Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

C9orf171 Gene

protein-coding   GIFtS: 37
GCID: GC09P135285          (predicted)

chromosome 9 open reading frame 171

  Search for C9orf171
in our new
 Human Malady Compendium 
Biological research products
for C9orf171
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Chromosome 9 Open Reading Frame 1711 2
FLJ460821
Uncharacterized Protein C9orf1712

External Ids:    HGNC: 337761   Entrez Gene: 3897992   Ensembl: ENSG000001885237   UniProtKB: Q6ZQR23   

Export aliases for C9orf171 gene to outside databases

Previous GC identifers: GC09P134277 GC09P104778


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

  --

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000009.11  NC_018920.1  NT_035014.4  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the C9orf171 gene promoter:
         LHX3b/Lhx3b   RP58   HNF-3beta   FOXJ2 (long isoform)   Cart-1   LHX3a/Lhx3a   FOXJ2   TGIF   
         Other transcription factors

Browse SwitchGear Promoter luciferase reporter plasmids
   Search SABiosciences Chromatin IP Primers for C9orf171

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat C9orf171


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 9q34.13   Ensembl cytogenetic band:  9q34.13   HGNC cytogenetic band: 9q34.13

C9orf171 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
C9orf171 gene location

GeneLoc information about chromosome 9         GeneLoc Exon Structure

GeneLoc location for GC09P135285:  view genomic region     (about GC identifiers)

Start:
135,285,430 bp from pter      End:
135,448,704 bp from pter
Size:
163,275 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: CI171_HUMAN, Q6ZQR2 (See protein sequence)
Recommended Name: Uncharacterized protein C9orf171  
Size: 320 amino acids; 36499 Da
Secondary accessions: Q147X1
Alternative splicing: 2 isoforms:  Q6ZQR2-1   Q6ZQR2-2   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for C9orf171: NX_Q6ZQR2

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q6ZQR2

  • C9orf171 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins: NP_997300.1  
    ENSEMBL proteins: 
     ENSP00000376908   ENSP00000343290   ENSP00000376909  

    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate: C9orf171
    OriGene Custom Protein Services for C9orf171 
    GenScript Custom Purified and Recombinant Proteins Services for C9orf171
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for C9orf171


    C9orf171 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for C9orf171 
    GenScript Custom Superior Antibodies Services for C9orf171
    Novus Biologicals C9orf171 Antibodies
    Search for Antibodies for C9orf171 at Abcam  
    Uscn Antibodies for C9orf171
    Search ThermoFisher Antibodies for C9orf171

    Assay Products for C9orf171: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for C9orf171
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for C9orf171


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    ProtoNet protein and cluster: Q6ZQR2


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    miRNA
    Products:
        
    Browse 3'-UTR reporter clones for miRNA target validation
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat C9orf171
    2 QIAGEN miScript miRNA Assays for microRNAs that regulate C9orf171:
    hsa-miR-544 hsa-miR-330-3p
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for C9orf171 (see all 4)
    OriGene shRNA RFP: C9orf171
    OriGene siRNA: C9orf171
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat C9orf171

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for C9orf171

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for C9orf171 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for C9orf171
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: C9orf171 (NM_207417)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for C9orf171
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat C9orf171 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for C9orf171
    Search LifeMap BioReagents cell lines for C9orf171

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for C9orf171


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section



    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for C9orf171

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for C9orf171
    Search CenterWatch for drugs/clinical trials and news about C9orf171 / CI171 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for C9orf171 gene: 
    NM_207417.1  

    Unigene Cluster for C9orf171:

    Chromosome 9 open reading frame 171
    Hs.201709  [show with all ESTs]
    Unigene Representative Sequence: AK128819
    3 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000393215 ENST00000343036(uc004cbn.3 uc004cbo.3) ENST00000393216


    miRNA
    Products:
         
    Browse 3'-UTR reporter clones for miRNA target validation
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat C9orf171
    2 QIAGEN miScript miRNA Assays for microRNAs that regulate C9orf171:
    hsa-miR-544 hsa-miR-330-3p
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for C9orf171 (see all 4)
    OriGene shRNA RFP: C9orf171
    OriGene siRNA: C9orf171
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat C9orf171
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for C9orf171 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for C9orf171
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: C9orf171 (NM_207417)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for C9orf171
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat C9orf171 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for C9orf171
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat C9orf171
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat C9orf171
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat C9orf171

    Additional cDNA sequence: 

    AK128819.1 BC118593.1 BC124555.1 

    3 DOTS entries:

    DT.100723291  DT.100761911  DT.40126507 

    8 AceView cDNA sequences:

    AI697241 BX395046 AK128819 NM_207417 BX395047 BX119796 AA912895 BX115412 

    GeneLoc Exon Structure

    2 Alternative Splicing Database (ASD) splice patterns (SP) for C9orf171    About this scheme

    ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7
    SP1:                                                
    SP2:              -                                 


    ECgene alternative splicing isoforms for C9orf171

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    C9orf171 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: AGTTTTAATT

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image

    C9orf171 expression in embryonic tissues and stem cells
    Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine    About this table
    Stem Cell Differentiation: 1 LifeMap Cell 
    NameCategory
    N2/LSB induced-cells (Generation of midbra...)
    Expression: Positive    Negative     Selective marker
    Experimental details: Curated     Microarrays     In-situ hybridization

    See C9orf171 Protein Expression from SPIRE MOPED and PaxDB
    SOURCE GeneReport for Unigene cluster: Hs.201709
        SABiosciences Custom PCR Arrays for C9orf171
    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for C9orf171
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat C9orf171
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat C9orf171
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat C9orf171
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for C9orf171

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of chordates.

    Orthologs for C9orf171 gene from 3/13 species (see all 13)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia 1700101E01Rik1 , 5 RIKEN cDNA 1700101E01 gene1, 5 84.84(n)1
    88.11(a)1
      2 (19.38 cM)5
    3293751  NM_001166705.11  NP_001160177.11 
     289553735 
    chicken
    (Gallus gallus)
    Aves C17H9orf1711 chromosome 17 open reading frame, human C9orf171 61.95(n)
    52.79(a)
      417168  XM_415451.3  XP_415451.2 
    zebrafish
    (Danio rerio)
    Actinopterygii si:ch211-215c18.41 si:ch211-215c18.4 49.79(n)
    40.51(a)
      558957  NM_001144790.1  NP_001138262.1 


    ENSEMBL Gene Tree for C9orf171 (if available)
    TreeFam Gene Tree for C9orf171 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
      --

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/35 NCBI SNPs in C9orf171 are shown (see all 35    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 9 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs106437171,2
    C--135293278(+) CCCCCCT/-TTCTG 1 -- int1 trp32Minor allele frequency- -:0.00NA CSA 4
    rs605958271,2
    C--135297014(+) GTTCT-/CATGCTCTGGTTTCTCTTCAAATCGTATAAATCTTTC
    GCCTTTTACTAAAGATTTCTGTGGAGAATCCTGGGTTCT
    TCTCC
    1 -- int11Minor allele frequency- CATGCTCTGGTTTCTCTTCAAATCGTATAAATCTTTCGCCTTTTACTAAAGATTTCTGTGGAGAATCCTGGGTTCT:0.00NA 2
    rs1501943981,2
    C,--135297069(+) GATTT-/CTGTG 
            
    GAGAA
    1 -- int10--------
    rs1114737341,2
    C--135297073(+) TCTGTG/TGAGAA 1 -- int10--------
    rs1444772671,2
    C,--135304199(+) GAAGA-/CCCCCC 1 -- int10--------
    rs355851481,2
    C,--135344178(+) ACACG-/CACACAC 1 -- int10--------
    rs5313181,2
    C,F,A,H,--135353137(+) TGTCTG/AGGGGG 1 -- int111Minor allele frequency- A:0.41NA WA CSA EA 375
    rs2017553021,2
    --135353137(+) TGTCT-/AGGGGG 1 -- int10--------
    rs1426731321,2
    --135357346(+) ATGGT-/TGGGG 
            
    GGGGG
    1 -- int10--------
    rs585425821,2
    C,--135399845(+) AAATAC/TAAAAA 1 -- int15Minor allele frequency- T:0.37NA CSA WA EA 362

    HapMap Linkage Disequilibrium report for C9orf171 (135285430 - 135448704 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 6 variations for C9orf171
         2 CNVs: 6721 52733
         4 Indels: 13204 41290 41842 62952

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing C9orf171
    DNA2.0 Custom Variant and Variant Library Synthesis for C9orf171

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    C9orf171 for disorders           About MalaCards

    C9orf171 for disorders           About GeneDecksing

    Human Genome Epidemiology (HuGE) Navigator: C9orf171 (4 documents)

    Export disorders for C9orf171 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for C9orf171 gene integrated from 9 sources:
    (articles sorted by number of sources associating them with C9orf171)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PubMed id 20379614)1 Rose J.E....Uhl G.R. (2010)
    2. Variation at the NFATC2 locus increases the risk of t hiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipr il and rosiglitazone Medication (DREAM) study. (PubMed id 20628086)1 Bailey S.D....Anand S. (2010)
    3. Gene-centric association signals for lipids and apoli poproteins identified via the HumanCVD BeadChip. (PubMed id 19913121)1 Talmud P.J.... . (2009)
    4. The consensus coding sequences of human breast and colorectal cancers. (PubMed id 16959974)2 Sjoeblom T.... Velculescu V.E. (2006)
    5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)2 Gerhard D.S....Malek J. (2004)
    6. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)2 Ota T.... Sugano S. (2004)
    7. DNA sequence and analysis of human chromosome 9. (PubMed id 15164053)2 Humphray S.J.... Dunham I. (2004)
    8. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (2002)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 389799 HGNC: 33776 AceView: FLJ46082 Ensembl:ENSG00000188523 euGenes: HUgn389799
    ECgene: C9orf171 H-InvDB: C9orf171

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for C9orf171 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for C9orf171 gene:
    Search GeneIP for patents involving C9orf171

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     Browse OriGene Antibodies   OriGene shRNA RFP for C9orf171  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for C9orf171   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for C9orf171  
     OriGene Protein Over-expression Lysate for C9orf171   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for C9orf171   Browse 3'-UTR reporter clones for miRNA target validation  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for C9orf171   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for C9orf171  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for C9orf171   OriGene Custom Protein Services for C9orf171  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat C9orf171
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing C9orf171
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat C9orf171
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat C9orf171
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat C9orf171
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat C9orf171
     GenScript Custom Purified and Recombinant Proteins Services for C9orf171 GenScript cDNA clones with any tag delivered in your preferred vector for C9orf171
     GenScript Custom Assay Services for C9orf171 GenScript Custom Superior Antibodies Services for C9orf171
     GenScript Custom overexpressing Cell Line Services for C9orf171 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in C9orf171 promoter
     Search Chromatin IP Primers for C9orf171
     RT2 qPCR Primer Assay in human, mouse, rat C9orf171
     Search GNC Networks for C9orf171
     SABiosciences Custom PCR Arrays for C9orf171
     Search Tocris compounds for C9orf171
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     C9orf171 antibodies
     Search for Antibodies for C9orf171 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for C9orf171
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     C9orf171 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for C9orf171
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for C9orf171
     Browse SwitchGear 3'UTR luciferase reporter plasmids for C9orf171
     Browse SwitchGear Promoter luciferase reporter plasmids for C9orf171
     Search ThermoFisher Antibodies for C9orf171
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat C9orf171
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      C9orf171 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 100 solr: 1.4