Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

C2orf43 Gene

protein-coding   GIFtS: 47
GCID: GC02M020883

Chromosome 2 Open Reading Frame 43

  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
Chromosome 2 Open Reading Frame 431 2
UPF0554 Protein C2orf432

External Ids:    HGNC: 261451   Entrez Gene: 605262   Ensembl: ENSG000001189617   OMIM: 6135705   UniProtKB: Q9H6V93   

Export aliases for C2orf43 gene to outside databases

Previous GC identifers: GC02M020747 GC02M020641


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

GeneCards Summary for C2orf43 Gene: 
C2orf43 (chromosome 2 open reading frame 43) is a protein-coding gene. Diseases associated with C2orf43 include defective apolipoprotein b-100, and prostate cancer.


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000002.11  NT_015926.15  NC_018913.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the C2orf43 gene promoter:
         Sox5   AML1a   NF-AT   NF-AT4   SRY   NF-AT2   Sox9   NF-AT3   RSRFC4   NF-AT1   
         Other transcription factors

Browse SwitchGear Promoter luciferase reporter plasmids
   Search SABiosciences Chromatin IP Primers for C2orf43

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat C2orf43


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 2p24.1   Ensembl cytogenetic band:  2p24.1   HGNC cytogenetic band: 2p24.1

C2orf43 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
C2orf43 gene location

GeneLoc information about chromosome 2         GeneLoc Exon Structure

GeneLoc location for GC02M020883:  view genomic region     (about GC identifiers)

Start:
20,883,788 bp from pter      End:
21,022,882 bp from pter
Size:
139,095 bases      Orientation:
minus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: CB043_HUMAN, Q9H6V9 (See protein sequence)
Recommended Name: UPF0554 protein C2orf43  
Size: 325 amino acids; 37319 Da
Secondary accessions: D6W530 Q53T37 Q53T58
Alternative splicing: 2 isoforms:  Q9H6V9-1   Q9H6V9-2   

Explore the universe of human proteins at neXtProt for C2orf43: NX_Q9H6V9

Explore proteomics data for C2orf43 at MOPED 

Post-translational modifications:

  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_Q9H6V9

  • C2orf43 Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    C2orf43 Protein Expression
    REFSEQ proteins (7 alternative transcripts): 
    NP_001269648.1  NP_001269649.1  NP_001269650.1  NP_001269651.1  NP_001269652.1  NP_001269653.1  NP_068744.1  

    ENSEMBL proteins: 
     ENSP00000384267   ENSP00000370480   ENSP00000237822   ENSP00000396911   ENSP00000400910  
     ENSP00000385951   ENSP00000414710   ENSP00000388635   ENSP00000440570   ENSP00000400340  

    Human Recombinant Protein Products for C2orf43: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for C2orf43
    OriGene Protein Over-expression Lysate for C2orf43
    OriGene MassSpec for C2orf43 
    OriGene Custom Protein Services for C2orf43
    GenScript Custom Purified and Recombinant Proteins Services for C2orf43
    Novus Biologicals C2orf43 Protein
    Novus Biologicals C2orf43 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for C2orf43 


    C2orf43 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies for C2orf43
    OriGene Custom Antibody Services for C2orf43
    GenScript Custom Superior Antibodies Services for C2orf43
    Novus Biologicals C2orf43 Antibodies
    Abcam antibodies for C2orf43
    Cloud-Clone Corp. Antibodies for C2orf43 
    Search ThermoFisher Antibodies for C2orf43
    LSBio Antibodies in human, mouse, rat for C2orf43 

    Assay Products for C2orf43: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for C2orf43
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for C2orf43
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for C2orf43 
    Cloud-Clone Corp. CLIAs for C2orf43


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    1 InterPro protein domain:
     IPR019363 DUF2305

    Graphical View of Domain Structure for InterPro Entry Q9H6V9

    ProtoNet protein and cluster: Q9H6V9

    1 Blocks protein domain: IPB008262 Lipase

    UniProtKB/Swiss-Prot: CB043_HUMAN, Q9H6V9
    Similarity: Belongs to the UPF0554 family


    C2orf43 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Animal Models:
       inGenious Targeting Laboratory - Custom generated mouse model solutions for C2orf43 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for C2orf43

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for C2orf43 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for C2orf43 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat C2orf43
    8/12 QIAGEN miScript miRNA Assays for microRNAs that regulate C2orf43 (see all 12):
    hsa-miR-579 hsa-miR-1231 hsa-miR-125a-5p hsa-miR-3673 hsa-miR-4251 hsa-miR-659 hsa-miR-125b hsa-miR-670
    SwitchGear 3'UTR luciferase reporter plasmidC2orf43 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for C2orf43
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat C2orf43

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for C2orf43
    Sirion Biotech Customized adenovirus for overexpression of C2orf43

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for C2orf43 (see all 9)
    OriGene ORF clones in mouse, rat for C2orf43
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: C2orf43 (NM_021925)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for C2orf43
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat C2orf43
    Sirion Biotech Customized lentivirus for stable overexpression of C2orf43 
                         Customized lentivirus expression plasmids for stable overexpression of C2orf43 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for C2orf43
    Search LifeMap BioReagents cell lines for C2orf43
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for C2orf43


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section



    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for C2orf43

    STRING Interaction Network Preview (showing 1 interactants - click image to see more details)

    1 Interacting protein for C2orf43 (ENSP000002378224) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    UBCENSP000003448184STRING: ENSP00000344818
    About this table

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for C2orf43 (CB043)

    Search CenterWatch for drugs/clinical trials and news about C2orf43 / CB043

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for C2orf43 gene (7 alternative transcripts): 
    NM_001282719.1  NM_001282720.1  NM_001282721.1  NM_001282722.1  NM_001282723.1  NM_001282724.1  NM_021925.3  

    Unigene Cluster for C2orf43:

    Chromosome 2 open reading frame 43
    Hs.187823  [show with all ESTs]
    Unigene Representative Sequence: AK025473
    11 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000403006 ENST00000381090 ENST00000470099 ENST00000237822(uc002rec.3 uc010ykb.1 uc010ykc.1 uc010ykd.1 uc010ykf.1 uc021vem.1 uc010yke.1 uc010yka.1)
    ENST00000432947 ENST00000412261 ENST00000402479 ENST00000419825 ENST00000435420
    ENST00000541941 ENST00000440866
    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat C2orf43
    8/12 QIAGEN miScript miRNA Assays for microRNAs that regulate C2orf43 (see all 12):
    hsa-miR-579 hsa-miR-1231 hsa-miR-125a-5p hsa-miR-3673 hsa-miR-4251 hsa-miR-659 hsa-miR-125b hsa-miR-670
    SwitchGear 3'UTR luciferase reporter plasmidC2orf43 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for C2orf43
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat C2orf43
    Clone
    Products:
         
    OriGene clones in human, mouse for C2orf43 (see all 9)
    OriGene ORF clones in mouse, rat for C2orf43
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: C2orf43 (NM_021925)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for C2orf43
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat C2orf43
    Sirion Biotech Customized lentivirus for stable overexpression of C2orf43 
                         Customized lentivirus expression plasmids for stable overexpression of C2orf43 
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for C2orf43
    OriGene qSTAR qPCR primer pairs in human, mouse for C2orf43
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat C2orf43
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat C2orf43
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat C2orf43

    Additional mRNA sequence: 

    AK021672.1 AK025473.1 AK299244.1 AK299555.1 AK300494.1 AK301493.1 AK316162.1 AK316204.1 
    AK316310.1 AL137397.1 BC017473.1 

    10 DOTS entries:

    DT.452495  DT.100742292  DT.100784879  DT.92429981  DT.99970877  DT.95284919  DT.100737436  DT.75103947 
    DT.91857282  DT.95357995 

    24/132 AceView cDNA sequences (see all 132):

    AA875950 BE878924 BQ896608 BU621521 BU625320 BX282105 AL137397 BP377556 
    BQ897786 CK904115 CF995010 CA429054 BQ070503 CR617559 BM711475 BC017473 
    BI966098 BX493482 AI433208 BM475920 BU186211 AI784168 AU118617 BQ941691 

    GeneLoc Exon Structure

    4 Alternative Splicing Database (ASD) splice patterns (SP) for C2orf43    About this scheme

    ExUns: 1a · 1b ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6 ^ 7 ^ 8a · 8b ^ 9
    SP1:                                -                                       
    SP2:                                                                        
    SP3:                                                              -         
    SP4:                                -           -                           


    ECgene alternative splicing isoforms for C2orf43

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    C2orf43 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: TAAACAATAC
    C2orf43 Expression
    About this image


    See C2orf43 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for C2orf43

    SOURCE GeneReport for Unigene cluster: Hs.187823
        SABiosciences Custom PCR Arrays for C2orf43
    Primer
    Products:
    OriGene qPCR primer pairs and template standards for C2orf43
    OriGene qSTAR qPCR primer pairs in human, mouse for C2orf43
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat C2orf43
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat C2orf43
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat C2orf43
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for C2orf43

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for C2orf43 gene from 8/16 species (see all 16)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia 1110057K04Rik1 , 5 RIKEN cDNA 1110057K04 gene1, 5 76.79(n)1
    68.67(a)1
      12 (3.85 cM)5
    688321  NM_172401.41  NP_765989.31 
     82081075 
    chicken
    (Gallus gallus)
    Aves C3H2orf431 chromosome 3 open reading frame, human C2orf43 61.27(n)
    54.52(a)
      421967  NM_001031093.1  NP_001026264.1 
    lizard
    (Anolis carolinensis)
    Reptilia C2ORF436
    Uncharacterized protein
    49(a)
    1 ↔ 1
    1(155543644-155644220)
    zebrafish
    (Danio rerio)
    Actinopterygii zgc:1950621 zgc:195062 56.72(n)
    48.85(a)
      566336  NM_001130785.1  NP_001124257.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG91861 CG9186 46.67(n)
    35.59(a)
      38150  NM_138253.2  NP_612097.1 
    worm
    (Caenorhabditis elegans)
    Secernentea F26A3.11 Protein F26A3.1 42.91(n)
    31.03(a)
      172522  NM_059728.3  NP_492129.1 
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons AT3G116201 esterase/lipase domain-containing protein 44.53(n)
    27.73(a)
      820334  NM_180229.3  NP_850560.1 
    rice
    (Oryza sativa)
    Liliopsida Os01g09588001 hypothetical protein   --   4325392  NM_001051991.1  NP_001045456.1 


    ENSEMBL Gene Tree for C2orf43 (if available)
    TreeFam Gene Tree for C2orf43 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for C2orf43 gene
    1 SIMAP similar gene for C2orf43 using alignment to 9 protein entries:     CB043_HUMAN (see all proteins):
    FLJ21820

    C2orf43 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/2656 SNPs in C2orf43 are shown (see all 2656)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 2 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs61466701,2
    C--20728481(+) CCTTT-/GGACAATTTATTGCACACAT
    TATTTTCTAGCTTACACCCTTT
    TTAAG
    1 -- cds11Minor allele frequency- GGACAATTTATTGCACACATTATTTTCTAGCTTACACCCTTT:0.00NA 2
    rs675626471,2
    C,F--20884368(+) AAAGGT/CTGAGT 1 -- int16Minor allele frequency- C:0.15NA WA EA 364
    rs1390219981,2
    --20884379(+) GGAGAA/GGCGTA 1 -- int10--------
    rs116937521,2
    C,F,H--20884381(+) AGAAGC/TGTATG 1 -- int1 ese316Minor allele frequency- T:0.13NS EA WA NA CSA 1556
    rs1413907861,2
    C--20884382(+) GAAGCA/GTATGG 1 -- int10--------
    rs1898145451,2
    --20884481(+) AAACAA/C/TGGGTG 1 -- int10--------
    rs1508312231,2
    --20884513(+) GCACTC/TGGTAA 1 -- int10--------
    rs1931536441,2
    --20884524(+) CTCTGA/CAGGAA 1 -- int10--------
    rs101719341,2
    C,F,H--20884546(+) CACAAA/CGACCA 1 -- int1 ese312Minor allele frequency- C:0.34NA EA NS 686
    rs116938491,2
    C,F,A,H--20884550(+) AAGACC/AATCCA 1 -- int1 ese36Minor allele frequency- A:0.15NA WA EA 364

    HapMap Linkage Disequilibrium report for C2orf43 (20883788 - 21022882 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 4 variations for C2orf43:    About this table     
    Variant IDTypeSubtypePubMed ID
    esv2030538CNV Deletion18987734
    esv2719782CNV Deletion23290073
    esv2662336CNV Deletion23128226
    esv2719781CNV Deletion23290073

    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing C2orf43
    DNA2.0 Custom Variant and Variant Library Synthesis for C2orf43

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 613570    OMIM disorders: --

    3 diseases for C2orf43:    About MalaCards
    defective apolipoprotein b-100    prostate cancer    prostatitis


    C2orf43 for disorders           About GeneDecksing

    Genetic Association Database (GAD): C2orf43
    Human Genome Epidemiology (HuGE) Navigator: C2orf43 (2 documents)

    Export disorders for C2orf43 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for C2orf43 gene, integrated from 9 sources (see all 23):
    (articles sorted by number of sources associating them with C2orf43)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Familial defective apolipoprotein B-100 and increased low-density lipoprotein cholesterol and coronary artery calcification in the o ld order amish. (PubMed id 21059979)1, 4 Shen H....Mitchell B.D. (2010)
    2. Genome-wide association study identifies five new sus ceptibility loci for prostate cancer in the Japanese population. (PubMed id 20676098)1, 4 Takata R....Nakagawa H. (2010)
    3. Roles and origins of leukocyte lipid bodies: proteomic and ultrastructural studies. (PubMed id 17135363)1, 3 Wan H.C....Weller P.F. (2007)
    4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    5. Genome-wide screen for metabolic syndrome susceptibili ty Loci reveals strong lipid gene contribution but no evidence for common geneti c basis for clustering of metabolic syndrome traits. (PubMed id 22399527)4 Kristiansson K....Salomaa V. (2012)
    6. Replication and fine mapping for association of the C2 orf43, FOXP4, GPRC6A and RFX6 genes with prostate cancer in the Chinese populati on. (PubMed id 22662242)1 Long Q.Z....Liu X.G. (2012)
    7. Initial characterization of the human central proteome. (PubMed id 21269460)2 Burkard T.R.... Colinge J. (2011)
    8. A proteome-wide, quantitative survey of in vivo ubiqui tylation sites reveals widespread regulatory roles. (PubMed id 21890473)1 Wagner S.A....Choudhary C. (2011)
    9. Systematic and quantitative assessment of the ubiquiti n-modified proteome. (PubMed id 21906983)1 Kim W....Gygi S.P. (2011)
    10. Genome-wide association study of coronary heart disea se and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (PubMed id 21347282)4 Lettre G....Boerwinkle E. (2011)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 60526 HGNC: 26145 AceView: FLJ21820 Ensembl:ENSG00000118961 euGenes: HUgn60526
    ECgene: C2orf43 H-InvDB: C2orf43

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for C2orf43 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for C2orf43 gene:
    Search GeneIP for patents involving C2orf43

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for C2orf43   OriGene RNAi products in human, mouse, rat for C2orf43  
     OriGene qPCR primer pairs and template standards for C2orf43   OriGene Protein Over-expression Lysate for C2orf43  
     OriGene MassSpec something-or-other for C2orf43   OriGene clones in human, mouse for C2orf43  
     OriGene qSTAR qPCR primer pairs in human, mouse for C2orf43   OriGene Purified Protein for C2orf43  
     OriGene ORF clones in mouse, rat for C2orf43   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for C2orf43   OriGene Custom Protein Services for C2orf43  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat C2orf43
     QIAGEN SeqTarget long-range PCR primers for resequencing C2orf43
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat C2orf43
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat C2orf43
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat C2orf43
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat C2orf43
     GenScript Custom Purified and Recombinant Proteins Services for C2orf43 GenScript cDNA clones with any tag delivered in your preferred vector for C2orf43
     GenScript Custom Assay Services for C2orf43 GenScript Custom Superior Antibodies Services for C2orf43
     GenScript Custom overexpressing Cell Line Services for C2orf43 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in C2orf43 promoter
     Search Chromatin IP Primers for C2orf43
     RT2 qPCR Primer Assay in human, mouse, rat C2orf43
     Search GNC Networks for C2orf43
     SABiosciences Custom PCR Arrays for C2orf43
     Search Tocris compounds for C2orf43 (CB043)
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     C2orf43 antibodies
     C2orf43 proteins
     C2orf43 lysates
     Antibodies for C2orf43
     See all of Abcam's Antibodies, Kits and Proteins for C2orf43
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Proteins for C2orf43
     Antibodies for C2orf43
     ELISAs for C2orf43
     CLIAs for C2orf43
     Search LifeMap BioReagents cell lines for C2orf43
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for C2orf43
     SwitchGear 3'UTR luciferase reporter plasmids for C2orf43
     Browse SwitchGear Promoter luciferase reporter plasmids for C2orf43
     Search ThermoFisher Antibodies for C2orf43
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat C2orf43
     inGenious Targeting Laboratory - Custom generated mouse model solutions for C2orf43
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for C2orf43
    Customized:
     lentivirus for stable overexpression of C2orf43
     lentivirus expression plasmids for stable overexpression of C2orf43
     adenovirus for overexpression of C2orf43
     LSBio Antibodies in human, mouse, rat for C2orf43
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      C2orf43 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4