Aliases for CAVIN4 Gene
Aliases for CAVIN4 Gene
External Ids for CAVIN4 Gene
- HGNC: 33742
- Entrez Gene: 347273
- Ensembl: ENSG00000170681
- UniProtKB: Q5BKX8
Previous HGNC Symbols for CAVIN4 Gene
- MURC
Summaries for CAVIN4 Gene
-
This gene encodes a protein containing two coiled-coil regions. The encoded protein promotes Rho/ROCK (Rho-kinase) signaling in cardiac muscles cells, and may facilitate myofibrillar organization. [provided by RefSeq, Jun 2013]
GeneCards Summary for CAVIN4 Gene
CAVIN4 (Caveolae Associated Protein 4) is a Protein Coding gene. Diseases associated with CAVIN4 include Bejel. An important paralog of this gene is CAVIN2.
UniProtKB/Swiss-Prot for CAVIN4 Gene
-
Induces RHOA activation and activates NPPA transcription and myofibrillar organization through the Rho/ROCK signaling pathway.
No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CAVIN4 Gene
Genomics for CAVIN4 Gene
Regulatory Elements for CAVIN4 Gene
Enhancers for CAVIN4 Gene
| GeneHancer Identifier | Enhancer Score | Enhancer Sources | Gene-Enhancer Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites within enhancer | Gene Targets for Enhancer |
|---|---|---|---|---|---|---|---|---|
| GH09G100600 | 0.9 | Ensembl ENCODE | 18.6 | +24.4 | 24353 | 1.8 | CTCF ZNF654 SAP130 TRIM22 ZEB2 RAD21 TEAD3 NFIC RFXANK SMC3 | CAVIN4 TMEFF1 INVS RN7SKP87 GC09M100582 PIR40273 |
| GH09G100598 | 1.2 | Ensembl ENCODE | 11.4 | +22.0 | 22012 | 1.4 | RB1 ARID4B SIN3A ZNF48 YY1 ETS1 ELK1 SCRT2 RCOR1 U2AF2 | CAVIN4 MSANTD3 RN7SKP87 GC09M100582 PIR40273 |
| GH09G100586 | 0.5 | ENCODE | 22.5 | +10.5 | 10489 | 1.3 | SOX13 JUND GATA2 FOS RARA | CAVIN4 TMEFF1 MSANTD3-TMEFF1 MSANTD3 GC09M100582 RN7SKP87 PIR40273 |
| GH09G100589 | 0.6 | ENCODE | 16.5 | +13.6 | 13597 | 1.6 | JUND ATF3 POLR2A JUN BHLHE40 NFE2 FOS | TMEFF1 CAVIN4 MSANTD3-TMEFF1 MSANTD3 RN7SKP87 GC09M100582 PIR40273 |
| GH09G100577 | 0.4 | ENCODE | 23 | +3.7 | 3729 | 6.0 | ZNF24 | CAVIN4 TMEFF1 RN7SKP87 GC09M100582 |
- Elite enhancer and/or Elite enhancer-gene association
Download GeneHancer data dump
Enhancers around CAVIN4 on UCSC Golden Path with GeneCards custom track
Regulatory Element Products
Genomic Location for CAVIN4 Gene
- Chromosome:
- 9
- Start:
- 100,576,867 bp from pter
- End:
- 100,588,402 bp from pter
- Size:
- 11,536 bases
- Orientation:
- Plus strand
Genomic View for CAVIN4 Gene
Genes around CAVIN4 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 9q31.1 by Ensembl
- 9q31.1 by Entrez Gene
- 9q31.1 by HGNC
CAVIN4 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for CAVIN4 Gene
Proteins for CAVIN4 Gene
-
Protein details for CAVIN4 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q5BKX8-MURC_HUMAN
- Recommended name:
- Muscle-related coiled-coil protein
- Protein Accession:
- Q5BKX8
- B1PRL3
- B4DT88
Protein attributes for CAVIN4 Gene
- Size:
- 364 amino acids
- Molecular mass:
- 41899 Da
- Quaternary structure:
-
- Interacts with SDPR; this augments the transactivation of NPPA.
- SequenceCaution:
-
- Sequence=AAH90888.1; Type=Erroneous initiation; Evidence={ECO:0000305};
Post-translational modifications for CAVIN4 Gene
Other Protein References for CAVIN4 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- Novus Biologicals Antibodies for CAVIN4
-
Abcam antibodies for CAVIN4
- Invitrogen Antibodies for CAVIN4
- antibodies-online Antibodies for CAVIN4: See all 17
- Search GeneTex for Antibodies for CAVIN4
Protein Products
-
OriGene Purified Proteins for CAVIN4
- Search Origene for MassSpec and Protein Over-expression Lysates for CAVIN4
- Origene Custom Protein Services for CAVIN4
- Novus Biologicals proteins for CAVIN4
- antibodies-online Proteins for CAVIN4: See all 8
- Search antibodies-online for peptides
- Search GeneTex for Proteins for CAVIN4
-
Abcam proteins for CAVIN4
Assay Products
- antibodies-online Kits for CAVIN4: See all 4
No data available for DME Specific Peptides for CAVIN4 Gene
Domains & Families for CAVIN4 Gene
Gene Families for CAVIN4 Gene
- HGNC:
Suggested Antigen Peptide Sequences for CAVIN4 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
Q5BKX8- Family:
-
- Belongs to the PTRF/SDPR family.
Function for CAVIN4 Gene
Molecular function for CAVIN4 Gene
- UniProtKB/Swiss-Prot Function:
- Induces RHOA activation and activates NPPA transcription and myofibrillar organization through the Rho/ROCK signaling pathway.
Phenotypes for CAVIN4 Gene
- MGI mutant phenotypes for CAVIN4:
- inferred from 2 alleles
- GenomeRNAi human phenotypes for CAVIN4:
Animal Models for CAVIN4 Gene
- MGI Knock Outs for CAVIN4:
-
- Murc tm1.2Tue
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for CAVIN4
-
-
ViGene Biosciences lentiviral particle packaged cDNA for CAVIN4 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for CAVIN4 gene
- Search ViGene Biosciences for CAVIN4
CRISPR Products
-
OriGene CRISPR knockouts for CAVIN4
- GenScript: Design CRISPR guide RNA sequences for CAVIN4
miRNA for CAVIN4 Gene
- miRTarBase miRNAs that target CAVIN4
-
- hsa-mir-377-3p (MIRT608021)
- hsa-mir-329-3p (MIRT608022)
- hsa-mir-362-3p (MIRT608023)
- hsa-mir-8485 (MIRT608024)
- hsa-mir-125b-2-3p (MIRT614407)
- hsa-mir-6783-3p (MIRT677190)
- hsa-mir-1343-3p (MIRT677191)
- hsa-mir-23b-5p (MIRT677192)
- hsa-mir-23a-5p (MIRT677193)
- hsa-mir-4284 (MIRT677194)
- hsa-mir-6829-3p (MIRT677195)
- hsa-mir-6791-3p (MIRT677196)
- hsa-mir-4772-3p (MIRT677197)
- hsa-mir-1307-3p (MIRT677198)
- hsa-mir-1304-3p (MIRT677199)
- hsa-mir-1281 (MIRT677200)
- hsa-mir-6742-3p (MIRT677201)
- hsa-mir-6852-5p (MIRT677202)
- hsa-mir-939-3p (MIRT677203)
- hsa-mir-660-3p (MIRT677204)
- hsa-mir-4485-5p (MIRT677205)
- hsa-mir-4514 (MIRT677206)
- hsa-mir-4692 (MIRT677207)
- hsa-mir-6715b-5p (MIRT677208)
- hsa-mir-4269 (MIRT677209)
- hsa-mir-4742-5p (MIRT677210)
- hsa-mir-6890-3p (MIRT677211)
- hsa-mir-5571-5p (MIRT677212)
miRNA Products
- Search ViGene Biosciences for CAVIN4
Inhibitory RNA Products
- Origene RNAi, siRNA, and shRNA products in human, mouse, rat for CAVIN4
- Browse OriGene Inhibitory RNA Products For CAVIN4
-
ViGene Biosciences ready-to-package AAV shRNAs for CAVIN4 gene
Clone Products
-
OriGene ORF clones in human for CAVIN4
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for CAVIN4
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for CAVIN4
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Cell Line Products
-
Horizon Cell Lines for CAVIN4
-
ViGene Biosciences adenoviral particle packaged cDNA for CAVIN4 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for CAVIN4 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for CAVIN4 gene
Flow Cytometry Products
No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for CAVIN4 Gene
Localization for CAVIN4 Gene
Subcellular locations from UniProtKB/Swiss-Prot for CAVIN4 Gene
- Cytoplasm, myofibril, sarcomere. Cytoplasm. Note=In cardiomyocytes, accumulates in the Z-line of the sarcomere. In vascular smooth muscle cells, detected diffusely throughout the cytoplasm (By similarity). {ECO:0000250}.
| Compartment | Confidence |
|---|---|
| nucleus | 3 |
| plasma membrane | 1 |
| cytosol | 1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005737 | cytoplasm | IBA | -- |
| GO:0030017 | sarcomere | IEA | -- |
| GO:0030018 | Z disc | IEA | -- |
Pathways & Interactions for CAVIN4 Gene
No Data Available
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0006351 | transcription, DNA-templated | IEA | -- |
| GO:0006355 | regulation of transcription, DNA-templated | IEA | -- |
| GO:0007275 | multicellular organism development | IEA | -- |
| GO:0007517 | muscle organ development | IEA | -- |
| GO:0010468 | regulation of gene expression | IMP | 21642240 |
No data available for Pathways by source and SIGNOR curated interactions for CAVIN4 Gene
Transcripts for CAVIN4 Gene
mRNA/cDNA for CAVIN4 Gene
- (1) REFSEQ mRNAs :
- (20) Selected AceView cDNA sequences:
- (1) Ensembl transcripts including schematic representations, and UCSC links where relevant :
CRISPR Products
-
OriGene CRISPR knockouts for CAVIN4
- GenScript: Design CRISPR guide RNA sequences for CAVIN4
miRNA Products
- Search ViGene Biosciences for CAVIN4
Inhibitory RNA Products
- Origene RNAi, siRNA, and shRNA products in human, mouse, rat for CAVIN4
- Browse OriGene Inhibitory RNA Products For CAVIN4
-
ViGene Biosciences ready-to-package AAV shRNAs for CAVIN4 gene
Clone Products
-
OriGene ORF clones in human for CAVIN4
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for CAVIN4
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for CAVIN4
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Flow Cytometry Products
Expression for CAVIN4 Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
- Bone (Muscoskeletal System)
NURSA nuclear receptor signaling pathways regulating expression of CAVIN4 Gene:
CAVIN4Evidence on tissue expression from TISSUES for CAVIN4 Gene
- Muscle(4.7)
- Heart(4.6)
Primer Products
-
OriGene qPCR primer pairs for CAVIN4
No data available for mRNA expression in normal human tissues , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for CAVIN4 Gene
Orthologs for CAVIN4 Gene
This gene was present in the common ancestor of chordates.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | MURC 34 35 |
|
||
| dog (Canis familiaris) |
Mammalia | MURC 34 35 |
|
||
| cow (Bos Taurus) |
Mammalia | MURC 34 35 |
|
||
| mouse (Mus musculus) |
Mammalia | Murc 34 16 35 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Murc 34 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | MURC 35 |
|
OneToOne | |
| platypus (Ornithorhynchus anatinus) |
Mammalia | MURC 35 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | MURC 34 35 |
|
||
| tropical clawed frog (Silurana tropicalis) |
Amphibia | murc 34 |
|
||
| African clawed frog (Xenopus laevis) |
Amphibia | Xl.23948 34 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | murca 34 |
|
||
| murcb 35 |
|
OneToMany | |||
| MURC (1 of 2) 35 |
|
OneToMany |
- Species where no ortholog for CAVIN4 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- fruit fly (Drosophila melanogaster)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- lizard (Anolis carolinensis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Paralogs for CAVIN4 Gene
Variants for CAVIN4 Gene
| SNP ID | Clin | Chr 09 pos | Sequence Context | AA Info | Type |
|---|---|---|---|---|---|
| rs145794010 | Likely benign | 100,585,875(+) | TCTTC(A/C/G)GATGA | reference, synonymous-codon | |
| rs149165620 | Likely benign | 100,578,386(+) | AGCAA(G/T)ACAGG | reference, missense | |
| rs565406194 | Likely benign | 100,586,361(+) | ATCCC(C/T)ACCCC | reference, synonymous-codon | |
| rs778284038 | Likely benign | 100,586,295(+) | GATGA(A/G)CTCAG | reference, synonymous-codon | |
| rs876657508 | Likely benign | 100,586,058(+) | AGGCT(-/AAGGCAGTCAGGAGAGAGGCT)GAGAC | cds-indel |
Residual Variation Intolerance Score:
64.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
2.68;
46.00% of all genes are more intolerant (likely to be disease-causing)
Relevant External Links for CAVIN4 Gene
- SNPedia medical, phenotypic, and genealogical associations of SNPs for
- CAVIN4
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for CAVIN4 Gene
Disorders for CAVIN4 Gene
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| bejel |
|
|
Search CAVIN4 in MalaCards
View complete list of genes associated with diseases
Relevant External Links for CAVIN4
- Atlas of Genetics and Cytogenetics in Oncology and Haematology:
- CAVIN4
No data available for UniProtKB/Swiss-Prot and Genatlas for CAVIN4 Gene
Publications for CAVIN4 Gene
- MURC, a muscle-restricted coiled-coil protein that modulates the Rho/ROCK pathway, induces cardiac dysfunction and conduction disturbance. (PMID: 18332105) Ogata T. … Oh H. (Mol. Cell. Biol. 2008) 2 3 4 64
- MURC, a muscle-restricted coiled-coil protein, is involved in the regulation of skeletal myogenesis. (PMID: 18508909) Tagawa M. … Oh H. (Am. J. Physiol., Cell Physiol. 2008) 2 3 64
- MURC/cavin-4 Is Co-Expressed with Caveolin-3 in Rhabdomyosarcoma Tumors and Its Silencing Prevents Myogenic Differentiation in the Human Embryonal RD Cell Line. (PMID: 26086601) Faggi F. … Fanzani A. (PLoS ONE 2015) 3 64
- A genome-wide association meta-analysis of plasma AI^ peptides concentrations in the elderly. (PMID: 24535457) Chouraki V. … Lambert J.C. (Mol. Psychiatry 2014) 3 64
- FSHD myotubes with different phenotypes exhibit distinct proteomes. (PMID: 23272181) Tassin A. … Belayew A. (PLoS ONE 2012) 3 64
Products for CAVIN4 Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Browse OriGene Antibodies
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for CAVIN4
- Search Origene for MassSpec and Protein Over-expression Lysates for CAVIN4
- Origene Custom Protein Services for CAVIN4
- Origene shRNA, siRNA, and RNAi products in human, mouse, rat for CAVIN4
- Browse OriGene Inhibitory RNA Products For CAVIN4
- OriGene qPCR primer pairs for CAVIN4
- OriGene CRISPR knockouts for CAVIN4
- OriGene ORF clones in human for CAVIN4
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For CAVIN4
- GenScript: Next-day shipping cDNA ORF clone for CAVIN4 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for CAVIN4
- GenScript Custom Assay Services for CAVIN4
- GenScript Custom overexpressing Cell Line Services for CAVIN4
- GenScript: Design CRISPR guide RNA sequences for CAVIN4
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for CAVIN4
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Proteins
- Sino Biological Antibodies
- Sino Biological ELISA Kits and Pair Sets
- Sino Biological Cell Lysates
- Sino Biological qPCR Primers
- Sino Biological CRO Services for Proteins, Antibodies and Genes
- Sino Biological Transfection Reagents
- Novus Biologicals Antibodies for CAVIN4
- Novus Biologicals proteins for CAVIN4
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Abcam antibodies for CAVIN4
- Abcam proteins for CAVIN4
- Search for Assays for CAVIN4 at Abcam
- Find your target
- Search knockout validated antibodies
- Browse monoclonal antibodies
- antibodies-online Antibodies for CAVIN4: See all 17
- antibodies-online Kits for CAVIN4: See all 4
- antibodies-online Proteins for CAVIN4: See all 8
- Search antibodies-online for peptides
- Search GeneTex for Antibodies for CAVIN4
- Search GeneTex for Proteins for CAVIN4
- ViGene Biosciences adenoviral particle packaged cDNA for CAVIN4 gene
- ViGene Biosciences lentiviral particle packaged cDNA for CAVIN4 gene
- ViGene Biosciences ready-to-package AAV shRNAs for CAVIN4 gene
- Search ViGene Biosciences for CAVIN4
- Horizon Cell Lines for CAVIN4
- Cyagen custom Knockout/knockin (KOKI) mouse models for CAVIN4
- VectorBuilder custom plasmid, inducible vectors for CAVIN4
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for CAVIN4
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Sources for CAVIN4 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) RNAdb
- (29) ASD
- (30) ECgene
- (31) GeneAnnot
- (32) CGAP SAGE
- (33) SOURCE
- (34) HomoloGene
- (35) PanEnsembl
- (36) euGenes
- (37) SGD
- (38) FlyBase
- (39) WormBase
- (40) Pseudogene
- (41) DGV
- (42) dbSNP
- (43) GenAtlas
- (44) GeneTests
- (45) HGMD
- (46) GAD
- (47) LSDB
- (48) BGMUT
- (49) HuGE
- (50) eBioscience
- (51) Atlas
- (52) Cell Signaling Technology
- (53) GenBank
- (54) H-invDB
- (55) HORDE
- (56) HUGE
- (57) IMGT
- (58) Leiden
- (59) MILLIPORE
- (60) miRBase
- (61) DME
- (62) NCBI
- (63) OriGene
- (64) PubMed
- (65) R&D Systems
- (66) TGDB
- (67) Tocris
- (68) Abcam
- (69) Novus
- (70) ProSpec
- (71) Sino Biological
- (72) GenScript
- (73) Qiagen
- (74) Cloud-Clone Corp.
- (75) Enzo Life Sciences
- (76) OCA
- (77) Proteopedia
- (78) MOPED
- (79) SPIRE
- (80) neXtProt
- (81) Reactome
- (82) GeneGo (Thomson Reuters)
- (83) fRNAdb
- (84) DISEASES
- (85) SIMAP
- (86) GenomeRNAi
- (87) LifeMap
- (88) miRTarBase
- (89) MalaCards
- (90) Invitrogen
- (91) BitterDB
- (92) Vector BioLabs
- (93) ESI-BIO
- (94) RefSeq
- (95) BioSystems
- (96) MaxQB
- (97) IUPHAR
- (98) BioGPS
- (99) Illumina
- (100) COMPARTMENTS
- (101) HOMER
- (102) PaxDb
- (103) ApexBio
- (104) Addgene
- (105) antibodies-online
- (106) CYP
- (107) NONCODE
- (108) SwitchGear Genomics
- (109) TreeFam
- (110) PathCards
- (111) GeneReviews
- (112) GeneTex
- (113) Taconic Biosciences
- (114) GTEx
- (115) ProteomicsDB
- (116) SCBT
- (117) DGIdb
- (118) ClinicalTrials
- (119) FDA Approved Drugs
- (120) RVIS
- (121) SIGNOR
- (122) diseasecard
- (123) NIH Rare Diseases
- (124) Orphanet
- (125) UMLS
- (126) GTR
- (127) Disease Ontology
- (128) Genetics Home Reference
- (129) MeSH
- (130) MedlinePlus
- (131) CDC
- (132) NINDS
- (133) NCBI Bookshelf
- (134) ClinVar
- (135) Gene Damage Index
- (136) ViGene Biosciences
- (137) HPO
- (138) UDN
- (139) VISTA
- (140) FANTOM5
- (141) ENCODE
- (142) ProSci
- (143) Horizon
- (144) NURSA
- (145) IID
- (146) Cyagen
- (147) VectorBuilder
- (148) SNPedia
- (149) BRCA Exchange
- (150) St John's Lab
- (151) CIViC
- (152) ProteoGenix
- (153) dbSUPER
- (154) TISSUES
- (155) Gene ORGANizer