Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CAVIN4 Gene

Aliases for CAVIN4 Gene

  • Caveolae Associated Protein 4 2 3
  • Muscle-Restricted Coiled-Coil Protein 2 3 4
  • Muscle Related Coiled-Coil Protein 2 3 5
  • MURC 3 4 5
  • Muscle-Related Coiled-Coil Protein 2 3
  • Cavin-4 3

External Ids for CAVIN4 Gene

Previous HGNC Symbols for CAVIN4 Gene

  • MURC

Summaries for CAVIN4 Gene

Entrez Gene Summary for CAVIN4 Gene

  • This gene encodes a protein containing two coiled-coil regions. The encoded protein promotes Rho/ROCK (Rho-kinase) signaling in cardiac muscles cells, and may facilitate myofibrillar organization. [provided by RefSeq, Jun 2013]

GeneCards Summary for CAVIN4 Gene

CAVIN4 (Caveolae Associated Protein 4) is a Protein Coding gene. Diseases associated with CAVIN4 include Bejel. An important paralog of this gene is CAVIN2.

UniProtKB/Swiss-Prot for CAVIN4 Gene

  • Induces RHOA activation and activates NPPA transcription and myofibrillar organization through the Rho/ROCK signaling pathway.

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CAVIN4 Gene

Genomics for CAVIN4 Gene

Regulatory Elements for CAVIN4 Gene

Enhancers for CAVIN4 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH09G100600 0.9 Ensembl ENCODE 18.6 +24.4 24353 1.8 CTCF ZNF654 SAP130 TRIM22 ZEB2 RAD21 TEAD3 NFIC RFXANK SMC3 CAVIN4 TMEFF1 INVS RN7SKP87 GC09M100582 PIR40273
GH09G100598 1.2 Ensembl ENCODE 11.4 +22.0 22012 1.4 RB1 ARID4B SIN3A ZNF48 YY1 ETS1 ELK1 SCRT2 RCOR1 U2AF2 CAVIN4 MSANTD3 RN7SKP87 GC09M100582 PIR40273
GH09G100586 0.5 ENCODE 22.4 +10.5 10489 1.3 SOX13 JUND GATA2 FOS RARA CAVIN4 TMEFF1 MSANTD3-TMEFF1 MSANTD3 GC09M100582 RN7SKP87 PIR40273
GH09G100589 0.6 ENCODE 16.5 +13.6 13597 1.6 JUND ATF3 POLR2A JUN BHLHE40 NFE2 FOS TMEFF1 CAVIN4 MSANTD3-TMEFF1 MSANTD3 GC09M100582 RN7SKP87 PIR40273
GH09G100577 0.4 ENCODE 23 +3.7 3729 6.0 ZNF24 CAVIN4 TMEFF1 GC09M100582 RN7SKP87
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around CAVIN4 on UCSC Golden Path with GeneCards custom track

Genomic Location for CAVIN4 Gene

Chromosome:
9
Start:
100,576,867 bp from pter
End:
100,588,402 bp from pter
Size:
11,536 bases
Orientation:
Plus strand

Genomic View for CAVIN4 Gene

Genes around CAVIN4 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CAVIN4 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CAVIN4 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CAVIN4 Gene

Proteins for CAVIN4 Gene

  • Protein details for CAVIN4 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q5BKX8-MURC_HUMAN
    Recommended name:
    Muscle-related coiled-coil protein
    Protein Accession:
    Q5BKX8
    Secondary Accessions:
    • B1PRL3
    • B4DT88

    Protein attributes for CAVIN4 Gene

    Size:
    364 amino acids
    Molecular mass:
    41899 Da
    Quaternary structure:
    • Interacts with SDPR; this augments the transactivation of NPPA.
    SequenceCaution:
    • Sequence=AAH90888.1; Type=Erroneous initiation; Evidence={ECO:0000305};

neXtProt entry for CAVIN4 Gene

Post-translational modifications for CAVIN4 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for CAVIN4 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for CAVIN4 Gene

Domains & Families for CAVIN4 Gene

Gene Families for CAVIN4 Gene

Protein Domains for CAVIN4 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for CAVIN4 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q5BKX8

UniProtKB/Swiss-Prot:

MURC_HUMAN :
  • Belongs to the PTRF/SDPR family.
Family:
  • Belongs to the PTRF/SDPR family.
genes like me logo Genes that share domains with CAVIN4: view

Function for CAVIN4 Gene

Molecular function for CAVIN4 Gene

UniProtKB/Swiss-Prot Function:
Induces RHOA activation and activates NPPA transcription and myofibrillar organization through the Rho/ROCK signaling pathway.

Phenotypes for CAVIN4 Gene

genes like me logo Genes that share phenotypes with CAVIN4: view

Animal Models for CAVIN4 Gene

MGI Knock Outs for CAVIN4:

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Applied Biological Materials Clones for CAVIN4

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for CAVIN4 Gene

Localization for CAVIN4 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CAVIN4 Gene

Cytoplasm, myofibril, sarcomere. Cytoplasm. Note=In cardiomyocytes, accumulates in the Z-line of the sarcomere. In vascular smooth muscle cells, detected diffusely throughout the cytoplasm (By similarity). {ECO:0000250}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CAVIN4 gene
Compartment Confidence
nucleus 3
plasma membrane 1
cytosol 1

Gene Ontology (GO) - Cellular Components for CAVIN4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IBA --
GO:0030017 sarcomere IEA --
GO:0030018 Z disc IEA --
genes like me logo Genes that share ontologies with CAVIN4: view

Pathways & Interactions for CAVIN4 Gene

SuperPathways for CAVIN4 Gene

No Data Available

Interacting Proteins for CAVIN4 Gene

Selected Interacting proteins: Q5BKX8-MURC_HUMAN for CAVIN4 Gene via IID

Gene Ontology (GO) - Biological Process for CAVIN4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0007275 multicellular organism development IEA --
GO:0007517 muscle organ development IEA --
GO:0010468 regulation of gene expression IMP 21642240
genes like me logo Genes that share ontologies with CAVIN4: view

No data available for Pathways by source and SIGNOR curated interactions for CAVIN4 Gene

Drugs & Compounds for CAVIN4 Gene

No Compound Related Data Available

Transcripts for CAVIN4 Gene

mRNA/cDNA for CAVIN4 Gene

(1) REFSEQ mRNAs :
(20) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Applied Biological Materials Clones for CAVIN4

Alternative Splicing Database (ASD) splice patterns (SP) for CAVIN4 Gene

No ASD Table

Relevant External Links for CAVIN4 Gene

GeneLoc Exon Structure for
CAVIN4
ECgene alternative splicing isoforms for
CAVIN4

Expression for CAVIN4 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

NURSA nuclear receptor signaling pathways regulating expression of CAVIN4 Gene:

CAVIN4

Evidence on tissue expression from TISSUES for CAVIN4 Gene

  • Muscle(4.7)
  • Heart(4.6)
genes like me logo Genes that share expression patterns with CAVIN4: view

Primer Products

No data available for mRNA expression in normal human tissues , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for CAVIN4 Gene

Orthologs for CAVIN4 Gene

This gene was present in the common ancestor of chordates.

Orthologs for CAVIN4 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia MURC 34 35
  • 99.27 (n)
dog
(Canis familiaris)
Mammalia MURC 34 35
  • 89.01 (n)
cow
(Bos Taurus)
Mammalia MURC 34 35
  • 88.18 (n)
mouse
(Mus musculus)
Mammalia Murc 34 16 35
  • 81.95 (n)
rat
(Rattus norvegicus)
Mammalia Murc 34
  • 81.68 (n)
oppossum
(Monodelphis domestica)
Mammalia MURC 35
  • 67 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia MURC 35
  • 64 (a)
OneToOne
chicken
(Gallus gallus)
Aves MURC 34 35
  • 69.7 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia murc 34
  • 63.47 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.23948 34
zebrafish
(Danio rerio)
Actinopterygii murca 34
  • 58.23 (n)
murcb 35
  • 44 (a)
OneToMany
MURC (1 of 2) 35
  • 36 (a)
OneToMany
Species where no ortholog for CAVIN4 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CAVIN4 Gene

ENSEMBL:
Gene Tree for CAVIN4 (if available)
TreeFam:
Gene Tree for CAVIN4 (if available)

Paralogs for CAVIN4 Gene

Paralogs for CAVIN4 Gene

genes like me logo Genes that share paralogs with CAVIN4: view

Variants for CAVIN4 Gene

Sequence variations from dbSNP and Humsavar for CAVIN4 Gene

SNP ID Clin Chr 09 pos Sequence Context AA Info Type
rs145794010 Likely benign 100,585,875(+) TCTTC(A/C/G)GATGA reference, synonymous-codon
rs149165620 Likely benign 100,578,386(+) AGCAA(G/T)ACAGG reference, missense
rs565406194 Likely benign 100,586,361(+) ATCCC(C/T)ACCCC reference, synonymous-codon
rs778284038 Likely benign 100,586,295(+) GATGA(A/G)CTCAG reference, synonymous-codon
rs876657508 Likely benign 100,586,058(+) AGGCT(-/AAGGCAGTCAGGAGAGAGGCT)GAGAC cds-indel

Variation tolerance for CAVIN4 Gene

Residual Variation Intolerance Score: 64.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.68; 46.00% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for CAVIN4 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
CAVIN4

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for CAVIN4 Gene

Disorders for CAVIN4 Gene

MalaCards: The human disease database

(1) MalaCards diseases for CAVIN4 Gene - From: DISEASES

Disorder Aliases PubMed IDs
bejel
  • njovera
- elite association - COSMIC cancer census association via MalaCards

Relevant External Links for CAVIN4

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
CAVIN4
genes like me logo Genes that share disorders with CAVIN4: view

No data available for UniProtKB/Swiss-Prot and Genatlas for CAVIN4 Gene

Publications for CAVIN4 Gene

  1. MURC, a muscle-restricted coiled-coil protein that modulates the Rho/ROCK pathway, induces cardiac dysfunction and conduction disturbance. (PMID: 18332105) Ogata T. … Oh H. (Mol. Cell. Biol. 2008) 2 3 4 64
  2. MURC, a muscle-restricted coiled-coil protein, is involved in the regulation of skeletal myogenesis. (PMID: 18508909) Tagawa M. … Oh H. (Am. J. Physiol., Cell Physiol. 2008) 2 3 64
  3. MURC/cavin-4 Is Co-Expressed with Caveolin-3 in Rhabdomyosarcoma Tumors and Its Silencing Prevents Myogenic Differentiation in the Human Embryonal RD Cell Line. (PMID: 26086601) Faggi F. … Fanzani A. (PLoS ONE 2015) 3 64
  4. A genome-wide association meta-analysis of plasma AI^ peptides concentrations in the elderly. (PMID: 24535457) Chouraki V. … Lambert J.C. (Mol. Psychiatry 2014) 3 64
  5. FSHD myotubes with different phenotypes exhibit distinct proteomes. (PMID: 23272181) Tassin A. … Belayew A. (PLoS ONE 2012) 3 64

Products for CAVIN4 Gene

Sources for CAVIN4 Gene

Content
Loading form....