amphibia Xl.23806 35
tropical clawed frog
(Silurana tropicalis)
Amphibia cdc16 35
  • 79.61 (n)
  • 88.83 (a)
Str.17391 35
zebrafish
(Danio rerio)
Actinopterygii cdc16 36
  • 80 (a)
OneToOne
cdc16 35
  • 72.29 (n)
  • 81.34 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP004623 35
  • 54.95 (n)
  • 50.75 (a)
fruit fly
(Drosophila melanogaster)
Insecta cdc16 36
  • 36 (a)
OneToOne
cdc16 37
  • 50 (a)
cdc16 35
  • 51.54 (n)
  • 46.67 (a)
worm
(Caenorhabditis elegans)
Secernentea emb-27 36
  • 21 (a)
OneToOne
emb-27 37
  • 24 (a)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_ACR168W 35
  • 46.11 (n)
  • 37.5 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes CDC16 35
  • 46.27 (n)
  • 33.98 (a)
CDC16 36
  • 22 (a)
OneToOne
CDC16 38
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0E08009g 35
  • 45.35 (n)
  • 35.05 (a)
thale cress
(Arabidopsis thaliana)
eudicotyledons APC6 35
  • 52.01 (n)
  • 44.36 (a)
bread mold
(Neurospora crassa)
Ascomycetes NCU01377 35
  • 44.96 (n)
  • 36.24 (a)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes cut9 35
  • 48.75 (n)
  • 37.73 (a)
Species with no ortholog for CDC16:
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for CDC16 Gene

ENSEMBL:
Gene Tree for CDC16 (if available)
TreeFam:
Gene Tree for CDC16 (if available)

Paralogs for CDC16 Gene

No data available for Paralogs for CDC16 Gene

Variants for CDC16 Gene

Sequence variations from dbSNP and Humsavar for CDC16 Gene

SNP ID Clin Chr 13 pos Sequence Context AA Info Type
rs3831159 -- 114,239,081(-) AATTC(-/TCACACATATTTAAGAGATGC)ATAAC intron-variant
rs4325428 -- 114,238,458(+) TGCGA(G/T)CTCCT intron-variant
rs4564451 -- 114,238,318(+) ACACT(C/G)AGGGC intron-variant
rs7321688 -- 114,234,890(+) AAGAG(A/C)CTGGG nc-transcript-variant, upstream-variant-2KB, utr-variant-5-prime
rs7982373 -- 114,241,614(+) AGTTG(A/G)AGCCC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for CDC16 Gene

Variant ID Type Subtype PubMed ID
nsv901106 CNV Gain 21882294
nsv832728 CNV Gain 17160897
nsv901114 CNV Gain 21882294
nsv901115 CNV Gain 21882294
esv25715 CNV Gain+Loss 19812545
nsv521609 CNV Gain 19592680
nsv901116 CNV Gain 21882294
nsv456143 CNV Gain 19166990

Variation tolerance for CDC16 Gene

Residual Variation Intolerance Score: 24.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.48; 10.49% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for CDC16 Gene

HapMap Linkage Disequilibrium report
CDC16

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CDC16 Gene

Disorders for CDC16 Gene

Relevant External Links for CDC16

Genetic Association Database (GAD)
CDC16
Human Genome Epidemiology (HuGE) Navigator
CDC16
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
CDC16

No disorders were found for CDC16 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for CDC16 Gene

Publications for CDC16 Gene

  1. CDC27Hs colocalizes with CDC16Hs to the centrosome and mitotic spindle and is essential for the metaphase to anaphase transition. (PMID: 7736578) Tugendreich S. … Hieter P. (Cell 1995) 2 3 4 23 67
  2. The serine/threonine phosphatase PP5 interacts with CDC16 and CDC27, two tetratricopeptide repeat-containing subunits of the anaphase- promoting complex. (PMID: 9405394) Ollendorff V. … Donoghue D.J. (J. Biol. Chem. 1997) 3 23
  3. Atomic structure of the APC/C and its mechanism of protein ubiquitination. (PMID: 26083744) Chang L. … Barford D. (Nature 2015) 3
  4. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin E.L. … Gygi S.P. (Cell 2015) 3
  5. Panorama of ancient metazoan macromolecular complexes. (PMID: 26344197) Wan C. … Emili A. (Nature 2015) 3

Products for CDC16 Gene

Sources for CDC16 Gene

Back to Top

Content