Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CCL15 Gene

Aliases for CCL15 Gene

  • C-C Motif Chemokine Ligand 15 2 3 5
  • Macrophage Inflammatory Protein 5 2 3 4
  • Chemokine CC-2 2 3 4
  • MIP-1 Delta 2 3 4
  • Small Inducible Cytokine Subfamily A (Cys-Cys), Member 15 2 3
  • Chemokine (C-C Motif) Ligand 15 2 3
  • Small-Inducible Cytokine A15 3 4
  • Leukotactin 1 2 3
  • MRP-2B 3 4
  • SCYA15 3 4
  • HCC-2 3 4
  • LKN-1 3 4
  • MIP-5 3 4
  • NCC-3 3 4
  • NCC3 3 4
  • C-C Motif Chemokine 15 3
  • New CC Chemokine 3 3
  • CC Chemokine 3 2
  • Leukotactin-1 4
  • HMRP-2B 3
  • MIP-1D 3
  • SCYL3 3
  • LKN1 3
  • SY15 3
  • MIP5 4

External Ids for CCL15 Gene

Previous HGNC Symbols for CCL15 Gene

  • SCYA15

Previous GeneCards Identifiers for CCL15 Gene

  • GC17U990091
  • GC17M036348
  • GC17M034160
  • GC17M034458
  • GC17M034460
  • GC17M031336
  • GC17M034312
  • GC17M030509
  • GC17M034315
  • GC17M034345
  • GC17M034391

Summaries for CCL15 Gene

Entrez Gene Summary for CCL15 Gene

  • This gene is located in a cluster of similar genes in the same region of chromosome 17. These genes encode CC cytokines, which are secreted proteins characterized by two adjacent cysteines. The product of this gene is chemotactic for T cells and monocytes, and acts through C-C chemokine receptor type 1 (CCR1). The proprotein is further processed into numerous smaller functional peptides. Naturally-occurring readthrough transcripts occur from this gene into the downstream gene, CCL14 (chemokine (C-C motif) ligand 14). [provided by RefSeq, Jan 2013]

GeneCards Summary for CCL15 Gene

CCL15 (C-C Motif Chemokine Ligand 15) is a Protein Coding gene. Among its related pathways are PEDF Induced Signaling and TGF-Beta Pathway. GO annotations related to this gene include receptor binding and chemokine activity. An important paralog of this gene is CCL15-CCL14.

UniProtKB/Swiss-Prot for CCL15 Gene

  • Chemotactic factor that attracts T-cells and monocytes, but not neutrophils, eosinophils, or B-cells. Acts mainly via CC chemokine receptor CCR1. Also binds to CCR3. CCL15(22-92), CCL15(25-92) and CCL15(29-92) are more potent chemoattractants than the small-inducible cytokine A15.

No data available for Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CCL15 Gene

Genomics for CCL15 Gene

Regulatory Elements for CCL15 Gene

Enhancers for CCL15 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
- Elite enhancer/Elite enhancer-gene association

Enhancers around CCL15 on UCSC Golden Path with GeneCards custom track

Genomic Location for CCL15 Gene

Chromosome:
17
Start:
35,996,440 bp from pter
End:
36,002,038 bp from pter
Size:
5,599 bases
Orientation:
Minus strand

Genomic View for CCL15 Gene

Genes around CCL15 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CCL15 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CCL15 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CCL15 Gene

Proteins for CCL15 Gene

  • Protein details for CCL15 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q16663-CCL15_HUMAN
    Recommended name:
    C-C motif chemokine 15
    Protein Accession:
    Q16663
    Secondary Accessions:
    • B2RU34
    • E1P651
    • Q9UM74

    Protein attributes for CCL15 Gene

    Size:
    113 amino acids
    Molecular mass:
    12248 Da
    Quaternary structure:
    • Monomer.

    Three dimensional structures from OCA and Proteopedia for CCL15 Gene

neXtProt entry for CCL15 Gene

Post-translational modifications for CCL15 Gene

No Post-translational modifications

Other Protein References for CCL15 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • R&D Systems Antibodies for CCL15 (CCL15/MIP-1 delta)
  • Cloud-Clone Corp. Antibodies for CCL15

No data available for DME Specific Peptides for CCL15 Gene

Domains & Families for CCL15 Gene

Gene Families for CCL15 Gene

Protein Domains for CCL15 Gene

Suggested Antigen Peptide Sequences for CCL15 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q16663

UniProtKB/Swiss-Prot:

CCL15_HUMAN :
  • Belongs to the intercrine beta (chemokine CC) family.
Family:
  • Belongs to the intercrine beta (chemokine CC) family.
genes like me logo Genes that share domains with CCL15: view

Function for CCL15 Gene

Molecular function for CCL15 Gene

UniProtKB/Swiss-Prot Function:
Chemotactic factor that attracts T-cells and monocytes, but not neutrophils, eosinophils, or B-cells. Acts mainly via CC chemokine receptor CCR1. Also binds to CCR3. CCL15(22-92), CCL15(25-92) and CCL15(29-92) are more potent chemoattractants than the small-inducible cytokine A15.

Gene Ontology (GO) - Molecular Function for CCL15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005102 receptor binding TAS 9346309
GO:0008009 chemokine activity IEA --
GO:0008201 heparin binding IEA --
GO:0042056 chemoattractant activity IDA 15001559
GO:0048020 CCR chemokine receptor binding IBA --
genes like me logo Genes that share ontologies with CCL15: view
genes like me logo Genes that share phenotypes with CCL15: view

Animal Model Products

CRISPR Products

miRNA for CCL15 Gene

miRTarBase miRNAs that target CCL15

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for CCL15 Gene

Localization for CCL15 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CCL15 Gene

Secreted.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for CCL15 Gene COMPARTMENTS Subcellular localization image for CCL15 gene
Compartment Confidence
extracellular 5

Gene Ontology (GO) - Cellular Components for CCL15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005615 extracellular space IEA --
GO:0005623 cell IEA --
genes like me logo Genes that share ontologies with CCL15: view

Pathways & Interactions for CCL15 Gene

genes like me logo Genes that share pathways with CCL15: view

Interacting Proteins for CCL15 Gene

Selected Interacting proteins: Q16663-CCL15_HUMAN for CCL15 Gene via IID

Gene Ontology (GO) - Biological Process for CCL15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002548 monocyte chemotaxis IBA --
GO:0006874 cellular calcium ion homeostasis TAS 9346309
GO:0006935 chemotaxis TAS 9600961
GO:0006954 inflammatory response IBA --
GO:0007165 signal transduction TAS 9548457
genes like me logo Genes that share ontologies with CCL15: view

No data available for SIGNOR curated interactions for CCL15 Gene

Drugs & Compounds for CCL15 Gene

(5) Drugs for CCL15 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(1) Additional Compounds for CCL15 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with CCL15: view

Transcripts for CCL15 Gene

mRNA/cDNA for CCL15 Gene

Unigene Clusters for CCL15 Gene

Chemokine (C-C motif) ligand 15:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for CCL15 Gene

No ASD Table

Relevant External Links for CCL15 Gene

GeneLoc Exon Structure for
CCL15
ECgene alternative splicing isoforms for
CCL15

Expression for CCL15 Gene

mRNA expression in normal human tissues for CCL15 Gene

mRNA differential expression in normal tissues according to GTEx for CCL15 Gene

This gene is overexpressed in Colon - Transverse (x14.0), Liver (x12.2), Small Intestine - Terminal Ileum (x8.2), Kidney - Cortex (x6.2), and Bladder (x4.8).

Protein differential expression in normal tissues from HIPED for CCL15 Gene

This gene is overexpressed in Rectum (56.3) and Kidney (12.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for CCL15 Gene



Protein tissue co-expression partners for CCL15 Gene

NURSA nuclear receptor signaling pathways regulating expression of CCL15 Gene:

CCL15

SOURCE GeneReport for Unigene cluster for CCL15 Gene:

Hs.272493

mRNA Expression by UniProt/SwissProt for CCL15 Gene:

Q16663-CCL15_HUMAN
Tissue specificity: Most abundant in heart, skeletal muscle and adrenal gland. Lower levels in placenta, liver, pancreas and bone marrow. CCL15(22-92), CCL15(25-92) and CCL15(29-92) are found in high levels in synovial fluids from rheumatoid patients.
genes like me logo Genes that share expression patterns with CCL15: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery for CCL15 Gene

Orthologs for CCL15 Gene

This gene was present in the common ancestor of human and chimp.

Orthologs for CCL15 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia CCL15 34
  • 97.94 (n)
  • 97.35 (a)
Species where no ortholog for CCL15 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • cow (Bos Taurus)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • mouse (Mus musculus)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for CCL15 Gene

ENSEMBL:
Gene Tree for CCL15 (if available)
TreeFam:
Gene Tree for CCL15 (if available)

Paralogs for CCL15 Gene

Paralogs for CCL15 Gene

(22) SIMAP similar genes for CCL15 Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with CCL15: view

Variants for CCL15 Gene

Sequence variations from dbSNP and Humsavar for CCL15 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
VAR_011640 -
rs748459425 -- 35,998,365(+) GGAGG(-/TGCAGCAGTCAGCAGCAAAGTGAAAGCC)TGCAG splice-acceptor-variant

Structural Variations from Database of Genomic Variants (DGV) for CCL15 Gene

Variant ID Type Subtype PubMed ID
esv3640462 CNV gain 21293372
nsv1055760 CNV gain 25217958
nsv1059795 CNV gain 25217958
nsv833424 CNV gain 17160897
nsv833427 CNV loss 17160897

Variation tolerance for CCL15 Gene

Residual Variation Intolerance Score: 88.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.34; 7.49% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for CCL15 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
CCL15

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CCL15 Gene

Disorders for CCL15 Gene

Relevant External Links for CCL15

Genetic Association Database (GAD)
CCL15
Human Genome Epidemiology (HuGE) Navigator
CCL15
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
CCL15

No disorders were found for CCL15 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for CCL15 Gene

Publications for CCL15 Gene

  1. Proteolytic activation of alternative CCR1 ligands in inflammation. (PMID: 15905581) Berahovich R.D. … Schall T.J. (J. Immunol. 2005) 3 4 22 65
  2. Organization of the chemokine gene cluster on human chromosome 17q11.2 containing the genes for CC chemokine MPIF-1, HCC-2, LEC, and RANTES. (PMID: 10213461) Nomiyama H. … Yoshie O. (J. Interferon Cytokine Res. 1999) 3 4 22 65
  3. Solution structure of the human CC chemokine 2: A monomeric representative of the CC chemokine subtype. (PMID: 10320325) Sticht H. … Adermann K. (Biochemistry 1999) 3 4 22 65
  4. Characterization of CKbeta8 and CKbeta8-1: two alternatively spliced forms of human beta-chemokine, chemoattractants for neutrophils, monocytes, and lymphocytes, and potent agonists at CC chemokine receptor 1. (PMID: 9558365) Youn B.-S. … Kwon B.S. (Blood 1998) 3 4 22 65
  5. HCC-2, a human chemokine: gene structure, expression pattern, and biological activity. (PMID: 9600961) Pardigol A. … Maegert H.-J. (Proc. Natl. Acad. Sci. U.S.A. 1998) 3 4 22 65

Products for CCL15 Gene

Sources for CCL15 Gene

Content