Free for academic non-profit institutions. Other users need a Commercial license

Aliases for C2CD4C Gene

Aliases for C2CD4C Gene

  • C2 Calcium-Dependent Domain Containing 4C 2 3 5
  • KIAA1957 2 3 4
  • Family With Sequence Similarity 148, Member C 2 3
  • Nuclear Localized Factor 3 2 3
  • Nuclear-Localized Factor 3 3 4
  • FAM148C 3 4
  • NLF3 3 4
  • Protein FAM148C 4

External Ids for C2CD4C Gene

Previous HGNC Symbols for C2CD4C Gene

  • KIAA1957
  • FAM148C

Previous GeneCards Identifiers for C2CD4C Gene

  • GC19M000363
  • GC19M000177

Summaries for C2CD4C Gene

GeneCards Summary for C2CD4C Gene

C2CD4C (C2 Calcium-Dependent Domain Containing 4C) is a Protein Coding gene. An important paralog of this gene is C2CD4A.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for C2CD4C Gene

Genomics for C2CD4C Gene

Regulatory Elements for C2CD4C Gene

Enhancers for C2CD4C Gene
GeneHancer Identifier Score Enhancer Sources TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Other Gene Targets for Enhancer

Enhancers around C2CD4C on UCSC Golden Path with GeneCards custom track

Genomic Location for C2CD4C Gene

Chromosome:
19
Start:
405,435 bp from pter
End:
409,170 bp from pter
Size:
3,736 bases
Orientation:
Minus strand

Genomic View for C2CD4C Gene

Genes around C2CD4C on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
C2CD4C Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for C2CD4C Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for C2CD4C Gene

Proteins for C2CD4C Gene

  • Protein details for C2CD4C Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q8TF44-C2C4C_HUMAN
    Recommended name:
    C2 calcium-dependent domain-containing protein 4C
    Protein Accession:
    Q8TF44
    Secondary Accessions:
    • Q8N3H7

    Protein attributes for C2CD4C Gene

    Size:
    421 amino acids
    Molecular mass:
    44576 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=BAB85543.1; Type=Erroneous initiation; Evidence={ECO:0000305};

neXtProt entry for C2CD4C Gene

Proteomics data for C2CD4C Gene at MOPED

Post-translational modifications for C2CD4C Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for C2CD4C Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for C2CD4C Gene

Domains & Families for C2CD4C Gene

Gene Families for C2CD4C Gene

Protein Domains for C2CD4C Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for C2CD4C Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q8TF44

UniProtKB/Swiss-Prot:

C2C4C_HUMAN :
  • Contains 1 C2 domain.
  • Belongs to the C2CD4 family.
Domain:
  • Contains 1 C2 domain.
Family:
  • Belongs to the C2CD4 family.
genes like me logo Genes that share domains with C2CD4C: view

Function for C2CD4C Gene

Gene Ontology (GO) - Molecular Function for C2CD4C Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005509 calcium ion binding IBA --
GO:0005544 calcium-dependent phospholipid binding IBA --
GO:0019905 NOT syntaxin binding IBA --
genes like me logo Genes that share ontologies with C2CD4C: view

Phenotypes for C2CD4C Gene

GenomeRNAi human phenotypes for C2CD4C:
genes like me logo Genes that share phenotypes with C2CD4C: view

Animal Model Products

CRISPR Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for C2CD4C Gene

Localization for C2CD4C Gene

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for C2CD4C Gene COMPARTMENTS Subcellular localization image for C2CD4C gene
Compartment Confidence
cytosol 3
nucleus 3

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for C2CD4C Gene

Pathways & Interactions for C2CD4C Gene

SuperPathways for C2CD4C Gene

No Data Available

Interacting Proteins for C2CD4C Gene

Gene Ontology (GO) - Biological Process for C2CD4C Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0048791 NOT calcium ion-regulated exocytosis of neurotransmitter IBA --
genes like me logo Genes that share ontologies with C2CD4C: view

No data available for Pathways by source and SIGNOR curated interactions for C2CD4C Gene

Drugs & Compounds for C2CD4C Gene

No Compound Related Data Available

Transcripts for C2CD4C Gene

mRNA/cDNA for C2CD4C Gene

(2) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(23) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for C2CD4C Gene

C2 calcium-dependent domain containing 4C:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for C2CD4C Gene

No ASD Table

Relevant External Links for C2CD4C Gene

GeneLoc Exon Structure for
C2CD4C
ECgene alternative splicing isoforms for
C2CD4C

Expression for C2CD4C Gene

mRNA expression in normal human tissues for C2CD4C Gene

mRNA differential expression in normal tissues according to GTEx for C2CD4C Gene

This gene is overexpressed in Brain - Cortex (x7.1), Brain - Anterior cingulate cortex (BA24) (x5.9), Brain - Amygdala (x5.4), Brain - Frontal Cortex (BA9) (x5.2), and Brain - Hypothalamus (x4.3).

Protein differential expression in normal tissues from HIPED for C2CD4C Gene

This gene is overexpressed in Fetal Brain (35.5), Frontal cortex (27.4), and Brain (6.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MOPED, and MaxQB for C2CD4C Gene



SOURCE GeneReport for Unigene cluster for C2CD4C Gene Hs.223770

genes like me logo Genes that share expression patterns with C2CD4C: view

Protein tissue co-expression partners for C2CD4C Gene

- Elite partner

Primer Products

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA Expression by UniProt/SwissProt for C2CD4C Gene

Orthologs for C2CD4C Gene

This gene was present in the common ancestor of chordates.

Orthologs for C2CD4C Gene

Organism Taxonomy Gene Similarity Type Details
mouse
(Mus musculus)
Mammalia C2cd4c 35
  • 84.13 (n)
  • 91.39 (a)
C2cd4c 16
C2cd4c 36
  • 91 (a)
OneToOne
chimpanzee
(Pan troglodytes)
Mammalia C2CD4C 35
  • 98.68 (n)
  • 99.34 (a)
rat
(Rattus norvegicus)
Mammalia C2cd4c 35
  • 82.42 (n)
  • 90.74 (a)
cow
(Bos Taurus)
Mammalia C2CD4C 36
  • 90 (a)
OneToOne
dog
(Canis familiaris)
Mammalia C2CD4C 36
  • 76 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia C2CD4C 36
  • 72 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia C2CD4C 36
  • 58 (a)
OneToOne
chicken
(Gallus gallus)
Aves C2CD4C 35
  • 70.85 (n)
  • 67.34 (a)
C2CD4C 36
  • 61 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia C2CD4C 36
  • 63 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia c2cd4c 35
  • 60.42 (n)
  • 63.26 (a)
Str.13420 35
zebrafish
(Danio rerio)
Actinopterygii LOC568754 35
  • 61.28 (n)
  • 59.2 (a)
C2CD4C (1 of 2) 36
  • 56 (a)
OneToMany
C2CD4C (2 of 2) 36
  • 54 (a)
OneToMany
Species with no ortholog for C2CD4C:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for C2CD4C Gene

ENSEMBL:
Gene Tree for C2CD4C (if available)
TreeFam:
Gene Tree for C2CD4C (if available)

Paralogs for C2CD4C Gene

Paralogs for C2CD4C Gene

genes like me logo Genes that share paralogs with C2CD4C: view

Variants for C2CD4C Gene

Sequence variations from dbSNP and Humsavar for C2CD4C Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type
rs12978500 -- 406,934(+) GGAAA(A/C)CCTGC intron-variant, utr-variant-3-prime
rs12980274 -- 409,977(+) AGAAG(A/G)CACAT upstream-variant-2KB
rs12984921 -- 406,991(+) CCCCG(C/G)CCAGC intron-variant, utr-variant-3-prime
rs8104383 -- 406,370(+) AGTGT(C/T)GGAGG utr-variant-3-prime
rs71171980 -- 405,087(+) GTGTG(-/GGGGGAACGGGGTCCTGCCCTGAGGGGTGTGGGGGGAACGGGGTCCTGCCCTGAGGGGTGTGGAGGGGGGATGGGGTCCTGCCCTGAGGGGTGTGAGGGGAACGGGGTCCTGCCCTGAGGGGTGTGGGGGGAACGGGGTCCTGCCCTGAGGGGTGTG)AGGGG downstream-variant-500B

Structural Variations from Database of Genomic Variants (DGV) for C2CD4C Gene

Variant ID Type Subtype PubMed ID
nsv428360 CNV Gain 18775914
dgv3498n71 CNV Loss 21882294
nsv910083 CNV Loss 21882294
dgv3499n71 CNV Loss 21882294
dgv3500n71 CNV Loss 21882294
dgv3501n71 CNV Gain 21882294
nsv910089 CNV Loss 21882294
dgv3502n71 CNV Loss 21882294
nsv910094 CNV Gain+Loss 21882294
dgv3503n71 CNV Loss 21882294
dgv3504n71 CNV Loss 21882294
dgv3505n71 CNV Loss 21882294
nsv910102 CNV Loss 21882294
nsv817810 CNV Loss 17921354
nsv910109 CNV Loss 21882294
nsv509712 CNV Insertion 20534489
esv2671474 CNV Deletion 23128226
nsv470101 CNV Loss 18288195
nsv910112 CNV Loss 21882294

Variation tolerance for C2CD4C Gene

Gene Damage Index Score: 2.19; 39.57% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for C2CD4C Gene

HapMap Linkage Disequilibrium report
C2CD4C

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for C2CD4C Gene

Disorders for C2CD4C Gene

Relevant External Links for C2CD4C

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
C2CD4C

No disorders were found for C2CD4C Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for C2CD4C Gene

Publications for C2CD4C Gene

  1. Prediction of the coding sequences of unidentified human genes. XXII. The complete sequences of 50 new cDNA clones which code for large proteins. (PMID: 11853319) Nagase T. … Ohara O. (DNA Res. 2001) 2 3 4 67
  2. Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (PMID: 23251661) Comuzzie A.G. … Butte N.F. (PLoS ONE 2012) 3
  3. A novel gene family induced by acute inflammation in endothelial cells. (PMID: 15527968) Warton K. … Stanley K.K. (Gene 2004) 3

Products for C2CD4C Gene

Sources for C2CD4C Gene

Content