Free for academic non-profit institutions. Other users need a Commercial license

Aliases for C2-AS1 Gene

Subcategory (RNA class) for C2-AS1 Gene

non-coding RNA

Quality Score for this RNA gene is

3

Aliases for C2-AS1 Gene

  • C2 Antisense RNA 1 2 3 5

External Ids for C2-AS1 Gene

Previous GeneCards Identifiers for C2-AS1 Gene

  • GC06U902559

Summaries for C2-AS1 Gene

GeneCards Summary for C2-AS1 Gene

C2-AS1 (C2 Antisense RNA 1) is an RNA Gene, and is affiliated with the non-coding RNA class.

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for C2-AS1 Gene

Genomics for C2-AS1 Gene

Regulatory Elements for C2-AS1 Gene

Enhancers for C2-AS1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH06G031940 0.8 ENCODE 0.7 +1.4 1356 0.3 SIX4 TFAP4 KLF1 SAP130 FEZF1 TEAD3 ZFHX2 GATA3 NCOR1 EGR2 SKIV2L C2-AS1 ENSG00000244255
GH06G031928 1 ENCODE 0.4 +12.2 12249 1.2 PKNOX1 AGO1 ZFP64 ARID4B SIN3A ZNF2 YY1 ZNF766 ZNF143 ZNF207 SKIV2L LY6G5B ATF6B DDX39B NFKBIL1 LSM2 PPT2 MIR1236 TCF19 STK19
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around C2-AS1 on UCSC Golden Path with GeneCards custom track

Genomic Location for C2-AS1 Gene

Chromosome:
6
Start:
31,934,474 bp from pter
End:
31,941,724 bp from pter
Size:
7,251 bases
Orientation:
Minus strand

Genomic View for C2-AS1 Gene

Genes around C2-AS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
C2-AS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for C2-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

Proteins for C2-AS1 Gene

Post-translational modifications for C2-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for C2-AS1 Gene

Domains & Families for C2-AS1 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for C2-AS1 Gene

Function for C2-AS1 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for C2-AS1 Gene

Localization for C2-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for C2-AS1 Gene

Pathways & Interactions for C2-AS1 Gene

SuperPathways for C2-AS1 Gene

No Data Available

Interacting Proteins for C2-AS1 Gene

Gene Ontology (GO) - Biological Process for C2-AS1 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for C2-AS1 Gene

Drugs & Compounds for C2-AS1 Gene

No Compound Related Data Available

Transcripts for C2-AS1 Gene

mRNA/cDNA for C2-AS1 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for C2-AS1 Gene

No ASD Table

Relevant External Links for C2-AS1 Gene

GeneLoc Exon Structure for
C2-AS1
ECgene alternative splicing isoforms for
C2-AS1

Expression for C2-AS1 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for C2-AS1 Gene

Orthologs for C2-AS1 Gene

Evolution for C2-AS1 Gene

ENSEMBL:
Gene Tree for C2-AS1 (if available)
TreeFam:
Gene Tree for C2-AS1 (if available)

No data available for Orthologs for C2-AS1 Gene

Paralogs for C2-AS1 Gene

No data available for Paralogs for C2-AS1 Gene

Variants for C2-AS1 Gene

Sequence variations from dbSNP and Humsavar for C2-AS1 Gene

SNP ID Clin Chr 06 pos Sequence Context AA Info Type
rs9332739 Pathogenic 31,936,027(+) ACTGA(C/G)GTGAT intron-variant, reference, missense
rs9332736 Likely pathogenic 31,934,291(+) TCATG(-/CAGACTCCTGATTCCTGACCCTGTCCAC/GTGGACAGGGTCAGGAATCAGGAGTCTG)CCTGC intron-variant, downstream-variant-500B, reference, frameshift-variant
rs1042663 Likely benign 31,937,353(+) TATGC(A/G)GCCTT intron-variant, reference, synonymous-codon
rs117576077 Likely benign 31,939,220(+) ATTCT(C/T)TTTGT intron-variant
rs140225293 Likely benign 31,943,100(+) GCTGG(A/G)TGAGT upstream-variant-2KB, splice-donor-variant

Structural Variations from Database of Genomic Variants (DGV) for C2-AS1 Gene

Variant ID Type Subtype PubMed ID
dgv10403n54 CNV loss 21841781
dgv10404n54 CNV loss 21841781
dgv10463n54 CNV loss 21841781
esv2759415 CNV gain+loss 17122850
esv3570963 CNV loss 25503493
nsv1073969 CNV deletion 25765185
nsv1112900 CNV deletion 24896259
nsv1126749 CNV deletion 24896259
nsv428141 CNV gain+loss 18775914
nsv508399 CNV deletion 20534489
nsv509126 CNV insertion 20534489
nsv601960 CNV loss 21841781
nsv830628 CNV loss 17160897

Relevant External Links for C2-AS1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
C2-AS1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for C2-AS1 Gene

Disorders for C2-AS1 Gene

Relevant External Links for C2-AS1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
C2-AS1

No disorders were found for C2-AS1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for C2-AS1 Gene

Publications for C2-AS1 Gene

  1. Heritability and genome-wide association study to assess genetic differences between advanced age-related macular degeneration subtypes. (PMID: 22705344) Sobrin L. … Seddon J.M. (Ophthalmology 2012) 3 64
  2. Common variants near FRK/COL10A1 and VEGFA are associated with advanced age-related macular degeneration. (PMID: 21665990) Yu Y. … Seddon J.M. (Hum. Mol. Genet. 2011) 3 64
  3. Genetic variants near TIMP3 and high-density lipoprotein-associated loci influence susceptibility to age-related macular degeneration. (PMID: 20385819) Chen W. … Swaroop A. (Proc. Natl. Acad. Sci. U.S.A. 2010) 3 64

Products for C2-AS1 Gene

Sources for C2-AS1 Gene

Content
Loading form....