Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CCL15 Gene

Aliases for CCL15 Gene

  • C-C Motif Chemokine Ligand 15 2 3
  • Macrophage Inflammatory Protein 5 2 3 4
  • Chemokine (C-C Motif) Ligand 15 2 3 5
  • Chemokine CC-2 2 3 4
  • MIP-1 Delta 2 3 4
  • Small Inducible Cytokine Subfamily A (Cys-Cys), Member 15 2 3
  • Small-Inducible Cytokine A15 3 4
  • Leukotactin 1 2 3
  • MRP-2B 3 4
  • SCYA15 3 4
  • HCC-2 3 4
  • LKN-1 3 4
  • MIP-5 3 4
  • NCC-3 3 4
  • NCC3 3 4
  • New CC Chemokine 3 3
  • CC Chemokine 3 2
  • Leukotactin-1 4
  • HMRP-2B 3
  • MIP-1D 3
  • SCYL3 3
  • LKN1 3
  • SY15 3
  • MIP5 4

External Ids for CCL15 Gene

Previous HGNC Symbols for CCL15 Gene

  • SCYA15

Previous GeneCards Identifiers for CCL15 Gene

  • GC17U990091
  • GC17M036348
  • GC17M034160
  • GC17M034458
  • GC17M034460
  • GC17M031336
  • GC17M034312
  • GC17M030509
  • GC17M034315
  • GC17M034345
  • GC17M034391

Summaries for CCL15 Gene

Entrez Gene Summary for CCL15 Gene

  • This gene is located in a cluster of similar genes in the same region of chromosome 17. These genes encode CC cytokines, which are secreted proteins characterized by two adjacent cysteines. The product of this gene is chemotactic for T cells and monocytes, and acts through C-C chemokine receptor type 1 (CCR1). The proprotein is further processed into numerous smaller functional peptides. Naturally-occurring readthrough transcripts occur from this gene into the downstream gene, CCL14 (chemokine (C-C motif) ligand 14). [provided by RefSeq, Jan 2013]

GeneCards Summary for CCL15 Gene

CCL15 (C-C Motif Chemokine Ligand 15) is a Protein Coding gene. Among its related pathways are ERK Signaling and Integrin Pathway. GO annotations related to this gene include receptor binding and chemokine activity. An important paralog of this gene is CCL15-CCL14.

UniProtKB/Swiss-Prot for CCL15 Gene

  • Chemotactic factor that attracts T-cells and monocytes, but not neutrophils, eosinophils, or B-cells. Acts mainly via CC chemokine receptor CCR1. Also binds to CCR3. CCL15(22-92), CCL15(25-92) and CCL15(29-92) are more potent chemoattractants than the small-inducible cytokine A15.

No data available for Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CCL15 Gene

Genomics for CCL15 Gene

Regulatory Elements for CCL15 Gene

Promoters for CCL15 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around CCL15 on UCSC Golden Path with GeneCards custom track

Genomic Location for CCL15 Gene

35,996,440 bp from pter
36,002,038 bp from pter
5,599 bases
Minus strand

Genomic View for CCL15 Gene

Genes around CCL15 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CCL15 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CCL15 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CCL15 Gene

Proteins for CCL15 Gene

  • Protein details for CCL15 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    C-C motif chemokine 15
    Protein Accession:
    Secondary Accessions:
    • B2RU34
    • E1P651
    • Q9UM74

    Protein attributes for CCL15 Gene

    113 amino acids
    Molecular mass:
    12248 Da
    Quaternary structure:
    • Monomer.

    Three dimensional structures from OCA and Proteopedia for CCL15 Gene

neXtProt entry for CCL15 Gene

Proteomics data for CCL15 Gene at MOPED

Post-translational modifications for CCL15 Gene

No Post-translational modifications

Other Protein References for CCL15 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • R&D Systems Antibodies for CCL15 (CCL15/MIP-1 delta)

No data available for DME Specific Peptides for CCL15 Gene

Domains & Families for CCL15 Gene

Gene Families for CCL15 Gene

Protein Domains for CCL15 Gene

Suggested Antigen Peptide Sequences for CCL15 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the intercrine beta (chemokine CC) family.
  • Belongs to the intercrine beta (chemokine CC) family.
genes like me logo Genes that share domains with CCL15: view

Function for CCL15 Gene

Molecular function for CCL15 Gene

UniProtKB/Swiss-Prot Function:
Chemotactic factor that attracts T-cells and monocytes, but not neutrophils, eosinophils, or B-cells. Acts mainly via CC chemokine receptor CCR1. Also binds to CCR3. CCL15(22-92), CCL15(25-92) and CCL15(29-92) are more potent chemoattractants than the small-inducible cytokine A15.

Gene Ontology (GO) - Molecular Function for CCL15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0048020 CCR chemokine receptor binding IBA --
genes like me logo Genes that share ontologies with CCL15: view
genes like me logo Genes that share phenotypes with CCL15: view

Animal Model Products

  • Taconic Biosciences Mouse Models for CCL15

CRISPR Products

miRNA for CCL15 Gene

miRTarBase miRNAs that target CCL15

Inhibitory RNA Products

In Situ Assay Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for CCL15 Gene

Localization for CCL15 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CCL15 Gene


Subcellular locations from

Jensen Localization Image for CCL15 Gene COMPARTMENTS Subcellular localization image for CCL15 gene
Compartment Confidence
extracellular 5

No data available for Gene Ontology (GO) - Cellular Components for CCL15 Gene

Pathways & Interactions for CCL15 Gene

genes like me logo Genes that share pathways with CCL15: view

Interacting Proteins for CCL15 Gene

Selected Interacting proteins: Q16663-CCL15_HUMAN for CCL15 Gene via I2D

Gene Ontology (GO) - Biological Process for CCL15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002548 monocyte chemotaxis IBA --
GO:0006874 cellular calcium ion homeostasis TAS 9346309
GO:0006955 immune response IEA --
GO:0007165 signal transduction TAS 9548457
GO:0007186 G-protein coupled receptor signaling pathway IBA --
genes like me logo Genes that share ontologies with CCL15: view

No data available for SIGNOR curated interactions for CCL15 Gene

Drugs & Compounds for CCL15 Gene

(5) Drugs for CCL15 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(1) Additional Compounds for CCL15 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with CCL15: view

Transcripts for CCL15 Gene

mRNA/cDNA for CCL15 Gene

Unigene Clusters for CCL15 Gene

Chemokine (C-C motif) ligand 15:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for CCL15 Gene

No ASD Table

Relevant External Links for CCL15 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for CCL15 Gene

mRNA expression in normal human tissues for CCL15 Gene

mRNA differential expression in normal tissues according to GTEx for CCL15 Gene

This gene is overexpressed in Colon - Transverse (x14.0), Liver (x12.2), Small Intestine - Terminal Ileum (x8.2), Kidney - Cortex (x6.2), and Bladder (x4.8).

Protein differential expression in normal tissues from HIPED for CCL15 Gene

This gene is overexpressed in Rectum (56.3) and Kidney (12.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for CCL15 Gene

SOURCE GeneReport for Unigene cluster for CCL15 Gene Hs.272493

mRNA Expression by UniProt/SwissProt for CCL15 Gene

Tissue specificity: Most abundant in heart, skeletal muscle and adrenal gland. Lower levels in placenta, liver, pancreas and bone marrow. CCL15(22-92), CCL15(25-92) and CCL15(29-92) are found in high levels in synovial fluids from rheumatoid patients.
genes like me logo Genes that share expression patterns with CCL15: view

Protein tissue co-expression partners for CCL15 Gene

Primer Products

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery for CCL15 Gene

Orthologs for CCL15 Gene

This gene was present in the common ancestor of human and chimp.

Orthologs for CCL15 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia CCL15 35
  • 97.94 (n)
  • 97.35 (a)
Species with no ortholog for CCL15:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • cow (Bos Taurus)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • mouse (Mus musculus)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for CCL15 Gene

Gene Tree for CCL15 (if available)
Gene Tree for CCL15 (if available)

Paralogs for CCL15 Gene

(22) SIMAP similar genes for CCL15 Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with CCL15: view

Variants for CCL15 Gene

Sequence variations from dbSNP and Humsavar for CCL15 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
VAR_011640 -
rs748459425 -- 35,998,365(+) GGAGG(-/TGCAGCAGTCAGCAGCAAAGTGAAAGCC)TGCAG splice-acceptor-variant

Structural Variations from Database of Genomic Variants (DGV) for CCL15 Gene

Variant ID Type Subtype PubMed ID
nsv833424 CNV Gain 17160897
nsv833427 CNV Loss 17160897
dgv945e1 CNV Complex 17122850
nsv428340 CNV Gain 18775914
dgv946e1 CNV Complex 17122850

Variation tolerance for CCL15 Gene

Residual Variation Intolerance Score: 88.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.34; 7.49% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for CCL15 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CCL15 Gene

Disorders for CCL15 Gene

Relevant External Links for CCL15

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for CCL15 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for CCL15 Gene

Publications for CCL15 Gene

  1. HCC-2, a human chemokine: gene structure, expression pattern, and biological activity. (PMID: 9600961) Pardigol A. … Maegert H.-J. (Proc. Natl. Acad. Sci. U.S.A. 1998) 3 4 23 67
  2. A YAC contig of the human CC chemokine genes clustered on chromosome 17q11.2. (PMID: 8661057) Naruse K. … Miura R. (Genomics 1996) 2 3 23
  3. A novel role for constitutively expressed epithelial-derived chemokines as antibacterial peptides in the intestinal mucosa. (PMID: 19812544) Kotarsky K. … Agace W.W. (Mucosal Immunol 2010) 3 23
  4. Mycobacterium tuberculosis-induced expression of Leukotactin-1 is mediated by the PI3-K/PDK1/Akt signaling pathway. (PMID: 20016943) Cho J.E. … Lee H. (Mol. Cells 2010) 3 23
  5. Human LZIP induces monocyte CC chemokine receptor 2 expression leading to enhancement of monocyte chemoattractant protein 1/CCL2- induced cell migration. (PMID: 18587271) Sung H.J. … Ko J. (Exp. Mol. Med. 2008) 3 23

Products for CCL15 Gene

Sources for CCL15 Gene

Back to Top
