Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

CAP1 Gene

protein-coding   GIFtS: 59
GCID: GC01P040505

CAP, adenylate cyclase-associated protein 1 (yeast)
 Explore 8 diseases affiliated with
CAP1 via
MalaCards
our new
 Human Malady Compendium 
Biological research products
for CAP1    

Aliases
for CAP1 gene

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section
Aliases
CAP, Adenylate Cyclase-Associated Protein 1 (Yeast)1 2
CAP1 2 3
CAP 12 3
CAP1-PEN2
Adenylyl Cyclase-Associated Protein 12
SSKAP555

External Ids:    HGNC: 200401   Entrez Gene: 104872   Ensembl: ENSG000001312367   OMIM: 6049695   UniProtKB: Q015183   

Export aliases for CAP1 gene to outside databases

Previous GC identifers: GC01P039969 GC01P039920 GC01P039921 GC01P040175 GC01P040278 GC01P038624


Summaries
for CAP1 gene

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section
Entrez Gene summary for CAP1:
The protein encoded by this gene is related to the S. cerevisiae CAP protein, which is involved in the cyclic AMP
pathway. The human protein is able to interact with other molecules of the same protein, as well as with CAP2 and
actin. Alternatively spliced transcript variants have been identified. (provided by RefSeq, Jul 2008)

UniProtKB/Swiss-Prot: CAP1_HUMAN, Q01518
Function: Directly regulates filament dynamics and has been implicated in a number of complex developmental and
morphological processes, including mRNA localization and the establishment of cell polarity

Gene Wiki entry for CAP1


Genomic Views
for CAP1 gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000001.10  NC_018912.1  NT_032977.9  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the CAP1 gene promoter:
         Pbx1a   AML1a   p300   CUTL1   CREB   AREB6   MZF-1   deltaCREB   Pax-4a   RSRFC4   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmid: CAP1 promoter sequence
   Search SABiosciences Chromatin IP Primers for CAP1

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat CAP1


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 1p34.2   Ensembl cytogenetic band:  1p34.2   HGNC cytogenetic band: 1p34.3

CAP1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
CAP1 gene location

GeneLoc information about chromosome 1         GeneLoc Exon Structure

GeneLoc location for GC01P040505:  view genomic region     (about GC identifiers)

Start:
 40,505,905 bp from pter      End:
 40,538,321 bp from pter
Size:
 32,417 bases      Orientation:
 plus strand

Proteins
for CAP1 gene

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section
UniProtKB/Swiss-Prot: CAP1_HUMAN, Q01518 (See protein sequence)
Recommended Name: Adenylyl cyclase-associated protein 1  
Size: 475 amino acids; 51901 Da
Subunit: Homodimer. Binds actin monomers
Subcellular location: Cell membrane; Peripheral membrane protein (By similarity)
1 PDB 3D structure from and Proteopedia for CAP1:
1K8F (3D)    
Secondary accessions: Q53HR7 Q5T0S1 Q5T0S2 Q6I9U6
Alternative splicing: 2 isoforms:  Q01518-1   Q01518-2   

Explore the universe of human proteins at neXtProt for CAP1: NX_Q01518

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q01518

    • CAP1 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins (2 alternative transcripts): 
    NP_001099000.1  NP_006358.1  

    ENSEMBL proteins: 
     ENSP00000361883   ENSP00000361888   ENSP00000398475   ENSP00000403198   ENSP00000398877  
     ENSP00000408561   ENSP00000410586   ENSP00000361878   ENSP00000361884   ENSP00000344832  
     ENSP00000361891   ENSP00000412859   ENSP00000413656   ENSP00000400943   ENSP00000413383  
     ENSP00000389974  
    Reactome Protein details: Q01518
    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein: CAP1
    OriGene Protein Over-expression Lysate (see all 2): CAP1
    OriGene Custom Protein Services for CAP1 
    GenScript Custom Purified and Recombinant Proteins Services for CAP1
    Novus Biologicals CAP1 Protein
    Novus Biologicals CAP1 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for CAP1

    Gene Ontology (GO): 3 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005737cytoplasm ----
    GO:0005886plasma membrane IEA--
    GO:0030864cortical actin cytoskeleton IEA--


    CAP1 for ontologies           About GeneDecksing



    CAP1 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies: CAP1
    OriGene Custom Antibody Services for CAP1 
    GenScript Custom Superior Antibodies Services for CAP1
    Novus Biologicals CAP1 Antibodies
    Abcam antibodies for CAP1 
    Uscn Antibodies for CAP1
    ThermoFisher Antibodies for CAP1

    Assay Products for CAP1: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for CAP1
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for CAP1

    Protein Domains /
    Families
    for CAP1 gene

    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    CAP1 for domains           About GeneDecksing

    5/7 InterPro domains/families (see all 7):
     IPR001837 Adenylate_cyclase-assoc_CAP
     IPR013992 Adenylate_cyclase-assoc_CAP_N
     IPR017901 C-CAP_CF_C-like
     IPR016098 CAP/MinC_C
     IPR018106 CAP_CS

    Graphical View of Domain Structure for InterPro Entry Q01518

    ProtoNet protein and cluster: Q01518

    2 Blocks protein families:
    IPB001837 CAP protein
    IPB006599 Cyclase-associated protein


    UniProtKB/Swiss-Prot: CAP1_HUMAN, Q01518
    Similarity: Belongs to the CAP family
    Similarity: Contains 1 C-CAP/cofactor C-like domain


    Function
    for CAP1 gene

    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section
    Function Summary:

         UniProtKB/Swiss-Prot: CAP1_HUMAN, Q01518
    Function: Directly regulates filament dynamics and has been implicated in a number of complex developmental and
    morphological processes, including mRNA localization and the establishment of cell polarity

    miRNA
    Products:            		miRTarBase miRNAs that target CAP1:
    hsa-mir-1 (MIRT002798)

    OriGene 3'-UTR Clone (see all 2): CAP1
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat CAP1
    8/47 QIAGEN miScript miRNA Assays for microRNAs that regulate CAP1 (see all 47):
    hsa-let-7d hsa-miR-513a-5p hsa-miR-1260b hsa-miR-3916 hsa-let-7g hsa-miR-548m hsa-miR-9 hsa-miR-133a
    SwitchGear 3'UTR luciferase reporter plasmid: CAP1 3' UTR sequence
    Inhib. RNA
    Products:            		Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for CAP1 (see all 7)
    OriGene shRNA RFP: CAP1
    OriGene siRNA: CAP1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat CAP1

    Gene Editing
    Products:    		DNA2.0 Custom Protein Engineering Service for CAP1

    Clone
    Products:             		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for CAP1 (see all 4)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for CAP1 (see all 2)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: CAP1 (NM_014716)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for CAP1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CAP1 

    Cell Line
    Products:             		GenScript Custom overexpressing Cell Line Services for CAP1
    Search LifeMap BioReagents cell lines for CAP1

    In Situ Assay
    Products:       
         		Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CAP1

    Gene Ontology (GO): 2 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003779actin binding IEA--
    GO:0005515protein binding ----


    CAP1 for ontologies           About GeneDecksing


    7 GenomeRNAi human phenotypes for CAP1:
     Increased Salmonella enterica   Increased Salmonella enterica   Increased Salmonella enterica   Increased Salmonella enterica  
     Increased Salmonella enterica   Increased Salmonella-containin  Increased cell number in G2M,  


    Pathways & Interactions
    for CAP1 gene

    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways - 5/6 super-pathways (see all 6) About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1Platelet degranulation
    		Platelet degranulation 1.00
    		Response to elevated platelet cytosolic Ca2+0.94
    2Axon guidance
    		Axon guidance1.00
    		Developmental Biology0.69
    3Platelet activation, signaling and aggregation
    		Platelet activation, signaling and aggregation1.00
    		Hemostasis0.43
    4Role of Abl in Robo-Slit signaling
    		Role of Abl in Robo-Slit signaling1.00
    5Insulin Signaling
    		Insulin Signaling1.00

    Pathway sources
    See GeneCards unified pathways
    Show all pathways


    1 BioSystems Pathway for CAP1 
        Insulin Signaling

    5/8        Reactome Pathways for CAP1 (see all 8)
        Hemostasis
    Developmental Biology
    Platelet degranulation
    Role of Abl in Robo-Slit signaling
    Signaling by Robo receptor



    CAP1 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for CAP1

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/70 Interacting proteins for CAP1 (Q015183 ENSP000003618784) via UniProtKB, MINT, STRING, and/or I2D (see all 70)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    CAP2P401233, ENSP000002299224I2D: score=3 STRING: ENSP00000229922
    ABL2P426843, ENSP000003565954I2D: score=1 STRING: ENSP00000356595
    ACTBP607093, ENSP000003499604I2D: score=1 STRING: ENSP00000349960
    CFL1P235283, ENSP000003096294I2D: score=1 STRING: ENSP00000309629
    MYOCQ999723, ENSP000000375024I2D: score=1 STRING: ENSP00000037502
    About this table

    Gene Ontology (GO): 5/12 biological process terms (GO ID links to tree view) (see all 12):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000902cell morphogenesis ----
    GO:0001667ameboidal cell migration IEA--
    GO:0002576platelet degranulation TAS--
    GO:0006898receptor-mediated endocytosis IEA--
    GO:0007010cytoskeleton organization ----


    CAP1 for ontologies           About GeneDecksing



    Drugs & Compounds
    for CAP1 gene

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    CAP1 for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for CAP1
    1 Novoseek chemical compound relationship for CAP1 gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    cyclic amp 32.9 4 1406678 (1), 17951520 (1)

    Search CenterWatch for drugs/clinical trials and news about CAP1 

    Transcripts
    for CAP1 gene

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section
    REFSEQ mRNAs for CAP1 gene (2 alternative transcripts): 
    NM_001105530.1  NM_006367.3  

    Unigene Cluster for CAP1:

    CAP, adenylate cyclase-associated protein 1 (yeast)
    Hs.370581  [show with all ESTs]
    Unigene Representative Sequence: NM_006367
    18/19 Ensembl transcripts including schematic representations, and UCSC links where relevant (see all 19):
    ENST00000372797(uc001cfa.4 uc001cey.4 uc001cez.4 uc009vvz.3 uc010oje.2)
    ENST00000372802 ENST00000449311 ENST00000421589(uc010ojd.1) ENST00000414893
    ENST00000414281 ENST00000420216 ENST00000372792 ENST00000372798 ENST00000340450
    ENST00000372805 ENST00000435719 ENST00000427843 ENST00000417287 ENST00000424977
    ENST00000446031 ENST00000479759 ENST00000461993

    miRNA
    Products:             		 OriGene 3'-UTR Clone (see all 2): CAP1
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat CAP1
    8/47 QIAGEN miScript miRNA Assays for microRNAs that regulate CAP1 (see all 47):
    hsa-let-7d hsa-miR-513a-5p hsa-miR-1260b hsa-miR-3916 hsa-let-7g hsa-miR-548m hsa-miR-9 hsa-miR-133a
    SwitchGear 3'UTR luciferase reporter plasmid: CAP1 3' UTR sequence
    Inhib. RNA
    Products:             		Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for CAP1 (see all 7)
    OriGene shRNA RFP: CAP1
    OriGene siRNA: CAP1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat CAP1
    Clone
    Products:             		 OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for CAP1 (see all 4)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for CAP1 (see all 2)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: CAP1 (NM_014716)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for CAP1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CAP1 
    Primer
    Products:            		 OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for CAP1
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat CAP1
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat CAP1
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat CAP1

    Additional cDNA sequence: 

    AK096193.1 AK222513.1 AK295396.1 AK297829.1 AK298094.1 AK298110.1 AK300861.1 AK315731.1 
    BC013963.2 BC020367.1 BC095440.1 BT007152.1 BX537801.1 CR457409.1 L12168.1 M98474.1 

    24/69 DOTS entries (see all 69):

    DT.100059795  DT.92464595  DT.92464576  DT.444472  DT.102842132  DT.96085130  DT.420521  DT.121410048 
    DT.100690341  DT.91850925  DT.100690352  DT.100769585  DT.100690349  DT.92464645  DT.95303264  DT.100690354 
    DT.121410268  DT.92385067  DT.100847303  DT.121410265  DT.100690347  DT.102842131  DT.97869858  DT.95131998 

    24/1000 AceView cDNA sequences (see all 1000):

    BU957148 BU190955 AI927567 AI754946 BM453352 BP350274 AL549097 R53879 
    BP354407 CB152183 CA397003 AU124346 BQ062233 BQ436026 BU629085 BE122916 
    BM083653 N74322 BG425231 AW512439 AI253655 CA395955 BM551540 BM716634 

    GeneLoc Exon Structure

    5/8 Alternative Splicing Database (ASD) splice patterns (SP) for CAP1 (see all 8)    About this scheme

    ExUns: 1a · 1b · 1c · 1d ^ 2a · 2b ^ 3a · 3b ^ 4 ^ 5a · 5b · 5c ^ 6a · 6b ^ 7 ^ 8a · 8b · 8c ^ 9 ^ 10a · 10b ^ 11a · 11b · 11c ^ 12a · 12b ^
    SP1:                                                                                                                                                            
    SP2:                                                                                                                    -                                       
    SP3:                                            -     -     -     -     -     -     -     -     -     -     -           -                                       
    SP4:                    -                                                                                                                                       
    SP5:                                                                                -     -     -     -                 -                                       

    ExUns: 13a · 13b ^ 14a · 14b
    SP1:                        
    SP2:                        
    SP3:                        
    SP4:                        
    SP5:                        


    ECgene alternative splicing isoforms for CAP1

    Expression
    for CAP1 gene

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    CAP1 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: CTCATCAGCT

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)
    About this image

    CAP1 expression in embryonic tissues and stem cells
    Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine    About this table
    1 LifeMap In Vivo Development Anatomical Compartment/Cell 
    Tissue Anatomical Compartment CellCategory (developmental path)
    LimbLimb BudLimb Bud Mesenchyme CellsMesoderm
    Expression: Positive    Negative     Selective marker
    Experimental details: Curated     Microarrays     In-situ hybridization

    See CAP1 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for CAP1

    SOURCE GeneReport for Unigene cluster: Hs.370581
        SABiosciences Expression via Pathway-Focused PCR Array including CAP1: 
              Insulin Signaling Pathway in human mouse rat

    Primer
    Products:    		 OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for CAP1
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat CAP1
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat CAP1
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat CAP1
    In Situ
    Assay Products:     
         		Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CAP1

    Orthologs
    for CAP1 gene

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section
    This gene was present in the common ancestor of eukaryotes.

    Orthologs for CAP1 gene from 9/34 species (see all 34)    About this table
    Organism Taxonomic
    classification    		 Gene Description Human
    Similarity    		 Orthology
    Type    		 Details
    chicken
    (Gallus gallus)    		 Aves CAP11 CAP, adenylate cyclase-associated protein 1 (yeast) 73.11(n)
    78.13(a)    		   419680  XM_003642584.1  XP_003642632.1 
    lizard
    (Anolis carolinensis)    		 Reptilia CAP16
    		 --
    		 77(a)
    		 1 ↔ 1
    		 GL343498.1(211396-221809)
    African clawed frog
    (Xenopus laevis)    		 Amphibia CAP1b2 cyclase-associated protein 1b 77.25(n)    AY233268.1 
    zebrafish
    (Danio rerio)    		 Actinopterygii wufj98f012 wufj98f01 79.17(n)   334527  AY162326.1 
    fruit fly
    (Drosophila melanogaster)    		 Insecta capt1 capulet 56.16(n)
    52.37(a)    		   45233  NM_001038781.1  NP_001033870.1 
    worm
    (Caenorhabditis elegans)    		 Secernentea cas-11 Protein CAS-1 48.93(n)
    41.24(a)    		   181729  NM_078312.2  NP_510713.1 
    baker's yeast
    (Saccharomyces cerevisiae)    		 Saccharomycetes SRV21 Srv2p 47.41(n)
    38.17(a)    		   855584   NP_014261.1 
    thale cress
    (Arabidopsis thaliana)    		 eudicotyledons CAP11 cyclase associated protein 1 47.54(n)
    40.85(a)    		   829600  NM_119614.5  NP_195175.1 
    rice
    (Oryza sativa)    		 Liliopsida Os08g04479001 hypothetical protein 47.51(n)
    39.49(a)    		   4345716  NM_001068469.1  NP_001061934.1 


    ENSEMBL Gene Tree for CAP1 (if available)
    TreeFam Gene Tree for CAP1 (if available) 

    Paralogs
    for CAP1 gene

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for CAP1 gene
    CAP22  
    2 SIMAP similar genes for CAP1 using alignment to 13 protein entries:     CAP1_HUMAN (see all proteins):
    DKFZp686D0714    CAP2

    CAP1 for paralogs           About GeneDecksing


    2 Pseudogenes.org Pseudogenes for CAP1
    PGOHUM00000262843 PGOHUM00000238079


    Genomic Variants
    for CAP1 gene

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/13 NCBI SNPs in CAP1 are shown (see all 13)     About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance    		Chr 1 posSequence#AA
    Chg    		TypeMore#Allele
    freq    		PopTotal
    sample    		More
    ----------
    rs41306511,2
    		C,H--38654836(+) ACACAG/CAAATG 2 -- int16Minor allele frequency- C:0.00NS EA NA 424
    rs1132751301,2
    		C,--38654989(+) TAGACT/-TAATA 2 -- int11Minor allele frequency- -:0.50CSA 2
    rs1120754201,2
    		--38655666(+) GTAGCG/AGAAGC 2 -- ut311Minor allele frequency- A:0.50CSA 2
    rs740680291,2
    		C,,--38655840(+) CCTCAG/ACCGTG 2 -- ut311Minor allele frequency- A:0.50WA 2
    rs1471949521,2
    		C,--40512774(+) GGTAT-/TATAATCTTATGGGATTTTGTG
    TTGATTAATCCCCATATAATCCCA    TATAA     		1 -- int10--------
    rs581907781,2
    		C,--40536074(+) TACACT/-GTTGA 2 -- int12Minor allele frequency- -:0.00NA CSA 4
    rs780625011,2
    		----40512161(+) AAAAAC/ACAAAC 1 -- int11Minor allele frequency- A:0.50NA 2
    rs1996904681,2
    		----40512819(+) ATCCCA/TTATAA 1 -- int10--------
    rs1998559661,2
    		----40528470(+) TGTGT-/GTGTGT
                ATAGA     		2 -- int10--------
    rs2010622641,2
    		----40512818(+) AATCCA/CATATA 1 -- int10--------

    HapMap Linkage Disequilibrium report for CAP1 (40505905 - 40538321 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 3 variations for CAP1
         3 CNVs: 8322 48321 3289

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing CAP1
    DNA2.0 Custom Variant and Variant Library Synthesis for CAP1

    Disorders / Diseases
    for CAP1 gene

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    CAP1 for disorders           About GeneDecksing

    OMIM gene information: 604969    OMIM disorders: --

    8 diseases for CAP1:    About MalaCards
    beta thalassemia    thalassemia    tongue cancer    hepatocellular carcinoma
    pancreatic cancer    pancreatitis    carcinoma    malaria

    Human Genome Epidemiology (HuGE) Navigator: CAP1 (3 documents)

    Export disorders for CAP1 gene to outside databases

    Publications
    for CAP1 gene

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for CAP1 gene, integrated from 9 sources (see all 60):
    (articles sorted by number of sources associating them with CAP1)    		    Utopia: connect your pdf to the dynamic
    world of online information

    1. Identification of a human cDNA encoding a protein that is structurally and functionally related to the yeast adenylyl cyclase- associated CAP proteins. (PubMed id 1406678)1, 2, 3, 9 Matviw H.... Young D. (1992)
    2. Mammalian CAP interacts with CAP, CAP2, and actin. (PubMed id 8761950)1, 3, 9 Hubberstey A....Young D. (1996)
    3. Crystal structure of the actin binding domain of the cyclase- associated protein. (PubMed id 15311924)1, 2, 9 Dodatko T.... Almo S.C. (2004)
    4. Phosphoproteomic analysis of the human pituitary. (PubMed id 16807684)1, 2 Beranova-Giorgianni S.... Giorgianni F. (2006)
    5. The DNA sequence and biological annotation of human chromosome 1. (PubMed id 16710414)1, 2 Gregory S.G.... Bentley D.R. (2006)
    6. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    7. Exploring proteomes and analyzing protein processing by mass spectrometric identification of sorted N-terminal peptides. (PubMed id 12665801)1, 2 Gevaert K.... Vandekerckhove J. (2003)
    8. Comparison of human CAP and CAP2, homologs of the yeast adenylyl cyclase-associated proteins. (PubMed id 7962207)1, 9 Yu G.... Young D. (1994)
    9. Human CAP1 is a key factor in the recycling of cofilin and actin for rapid actin turnover. (PubMed id 11950878)1, 9 Moriyama K. and Yahara I. (2002)
    10. Adenylate cyclase-associated protein 1 overexpressed in pancreatic cancers is involved in cancer cell motility. (PubMed id 19188911)1, 9 Yamazaki K....Sakamoto M. (2009)

    External Searches for CAP1 gene

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  
      Query String
    		PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    Genome Databases showing CAP1 gene

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 10487 HGNC: 20040 AceView: CAP1 Ensembl:ENSG00000131236 euGenes: HUgn10487
    ECgene: CAP1 H-InvDB: CAP1

    Other Databases showing CAP1 gene

    (According to HUGE)
    About This Section
    		   --

    Specialized Databases showing CAP1 gene

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for CAP1 Pharmacogenomics, SNPs, Pathways

    Intellectual Property
    for CAP1 gene

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    		Patent Information for CAP1 gene:
    Search GeneIP for patents involving CAP1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    Products
    for CAP1 gene

    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     OriGene Antibodies for CAP1   OriGene shRNA RFP for CAP1  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for CAP1   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for CAP1  
     OriGene Protein Over-expression Lysate for CAP1   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for CAP1   OriGene 3'-UTR Clone for CAP1  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for CAP1   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for CAP1  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     OriGene Purified Protein for CAP1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for CAP1   OriGene Custom Protein Services for CAP1  
     OriGene Custom Immunoassay Development  

         		 
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat CAP1
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing CAP1
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat CAP1
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat CAP1
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat CAP1
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat CAP1
     GenScript Custom Purified and Recombinant Proteins Services for CAP1 GenScript cDNA clones with any tag delivered in your preferred vector for CAP1
     GenScript Custom Assay Services for CAP1 GenScript Custom Superior Antibodies Services for CAP1
     GenScript Custom overexpressing Cell Line Services for CAP1 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in CAP1 promoter
     Search Chromatin IP Primers for CAP1
     RT2 qPCR Primer Assay in human, mouse, rat CAP1
     GNC Network for CAP1
     SABiosciences PCR Arrays including human, mouse, rat CAP1
     Search Tocris compounds for CAP1
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     CAP1 antibodies
     CAP1 proteins
     CAP1 lysates
     Antibodies for CAP1
     See all of Abcam's Antibodies, Kits and Proteins for CAP1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     CAP1 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for CAP1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CAP1
     SwitchGear 3'UTR luciferase reporter plasmids for CAP1
     SwitchGear Promoter luciferase reporter plasmids for CAP1
     ThermoFisher Antibodies for CAP1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CAP1
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 27 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 

    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Copyright © 1996-2013 , Weizmann Institute of Science. All Rights Reserved.
    Hot genes      Disease genes      CAP1 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 100 solr: 1.4