Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

C1orf94 Gene

protein-coding   GIFtS: 44
GCID: GC01P034632

Chromosome 1 Open Reading Frame 94

  Search for C1orf94
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
Chromosome 1 Open Reading Frame 941 2
Uncharacterized Protein C1orf942

External Ids:    HGNC: 282501   Entrez Gene: 849702   Ensembl: ENSG000001426987   UniProtKB: Q6P1W53   

Export aliases for C1orf94 gene to outside databases

Previous GC identifers: GC01P034303 GC01P034405 GC01P032749


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

GeneCards Summary for C1orf94 Gene: 
C1orf94 (chromosome 1 open reading frame 94) is a protein-coding gene. GO annotations related to this gene include protein binding.


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000001.10  NC_018912.2  NT_032977.9  
Regulatory elements:
   Search SABiosciences Regulatory transcription factor binding sites for C1orf94
         Other transcription factors

Browse SwitchGear Promoter luciferase reporter plasmids
   Search SABiosciences Chromatin IP Primers for C1orf94

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat C1orf94


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 1p34.3   Ensembl cytogenetic band:  1p34.3   HGNC cytogenetic band: 1p34.3

C1orf94 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
C1orf94 gene location

GeneLoc information about chromosome 1         GeneLoc Exon Structure

GeneLoc location for GC01P034632:  view genomic region     (about GC identifiers)

Start:
34,632,484 bp from pter      End:
34,684,732 bp from pter
Size:
52,249 bases      Orientation:
plus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: CA094_HUMAN, Q6P1W5 (See protein sequence)
Recommended Name: Uncharacterized protein C1orf94  
Size: 598 amino acids; 65353 Da
Secondary accessions: B3KVT1 D3DPR3 E9PJ76 Q96IC8
Alternative splicing: 2 isoforms:  Q6P1W5-1   Q6P1W5-2   

Explore the universe of human proteins at neXtProt for C1orf94: NX_Q6P1W5

Explore proteomics data for C1orf94 at MOPED 

Post-translational modifications:

  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_Q6P1W5

  • C1orf94 Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    C1orf94 Protein Expression
    REFSEQ proteins (2 alternative transcripts): 
    NP_001128206.1  NP_116273.2  

    ENSEMBL proteins: 
     ENSP00000362472   ENSP00000435634  

    Human Recombinant Protein Products for C1orf94: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for C1orf94
    OriGene Protein Over-expression Lysate for C1orf94
    OriGene MassSpec for C1orf94 
    OriGene Custom Protein Services for C1orf94
    GenScript Custom Purified and Recombinant Proteins Services for C1orf94
    Novus Biologicals C1orf94 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for C1orf94 


    C1orf94 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for C1orf94
    GenScript Custom Superior Antibodies Services for C1orf94
    Novus Biologicals C1orf94 Antibody
    Abcam antibodies for C1orf94
    Cloud-Clone Corp. Antibodies for C1orf94 
    ThermoFisher Antibodies for C1orf94
    LSBio Antibodies in human, mouse, rat for C1orf94 

    Assay Products for C1orf94: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for C1orf94
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for C1orf94
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for C1orf94 
    Cloud-Clone Corp. CLIAs for C1orf94


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    ProtoNet protein and cluster: Q6P1W5


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

         Gene Ontology (GO): 1 molecular function term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005515protein binding IPI16713569
         
    C1orf94 for ontologies           About GeneDecksing


    Phenotypes:
         2 GenomeRNAi human phenotypes for C1orf94:
     Decreased number of cells in m  Increased G2M DNA content 

    Animal Models:
       inGenious Targeting Laboratory - Custom generated mouse model solutions for C1orf94 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for C1orf94

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for C1orf94 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for C1orf94 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat C1orf94
    8/10 QIAGEN miScript miRNA Assays for microRNAs that regulate C1orf94 (see all 10):
    hsa-miR-3163 hsa-miR-200c* hsa-miR-487a hsa-miR-765 hsa-miR-431 hsa-miR-550a* hsa-miR-154* hsa-miR-1253
    SwitchGear 3'UTR luciferase reporter plasmidC1orf94 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for C1orf94
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat C1orf94

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for C1orf94
    Sirion Biotech Customized adenovirus for overexpression of C1orf94

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for C1orf94 (see all 10)
    OriGene ORF clones in mouse, rat for C1orf94
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): C1orf94 (NM_001134734)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for C1orf94
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat C1orf94
    Sirion Biotech Customized lentivirus for stable overexpression of C1orf94 
                         Customized lentivirus expression plasmids for stable overexpression of C1orf94 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for C1orf94
    Search LifeMap BioReagents cell lines for C1orf94
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for C1orf94


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section



    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for C1orf94

    5/14 Interacting proteins for C1orf94 (Q6P1W51, 2, 3) via UniProtKB, MINT, STRING, and/or I2D (see all 14)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    ATXN1P542531, 2, 3EBI-946029,EBI-930964 MINT-2855229 MINT-2877750 I2D: score=3 
    UBQLN4Q9NRR52, 3MINT-2877731 I2D: score=3 
    C6orf165Q8IYR03I2D: score=1 
    ENSG00000272514Q8IYR03I2D: score=1 
    MAPK1IP1LQ8NDC03I2D: score=4 
    About this table

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for C1orf94 (CA094)

    Search CenterWatch for drugs/clinical trials and news about C1orf94 / CA094

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for C1orf94 gene (2 alternative transcripts): 
    NM_001134734.1  NM_032884.3  

    Unigene Cluster for C1orf94:

    Chromosome 1 open reading frame 94
    Hs.194610  [show with all ESTs]
    Unigene Representative Sequence: NM_001134734
    2 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000373374(uc001bxs.4) ENST00000488417(uc001bxt.3)
    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat C1orf94
    8/10 QIAGEN miScript miRNA Assays for microRNAs that regulate C1orf94 (see all 10):
    hsa-miR-3163 hsa-miR-200c* hsa-miR-487a hsa-miR-765 hsa-miR-431 hsa-miR-550a* hsa-miR-154* hsa-miR-1253
    SwitchGear 3'UTR luciferase reporter plasmidC1orf94 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for C1orf94
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat C1orf94
    Clone
    Products:
         
    OriGene clones in human, mouse for C1orf94 (see all 10)
    OriGene ORF clones in mouse, rat for C1orf94
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): C1orf94 (NM_001134734)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for C1orf94
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat C1orf94
    Sirion Biotech Customized lentivirus for stable overexpression of C1orf94 
                         Customized lentivirus expression plasmids for stable overexpression of C1orf94 
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for C1orf94
    OriGene qSTAR qPCR primer pairs in human, mouse for C1orf94
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat C1orf94
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat C1orf94
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat C1orf94

    Additional mRNA sequence: 

    AK123355.1 BC007637.1 BC064845.1 

    2 DOTS entries:

    DT.100738170  DT.307696 

    21 AceView cDNA sequences:

    AA725646 AW117410 AI798078 BC007637 CD558080 NM_032884 BC064845 AA758238 
    BE300123 CD359022 BX097703 AA994338 AK123355 BF979270 AA953860 BE296587 
    AW241777 BI831186 AA907373 BF979801 AA913614 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    C1orf94 expression in normal human tissues (normalized intensities)      C1orf94 embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: AGTGATTTTT
    C1orf94 Expression
    About this image


    C1orf94 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/2 selected tissues (see all 2) fully expand
     
     Inner Cell Mass (Early Embryonic Tissues)    fully expand to see all 2 entries
             Line H9 (WA09)
             ESI-051   
     
     Testis (Reproductive System)
             sperm   

    See C1orf94 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for C1orf94

    SOURCE GeneReport for Unigene cluster: Hs.194610
        SABiosciences Custom PCR Arrays for C1orf94
    Primer
    Products:
    OriGene qPCR primer pairs and template standards for C1orf94
    OriGene qSTAR qPCR primer pairs in human, mouse for C1orf94
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat C1orf94
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat C1orf94
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat C1orf94
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for C1orf94

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of chordates.

    Orthologs for C1orf94 gene from 3/8 species (see all 8)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia CK1379561 , 5 cDNA sequence CK1379561, 5 80.33(n)1
    73.02(a)1
      4 (61.65 cM)5
    6351691  NM_001134733.11  NP_001128205.11 
     1279275925 
    chicken
    (Gallus gallus)
    Aves C23H1orf941 chromosome 23 open reading frame, human C1orf94 60.87(n)
    48.67(a)
      419639  XM_417787.3  XP_417787.3 
    lizard
    (Anolis carolinensis)
    Reptilia C1ORF946
    Uncharacterized protein
    38(a)
    1 ↔ 1
    GL343589.1(336532-342186)


    ENSEMBL Gene Tree for C1orf94 (if available)
    TreeFam Gene Tree for C1orf94 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
      --

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/1142 SNPs in C1orf94 are shown (see all 1142)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 1 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs61431881,2
    C--32751861(+) gagag-/AGAGAGAGAGAGAGAG/
    AGAGAGAGAGAGAGAGTGAG
    CAAAT
    1 -- int1 trp31NA 2
    rs587941321,2
    C--32789695(+) TGTGT-/GTGTGT/
    GTGTGTGTGT
    CTTAC
    4 -- int1 cds11NA 2
    rs1401290521,2
    --34633455(+) ATTTGC/GTCTGG 1 -- int10--------
    rs1178653631,2
    F--34633564(+) ATGAAT/CATACA 1 -- int11Minor allele frequency- C:0.01EA 120
    rs1832997631,2
    --34633829(+) AGCCAC/TGATCA 1 -- int10--------
    rs1420975801,2
    C--34634011(+) GAGGAA/GGATGG 1 -- int10--------
    rs795579001,2
    C,F--34634037(+) AGCAAT/AGGGAG 1 -- int11Minor allele frequency- A:0.02NA 120
    rs121218381,2
    C--34634086(+) ATGGCA/GAGGAG 1 -- int10--------
    rs1930065131,2
    --34634133(+) TGTATC/TAATTT 1 -- int10--------
    rs1459734411,2
    C--34634147(+) AGGACC/TGCTGC 1 -- int10--------

    HapMap Linkage Disequilibrium report for C1orf94 (34632484 - 34684732 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 5 variations for C1orf94:    About this table     
    Variant IDTypeSubtypePubMed ID
    esv270278CNV Insertion20981092
    nsv834657CNV Gain17160897
    nsv834646CNV Gain17160897
    nsv470709CNV Gain18288195
    nsv834669CNV Gain17160897

    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing C1orf94
    DNA2.0 Custom Variant and Variant Library Synthesis for C1orf94

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    C1orf94 for disorders           About MalaCards

    C1orf94 for disorders           About GeneDecksing

    Genetic Association Database (GAD): C1orf94

    Export disorders for C1orf94 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for C1orf94 gene, integrated from 9 sources (see all 15):
    (articles sorted by number of sources associating them with C1orf94)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    2. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1, 3 Strausberg R.L....Marra M.A. (2002)
    3. Genome-wide association analysis of genetic generalize d epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32 . (PubMed id 22949513)1  ....Sander T. (2012)
    4. Protein interactions of the transcription factor Hoxa1 . (PubMed id 23088713)1 Lambert B....Rezsohazy R. (2012)
    5. Chromosome 6p22 locus associated with clinically aggressive neuroblastoma. (PubMed id 18463370)4 Maris J.M....Hakonarson H. (2008)
    6. A genome-wide association study for blood lipid phenotypes in the Framingham Heart Study. (PubMed id 17903299)4 Kathiresan S....Cupples L.A. (2007)
    7. Genome-wide association to body mass index and waist circumference: the Framingham Heart Study 100K project. (PubMed id 17903300)4 Fox C.S....Atwood L.D. (2007)
    8. hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. (PubMed id 17207965)1 Lamesch P.... Vidal M. (2007)
    9. Genome-wide association of echocardiographic dimensions, brachial artery endothelial function and treadmill exercise responses in the Framingham Heart Study. (PubMed id 17903301)4 Vasan R.S....Benjamin E.J. (2007)
    10. A germline-specific class of small RNAs binds mammali an Piwi proteins. (PubMed id 16751776)1 Girard A....Carmell M.A. (2006)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 84970 HGNC: 28250 AceView: MGC15882 Ensembl:ENSG00000142698 euGenes: HUgn84970
    ECgene: C1orf94 H-InvDB: C1orf94

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for C1orf94 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for C1orf94 gene:
    Search GeneIP for patents involving C1orf94

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for C1orf94  
     OriGene qPCR primer pairs and template standards for C1orf94   OriGene Protein Over-expression Lysate for C1orf94  
     OriGene MassSpec something-or-other for C1orf94   OriGene clones in human, mouse for C1orf94  
     OriGene qSTAR qPCR primer pairs in human, mouse for C1orf94   OriGene Purified Protein for C1orf94  
     OriGene ORF clones in mouse, rat for C1orf94   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for C1orf94   OriGene Custom Protein Services for C1orf94  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat C1orf94
     QIAGEN SeqTarget long-range PCR primers for resequencing C1orf94
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat C1orf94
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat C1orf94
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat C1orf94
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat C1orf94
     GenScript Custom Purified and Recombinant Proteins Services for C1orf94 GenScript cDNA clones with any tag delivered in your preferred vector for C1orf94
     GenScript Custom Assay Services for C1orf94 GenScript Custom Superior Antibodies Services for C1orf94
     GenScript Custom overexpressing Cell Line Services for C1orf94 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Search Regulatory tfbs for C1orf94
     Search Chromatin IP Primers for C1orf94
     RT2 qPCR Primer Assay in human, mouse, rat C1orf94
     Search GNC Networks for C1orf94
     SABiosciences Custom PCR Arrays for C1orf94
     Search Tocris compounds for C1orf94 (CA094)
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     C1orf94 antibodies
     C1orf94 lysates
     Antibodies for C1orf94
     See all of Abcam's Antibodies, Kits and Proteins for C1orf94
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Proteins for C1orf94
     Antibodies for C1orf94
     ELISAs for C1orf94
     CLIAs for C1orf94
     Search LifeMap BioReagents cell lines for C1orf94
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for C1orf94
     SwitchGear 3'UTR luciferase reporter plasmids for C1orf94
     Browse SwitchGear Promoter luciferase reporter plasmids for C1orf94
     ThermoFisher Antibodies for C1orf94
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat C1orf94
     inGenious Targeting Laboratory - Custom generated mouse model solutions for C1orf94
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for C1orf94
    Customized:
     lentivirus for stable overexpression of C1orf94
     lentivirus expression plasmids for stable overexpression of C1orf94
     adenovirus for overexpression of C1orf94
     LSBio Antibodies in human, mouse, rat for C1orf94
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      C1orf94 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4