Free for academic non-profit institutions. Other users need a Commercial license

Aliases for C2 Gene

Aliases for C2 Gene

  • Complement C2 2 3 5
  • Complement Component 2 2 3
  • C3/C5 Convertase 3 4
  • EC 3.4.21.43 4 61
  • Complement Component C2 3
  • EC 3.4.21 61
  • ARMD14 3
  • CO2 3

External Ids for C2 Gene

Previous GeneCards Identifiers for C2 Gene

  • GC06P031957
  • GC06P031636
  • GC06P031999
  • GC06P032003
  • GC06P031865
  • GC06P031682

Summaries for C2 Gene

Entrez Gene Summary for C2 Gene

  • Component C2 is a serum glycoprotein that functions as part of the classical pathway of the complement system. Activated C1 cleaves C2 into C2a and C2b. The serine proteinase C2a then combines with complement factor 4b to create the C3 or C5 convertase. Deficiency of C2 has been reported to associated with certain autoimmune diseases and SNPs in this gene have been associated with altered susceptibility to age-related macular degeneration. This gene localizes within the class III region of the MHC on the short arm of chromosome 6. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described in publications but their full-length sequence has not been determined.[provided by RefSeq, Mar 2009]

GeneCards Summary for C2 Gene

C2 (Complement C2) is a Protein Coding gene. Diseases associated with C2 include C2 Deficiency and Macular Degeneration, Age-Related, 14, Reduced Risk Of. Among its related pathways are Immune System and Complement Pathway. GO annotations related to this gene include serine-type endopeptidase activity. An important paralog of this gene is ENSG00000244255.

UniProtKB/Swiss-Prot for C2 Gene

  • Component C2 which is part of the classical pathway of the complement system is cleaved by activated factor C1 into two fragments: C2b and C2a. C2a, a serine protease, then combines with complement factor C4b to generate the C3 or C5 convertase.

Gene Wiki entry for C2 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for C2 Gene

Genomics for C2 Gene

Regulatory Elements for C2 Gene

Enhancers for C2 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH06F031944 1.1 Ensembl ENCODE 12.2 +49.8 49754 6.8 HDGF PKNOX1 ARNT CREB3L1 MLX ARID4B DMAP1 YY1 SLC30A9 FOS SKIV2L STK19B HLA-DRB1 ATF6B C4A HLA-DQA2 C2 STK19 EHMT2 ZBTB12
GH06F031928 1.2 Ensembl ENCODE 11.3 +31.6 31642 1.3 PKNOX1 ZFP64 ARID4B SIN3A ZNF2 ZNF48 YY1 GLIS2 ZNF766 ZNF143 SKIV2L LY6G5B ATF6B DDX39B NFKBIL1 LSM2 PPT2 MIR1236 TCF19 STK19
GH06F031861 0.2 ENCODE 11.3 -33.7 -33670 4.5 MLX CREB3L1 ZFP64 FEZF1 DMAP1 YBX1 YY1 SLC30A9 ZNF548 ZNF263 LY6G5B LSM2 MICA C4A SNORA38 ENSG00000233902 LOC102725019 DDX39B STK19B LY6G5C
GH06F032104 0.5 FANTOM5 2 +206.7 206670 0.1 PKNOX1 ZIC2 SKIV2L TNXB C2 RNA5SP206
GH06F031900 0.4 ENCODE 0.8 +2.4 2408 0.1 KLF1 KLF17 HIC1 ZNF335 PATZ1 PRDM10 ZNF600 SP3 ZBTB2 SP2 SNORA38 ENSG00000233902 LOC102725019 DDX39B BAG6 C6orf47 LY6G5B C2 ZBTB12
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around C2 on UCSC Golden Path with GeneCards custom track

Promoters for C2 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000487931 -185 2401 PKNOX1 ARNT MLX CREB3L1 ZFP64 ARID4B SIN3A DMAP1 ZNF2 YY1

Genomic Location for C2 Gene

Chromosome:
6
Start:
31,897,785 bp from pter
End:
31,945,674 bp from pter
Size:
47,890 bases
Orientation:
Plus strand

Genomic View for C2 Gene

Genes around C2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
C2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for C2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

Proteins for C2 Gene

  • Protein details for C2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P06681-CO2_HUMAN
    Recommended name:
    Complement C2
    Protein Accession:
    P06681
    Secondary Accessions:
    • B4DPF3
    • B4DV20
    • E9PFN7
    • O19694
    • Q13904

    Protein attributes for C2 Gene

    Size:
    752 amino acids
    Molecular mass:
    83268 Da
    Quaternary structure:
    • C2a interacts with Schistosoma haematobium TOR (via N-terminal extracellular domain). This results in inhibition of the classical and lectin pathway of complement activation, probably due to interference with binding of C2a to C4b such that C3 convertase cannot be formed. This infers resistance to complement-mediated cell lysis, allowing parasite survival and infection.
    Miscellaneous:
    • C2 is a major histocompatibility complex class-III protein.

    Three dimensional structures from OCA and Proteopedia for C2 Gene

    Alternative splice isoforms for C2 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for C2 Gene

Selected DME Specific Peptides for C2 Gene

P06681:
  • KVKMSTHARPICLPCT
  • LGATNPTQ
  • MVDRIFSFEI
  • VLTAAHC
  • SFECEDGF
  • IILLTDGKSNMG
  • GSTCRDHE
  • LRGSPVR
  • PCKGESGGAVFL
  • RPICLPCT
  • QPWLRQHL
  • WDGETAVCDNGA
  • NYKDHENGTGTN
  • GVWSGTE
  • HCPNPGIS
  • VAIITFAS
  • RDFHINL
  • LGSKKDGERHAFIL
  • DYLDIYAIGVG
  • EFYGDDIALLKL
  • LWRVNVGDP
  • IQRSGHLNLYLLLD
  • GDKVRYRCSS
  • RFFQVGLVSWGL
  • CKPVRCPAPVSFENG
  • EVVTDQFLCSG
  • ICGVGNMSANAS
  • KALHQVF
  • WVLTAAHCFR
  • LTAAHCF
  • WVLTAAH
  • PAHFVALNG
  • ICRQPYSYDFPEDVAPALGTSFSH
  • FTLSHGWAPGSLL

Post-translational modifications for C2 Gene

  • Glycosylation at Asn 29, Asn 112, Asn 290, Asn 333, Asn 467, Asn 471, Asn 621, and Asn 651
  • Modification sites at PhosphoSitePlus

Antibody Products

  • R&D Systems Antibodies for C2 (Complement Component C2)
  • R&D Systems Antibodies for C2 (Complement Component C2b)
  • Abcam antibodies for C2

Domains & Families for C2 Gene

Graphical View of Domain Structure for InterPro Entry

P06681

UniProtKB/Swiss-Prot:

CO2_HUMAN :
  • The MIDAS-like motif in the VWFA domain binds divalent metal cations.
  • Belongs to the peptidase S1 family.
Domain:
  • The MIDAS-like motif in the VWFA domain binds divalent metal cations.
  • Contains 1 peptidase S1 domain.
  • Contains 3 Sushi (CCP/SCR) domains.
  • Contains 1 VWFA domain.
Family:
  • Belongs to the peptidase S1 family.
genes like me logo Genes that share domains with C2: view

Function for C2 Gene

Molecular function for C2 Gene

GENATLAS Biochemistry:
complement component 2,110kDa,activated by C1r to form C2a and C2b,combining with C4A and C4B to form C3/C5 convertase,classical pathway of C3 activation
UniProtKB/Swiss-Prot CatalyticActivity:
Selective cleavage of Arg- -Ser bond in complement component C3 alpha-chain to form C3a and C3b, and Arg- -Xaa bond in complement component C5 alpha-chain to form C5a and C5b.
UniProtKB/Swiss-Prot Function:
Component C2 which is part of the classical pathway of the complement system is cleaved by activated factor C1 into two fragments: C2b and C2a. C2a, a serine protease, then combines with complement factor C4b to generate the C3 or C5 convertase.

Enzyme Numbers (IUBMB) for C2 Gene

Gene Ontology (GO) - Molecular Function for C2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004252 serine-type endopeptidase activity IEA,TAS --
GO:0008233 peptidase activity IEA --
GO:0008236 serine-type peptidase activity IEA --
GO:0016787 hydrolase activity IEA --
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with C2: view
genes like me logo Genes that share phenotypes with C2: view

Human Phenotype Ontology for C2 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

  • Taconic Biosciences Mouse Models for C2

miRNA for C2 Gene

miRTarBase miRNAs that target C2

Flow Cytometry Products

No data available for Animal Models , Transcription Factor Targets and HOMER Transcription for C2 Gene

Localization for C2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for C2 Gene

Secreted.

Gene Ontology (GO) - Cellular Components for C2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region IEA,TAS --
GO:0005615 extracellular space IEA,TAS --
GO:0070062 extracellular exosome IDA 23533145
genes like me logo Genes that share ontologies with C2: view

No data available for Subcellular locations from COMPARTMENTS for C2 Gene

Pathways & Interactions for C2 Gene

genes like me logo Genes that share pathways with C2: view

Gene Ontology (GO) - Biological Process for C2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006508 proteolysis IEA --
GO:0006956 complement activation IEA,TAS --
GO:0006958 complement activation, classical pathway IEA --
GO:0007584 response to nutrient IEA --
GO:0030449 regulation of complement activation TAS --
genes like me logo Genes that share ontologies with C2: view

No data available for SIGNOR curated interactions for C2 Gene

Drugs & Compounds for C2 Gene

(1) Drugs for C2 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
genes like me logo Genes that share compounds with C2: view

Transcripts for C2 Gene

Unigene Clusters for C2 Gene

Complement component 2:
Representative Sequences:

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for C2 Gene

ExUns: 1a · 1b · 1c · 1d · 1e ^ 2a · 2b ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8a · 8b · 8c · 8d ^ 9 ^ 10a · 10b ^ 11 ^ 12a · 12b ^ 13 ^ 14a · 14b ·
SP1: - - - - -
SP2: - - - - - -
SP3: -
SP4: - - - - - - - - - - - -
SP5: - - - - - - - -
SP6: -
SP7: - -
SP8: - - -
SP9: - - - - -
SP10:
SP11:
SP12: -

ExUns: 14c ^ 15a · 15b ^ 16 ^ 17 ^ 18 ^ 19 ^ 20
SP1:
SP2:
SP3: -
SP4:
SP5:
SP6:
SP7:
SP8:
SP9:
SP10:
SP11:
SP12:

Relevant External Links for C2 Gene

GeneLoc Exon Structure for
C2
ECgene alternative splicing isoforms for
C2

Expression for C2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for C2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for C2 Gene

This gene is overexpressed in Liver (x28.4).

Protein differential expression in normal tissues from HIPED for C2 Gene

This gene is overexpressed in Synovial fluid (18.8), Serum (16.2), and Monocytes (12.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for C2 Gene



Protein tissue co-expression partners for C2 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of C2 Gene:

C2

SOURCE GeneReport for Unigene cluster for C2 Gene:

Hs.408903
genes like me logo Genes that share expression patterns with C2: view

Primer Products

No data available for mRNA Expression by UniProt/SwissProt for C2 Gene

Orthologs for C2 Gene

This gene was present in the common ancestor of chordates.

Orthologs for C2 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia C2 34 35
  • 99.65 (n)
dog
(Canis familiaris)
Mammalia C2 34
  • 85.29 (n)
cow
(Bos Taurus)
Mammalia C2 34 35
  • 83.73 (n)
rat
(Rattus norvegicus)
Mammalia C2 34
  • 80.21 (n)
mouse
(Mus musculus)
Mammalia C2 34 16 35
  • 79.5 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia C2 35
  • 57 (a)
OneToOne
chicken
(Gallus gallus)
Aves C2 34 35
  • 54.74 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia c2 34
  • 49.51 (n)
zebrafish
(Danio rerio)
Actinopterygii LOC563828 34
  • 48.98 (n)
C2 35
  • 31 (a)
OneToOne
-- 34
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 20 (a)
ManyToMany
-- 35
  • 19 (a)
ManyToMany
-- 35
  • 18 (a)
ManyToMany
Species where no ortholog for C2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for C2 Gene

ENSEMBL:
Gene Tree for C2 (if available)
TreeFam:
Gene Tree for C2 (if available)

Paralogs for C2 Gene

Variants for C2 Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for C2 Gene

CO2_HUMAN-P06681
The variant Asp-318 is associated with a reduced risk of age-related macular degeneration (ARMD) [MIM:603075]. ARMD is a multifactorial eye disease and the most common cause of irreversible vision loss in the developed world.

Sequence variations from dbSNP and Humsavar for C2 Gene

SNP ID Clin Chr 06 pos Sequence Context AA Info Type
rs151340617 Complement component 2 deficiency (C2D) [MIM:217000] 31,943,254(+) TCTGC(A/G)GGGTG upstream-variant-2KB, reference, missense
rs28934590 Complement component 2 deficiency (C2D) [MIM:217000] 31,933,876(+) CTACT(C/T)TTATG intron-variant, reference, missense
rs760744400 Complement component 2 deficiency (C2D) [MIM:217000] 31,928,867(+) TCAGT(A/G)TCGCC intron-variant, reference, missense
rs9332739 Pathogenic 31,936,027(+) ACTGA(C/G)GTGAT intron-variant, reference, missense
rs9332736 Likely pathogenic 31,934,291(+) TCATG(-/GTGGACAGGGTCAGGAATCAGGAGTCTG)CCTGC intron-variant, downstream-variant-500B, reference, frameshift-variant

Structural Variations from Database of Genomic Variants (DGV) for C2 Gene

Variant ID Type Subtype PubMed ID
dgv10403n54 CNV loss 21841781
dgv10404n54 CNV loss 21841781
dgv10463n54 CNV loss 21841781
dgv10464n54 CNV loss 21841781
dgv10465n54 CNV loss 21841781
esv2422045 CNV deletion 20811451
esv2658525 CNV deletion 23128226
esv2663182 CNV deletion 23128226
esv2731824 CNV deletion 23290073
esv2759415 CNV gain+loss 17122850
esv3567540 CNV deletion 23714750
esv3570963 CNV loss 25503493
esv3608572 CNV loss 21293372
esv3608573 CNV loss 21293372
esv3890823 CNV loss 25118596
esv988690 CNV gain 20482838
nsv1073969 CNV deletion 25765185
nsv10822 CNV gain 18304495
nsv10823 CNV loss 18304495
nsv1112900 CNV deletion 24896259
nsv1126749 CNV deletion 24896259
nsv428141 CNV gain+loss 18775914
nsv508399 CNV deletion 20534489
nsv509126 CNV insertion 20534489
nsv601960 CNV loss 21841781
nsv601965 CNV loss 21841781
nsv823505 CNV loss 20364138
nsv830628 CNV loss 17160897

Variation tolerance for C2 Gene

Residual Variation Intolerance Score: 54.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.09; 50.87% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for C2 Gene

Human Gene Mutation Database (HGMD)
C2
SNPedia medical, phenotypic, and genealogical associations of SNPs for
C2

Disorders for C2 Gene

MalaCards: The human disease database

(10) MalaCards diseases for C2 Gene - From: OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
c2 deficiency
  • complement component 2 deficiency
macular degeneration, age-related, 14, reduced risk of
  • age related macular degeneration 14
immunodeficiency due to a classical component pathway complement deficiency
  • immunodeficiency due to a c1, c4, or c2 component complement deficiency
complement component c2 deficiency
  • c2 deficiency
macular degeneration, age-related, 1
  • macular degeneration, age-related, reduced risk of
- elite association - COSMIC cancer census association via MalaCards
Search C2 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

CO2_HUMAN
  • Complement component 2 deficiency (C2D) [MIM:217000]: A rare defect of the complement classical pathway associated with the development of autoimmune disorders, mainly systemic lupus erythematosus. Skin and joint manifestations are common and renal disease is relatively rare. Patients with complement component 2 deficiency are also reported to have recurrent invasive infections. {ECO:0000269 PubMed:8621452, ECO:0000269 PubMed:9670930}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Genatlas disease for C2 Gene

Henoch-Schonlein purpura susceptibility,lupus systemic discoid syndrome,polymyositis susceptibility (C2 deficiency,type I)

Relevant External Links for C2

Genetic Association Database (GAD)
C2
Human Genome Epidemiology (HuGE) Navigator
C2
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
C2
genes like me logo Genes that share disorders with C2: view

Publications for C2 Gene

  1. Variation in factor B (BF) and complement component 2 (C2) genes is associated with age-related macular degeneration. (PMID: 16518403) Gold B. … Allikmets R. (Nat. Genet. 2006) 3 4 46 64
  2. A novel type II complement C2 deficiency allele in an African- American family. (PMID: 9670930) Zhu Z.B. … Volanakis J.E. (J. Immunol. 1998) 3 4 22 64
  3. Structure of the human C2 gene. (PMID: 8326124) Ishii Y. … Volanakis J.E. (J. Immunol. 1993) 3 4 22 64
  4. Simultaneous mutation detection in 90 retinal disease genes in multiple patients using a custom-designed 300-kb retinal resequencing chip. (PMID: 20801516) Booij J.C. … Florijn R.J. (Ophthalmology 2011) 3 46 64
  5. Common variants near FRK/COL10A1 and VEGFA are associated with advanced age-related macular degeneration. (PMID: 21665990) Yu Y. … Seddon J.M. (Hum. Mol. Genet. 2011) 3 46 64

Products for C2 Gene

Sources for C2 Gene

Content
Loading form....