Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CD163L1 Gene

Aliases for CD163L1 Gene

  • CD163 Molecule Like 1 2 3 5
  • CD163 Antigen-Like 1 2 3 4
  • CD163B 3 4
  • M160 3 4
  • Scavenger Receptor Cysteine-Rich Type 1 Protein M160 3
  • CD163 Molecule-Like 1 2
  • CD163 Antigen B 3
  • CD163b Antigen 4
  • SCARI2 3
  • WC1 3

External Ids for CD163L1 Gene

Previous GeneCards Identifiers for CD163L1 Gene

  • GC12M007399
  • GC12M007507

Summaries for CD163L1 Gene

Entrez Gene Summary for CD163L1 Gene

  • This gene encodes a member of the scavenger receptor cysteine-rich (SRCR) superfamily. Members of this family are secreted or membrane-anchored proteins mainly found in cells associated with the immune system. The SRCR family is defined by a 100-110 amino acid SRCR domain, which may mediate protein-protein interaction and ligand binding. The encoded protein contains twelve SRCR domains, a transmembrane region and a cytoplasmic domain. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]

GeneCards Summary for CD163L1 Gene

CD163L1 (CD163 Molecule Like 1) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include scavenger receptor activity. An important paralog of this gene is CD163.

Additional gene information for CD163L1 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CD163L1 Gene

Genomics for CD163L1 Gene

GeneHancer (GH) Regulatory Elements for CD163L1 Gene

Promoters and enhancers for CD163L1 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH12I007444 Promoter/Enhancer 0.8 EPDnew Ensembl 550.3 +35.8 35795 0.2 IKZF1 CD163L1 LOC100419928
GH12I007439 Promoter/Enhancer 1.7 FANTOM5 Ensembl ENCODE 6.9 +39.9 39924 1.3 PKNOX1 ATF1 ARNT SIN3A POLR2B ELK1 ATF7 ZNF263 SP3 YY2 LOC100419928 CD163L1 PEX5 NANOG PIR47476
GH12I007555 Enhancer 1 FANTOM5 Ensembl ENCODE 6.6 -76.5 -76457 1.6 MEF2D ATF1 LEF1 GABPB1 CEBPG GABPA GC12M007519 CD163L1 CD163 PEX5 SLC2A3
GH12I007500 Promoter/Enhancer 1 EPDnew Ensembl 0.3 -22.5 -22477 4 NFE2 ZNF600 MAFK PRDM1 CD163 ATN1 CD163L1
GH12I007498 Enhancer 0.7 Ensembl ENCODE 0.4 -19.4 -19404 1.8 JUND CTBP1 POLR2A ZEB1 ZBTB17 ATN1 CD163 CD163L1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around CD163L1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CD163L1 gene promoter:

Genomic Locations for CD163L1 Gene

Genomic Locations for CD163L1 Gene
153,414 bases
Minus strand

Genomic View for CD163L1 Gene

Genes around CD163L1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CD163L1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CD163L1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CD163L1 Gene

Proteins for CD163L1 Gene

  • Protein details for CD163L1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Scavenger receptor cysteine-rich type 1 protein M160
    Protein Accession:
    Secondary Accessions:
    • B4E0G7
    • C9JHR7
    • E7EVK4
    • Q2M3B7
    • Q6UWC2

    Protein attributes for CD163L1 Gene

    1453 amino acids
    Molecular mass:
    159239 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for CD163L1 Gene


neXtProt entry for CD163L1 Gene

Post-translational modifications for CD163L1 Gene

  • Glycosylation at Asn42, Asn78, posLast=120120, Asn161, Asn334, Asn377, posLast=441441, Asn548, posLast=637637, Asn972, Asn1013, posLast=10841084, posLast=11041104, Asn1161, Asn1171, posLast=13181318, and Asn1354

No data available for DME Specific Peptides for CD163L1 Gene

Domains & Families for CD163L1 Gene

Gene Families for CD163L1 Gene

Human Protein Atlas (HPA):
  • CD markers
  • Predicted intracellular proteins
  • Predicted membrane proteins

Protein Domains for CD163L1 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with CD163L1: view

No data available for UniProtKB/Swiss-Prot for CD163L1 Gene

Function for CD163L1 Gene

Phenotypes From GWAS Catalog for CD163L1 Gene

Gene Ontology (GO) - Molecular Function for CD163L1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005044 scavenger receptor activity IEA --
genes like me logo Genes that share ontologies with CD163L1: view
genes like me logo Genes that share phenotypes with CD163L1: view

Animal Model Products

miRNA for CD163L1 Gene

miRTarBase miRNAs that target CD163L1

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for CD163L1 Gene

Localization for CD163L1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CD163L1 Gene

Isoform 1: Cell membrane; Single-pass type I membrane protein.
Isoform 2: Cell membrane; Single-pass type I membrane protein.
Isoform 3: Secreted.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CD163L1 gene
Compartment Confidence
plasma membrane 5
extracellular 3
endoplasmic reticulum 1
lysosome 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Centrosome (2)
  • Cytosol (2)
  • Nucleoplasm (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for CD163L1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region IEA --
GO:0005886 plasma membrane IEA --
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with CD163L1: view

Pathways & Interactions for CD163L1 Gene

SuperPathways for CD163L1 Gene

No Data Available

Interacting Proteins for CD163L1 Gene

Selected Interacting proteins: Q9NR16-C163B_HUMAN for CD163L1 Gene via IID

Gene Ontology (GO) - Biological Process for CD163L1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006898 receptor-mediated endocytosis IEA --
genes like me logo Genes that share ontologies with CD163L1: view

No data available for Pathways by source and SIGNOR curated interactions for CD163L1 Gene

Drugs & Compounds for CD163L1 Gene

No Compound Related Data Available

Transcripts for CD163L1 Gene

Unigene Clusters for CD163L1 Gene

CD163 molecule-like 1:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for CD163L1 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8a · 8b ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15 ^ 16 ^ 17 ^ 18 ^ 19 ^ 20
SP1: -
SP2: -

Relevant External Links for CD163L1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for CD163L1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CD163L1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for CD163L1 Gene

This gene is overexpressed in Spleen (x15.4).

Protein differential expression in normal tissues from HIPED for CD163L1 Gene

This gene is overexpressed in Cervix (18.0), Tonsil (9.5), Lymph node (8.6), and Stomach (6.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for CD163L1 Gene

NURSA nuclear receptor signaling pathways regulating expression of CD163L1 Gene:


SOURCE GeneReport for Unigene cluster for CD163L1 Gene:


mRNA Expression by UniProt/SwissProt for CD163L1 Gene:

Tissue specificity: Isoform 1 is highly expressed in the spleen, lymph nodes, thymus, and fetal liver and weakly expressed in bone marrow and no expression was found in peripheral blood leukocytes. Isoform 1 expression is restricted to the monocyte and macrophage cell lines. Isoform 2 is only expressed in spleen.

Evidence on tissue expression from TISSUES for CD163L1 Gene

  • Heart(4.2)
  • Liver(4.1)
  • Lung(4.1)
genes like me logo Genes that share expression patterns with CD163L1: view

No data available for Protein tissue co-expression partners and Phenotype-based relationships between genes and organs from Gene ORGANizer for CD163L1 Gene

Orthologs for CD163L1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for CD163L1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia CD163L1 33 34
  • 99.5 (n)
(Monodelphis domestica)
Mammalia -- 34
  • 50 (a)
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 40 (a)
(Bos Taurus)
Mammalia -- 34
  • 38 (a)
(Mus musculus)
Mammalia Cd163l1 34
  • 37 (a)
(Canis familiaris)
Mammalia -- 34
  • 36 (a)
(Gallus gallus)
Aves -- 34
  • 39 (a)
-- 34
  • 39 (a)
-- 34
  • 38 (a)
-- 34
  • 32 (a)
-- 34
  • 32 (a)
(Danio rerio)
Actinopterygii si:dkey-21h14.12 34
  • 21 (a)
Species where no ortholog for CD163L1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CD163L1 Gene

Gene Tree for CD163L1 (if available)
Gene Tree for CD163L1 (if available)

Paralogs for CD163L1 Gene

Paralogs for CD163L1 Gene

(7) SIMAP similar genes for CD163L1 Gene using alignment to 6 proteins: Pseudogenes for CD163L1 Gene

genes like me logo Genes that share paralogs with CD163L1: view

Variants for CD163L1 Gene

Sequence variations from dbSNP and Humsavar for CD163L1 Gene

SNP ID Clin Chr 12 pos Variation AA Info Type
rs1000024526 -- 7,383,090(-) C/T intron_variant
rs1000025490 -- 7,428,315(-) A/G genic_upstream_transcript_variant, intron_variant
rs1000025764 -- 7,358,403(-) T/C intron_variant
rs1000034712 -- 7,340,724(-) G/A/C genic_downstream_transcript_variant, intron_variant
rs1000089357 -- 7,366,241(-) GGAAAGGGTAGGGGAAAGGG/GGAAAGGG intron_variant

Structural Variations from Database of Genomic Variants (DGV) for CD163L1 Gene

Variant ID Type Subtype PubMed ID
esv1408895 CNV insertion 17803354
esv2745488 CNV deletion 23290073
nsv1115967 CNV insertion 24896259
nsv1116690 CNV tandem duplication 24896259
nsv1122690 CNV deletion 24896259
nsv1148558 CNV duplication 26484159
nsv594 CNV deletion 18451855
nsv595 CNV insertion 18451855
nsv976561 CNV duplication 23825009

Variation tolerance for CD163L1 Gene

Residual Variation Intolerance Score: 41% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.14; 69.39% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CD163L1 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CD163L1 Gene

Disorders for CD163L1 Gene

Additional Disease Information for CD163L1

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology

No disorders were found for CD163L1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for CD163L1 Gene

Publications for CD163L1 Gene

  1. Cloning of a novel scavenger receptor cysteine-rich type I transmembrane molecule (M160) expressed by human macrophages. (PMID: 11086079) Gronlund J … Holmskov U (Journal of immunology (Baltimore, Md. : 1950) 2000) 2 3 4 58
  2. Assignment of CD163B, the gene encoding M160, a novel scavenger receptor, to human chromosome 12p13.3 by in situ hybridization and somatic cell hybrid analysis. (PMID: 11124526) Stover CM … Holmskov U (Cytogenetics and cell genetics 2000) 2 3 22 58
  3. Identification of the CD163 protein domains involved in infection of the porcine reproductive and respiratory syndrome virus. (PMID: 20032174) Van Gorp H … Nauwynck HJ (Journal of virology 2010) 3 4 58
  4. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 44 58
  5. Signal peptide prediction based on analysis of experimentally verified cleavage sites. (PMID: 15340161) Zhang Z … Henzel WJ (Protein science : a publication of the Protein Society 2004) 3 4 58

Products for CD163L1 Gene

Sources for CD163L1 Gene

Loading form....