Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



C1orf94 Gene

protein-coding   GIFtS: 44
GCID: GC01P034632

Chromosome 1 Open Reading Frame 94

  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Chromosome 1 Open Reading Frame 941 2
Uncharacterized Protein C1orf942

External Ids:    HGNC: 282501   Entrez Gene: 849702   Ensembl: ENSG000001426987   UniProtKB: Q6P1W53   

Export aliases for C1orf94 gene to outside databases

Previous GC identifers: GC01P034303 GC01P034405 GC01P032749


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

GeneCards Summary for C1orf94 Gene:
C1orf94 (chromosome 1 open reading frame 94) is a protein-coding gene. Diseases associated with C1orf94 include ataxia, and neuroblastoma.


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000001.11  NC_018912.2  NT_032977.10  
Regulatory elements:
   Search for regulatory transcription factor binding sites for C1orf94
         Other transcription factors

Browse SwitchGear Promoter luciferase reporter plasmids
   Search Chromatin IP Primers for C1orf94

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat C1orf94


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 1p34.3   Ensembl cytogenetic band:  1p34.3   HGNC cytogenetic band: 1p34.3

C1orf94 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
C1orf94 gene location

GeneLoc information about chromosome 1         GeneLoc Exon Structure

GeneLoc location for GC01P034632:  view genomic region     (about GC identifiers)

Start:
34,632,484 bp from pter      End:
34,684,732 bp from pter
Size:
52,249 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: CA094_HUMAN, Q6P1W5 (See protein sequence)
Recommended Name: Uncharacterized protein C1orf94  
Size: 598 amino acids; 65353 Da
Secondary accessions: B3KVT1 D3DPR3 E9PJ76 Q96IC8
Alternative splicing: 2 isoforms:  Q6P1W5-1   Q6P1W5-2   

Explore the universe of human proteins at neXtProt for C1orf94: NX_Q6P1W5

Explore proteomics data for C1orf94 at MOPED


See C1orf94 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

REFSEQ proteins (2 alternative transcripts): 
NP_001128206.1  NP_116273.2  

ENSEMBL proteins: 
 ENSP00000362472   ENSP00000435634  

C1orf94 Human Recombinant Protein Products:

Browse Purified and Recombinant Proteins at EMD Millipore
Browse R&D Systems for human recombinant proteins
Browse recombinant and purified proteins available from Enzo Life Sciences
OriGene Purified Protein for C1orf94
OriGene Protein Over-expression Lysate for C1orf94
OriGene MassSpec for C1orf94
OriGene Custom Protein Services for C1orf94
GenScript Custom Purified and Recombinant Proteins Services for C1orf94
Novus Biologicals C1orf94 Lysate
Browse Sino Biological Recombinant Proteins
Browse Sino Biological Cell Lysates
Browse ProSpec Recombinant Proteins
Cloud-Clone Corp. Proteins for C1orf94

C1orf94 Antibody Products:

Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
Browse R&D Systems for Antibodies
Browse OriGene Antibodies
OriGene Custom Antibody Services for C1orf94
Novus Biologicals C1orf94 Antibody
Abcam antibodies for C1orf94
Cloud-Clone Corp. Antibodies for C1orf94
ThermoFisher Antibodies for C1orf94
LSBio Antibodies in human, mouse, rat for C1orf94

C1orf94 Assay Products:

Browse Kits and Assays available from EMD Millipore
OriGene Custom Assay Services for C1orf94
Browse R&D Systems for biochemical assays
GenScript Custom Assay Services for C1orf94
Browse Enzo Life Sciences for kits & assays
Cloud-Clone Corp. ELISAs for C1orf94
Cloud-Clone Corp. CLIAs for C1orf94


(According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

TryGeneCards Plus

ProtoNet protein and cluster: Q6P1W5


(According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
About This Section

TryGeneCards Plus

     Gene Ontology (GO): 1 molecular function term:    About this table

GO IDQualified GO termEvidencePubMed IDs
GO:0005515protein binding IPI16713569
     
C1orf94 for ontologies           About GeneDecksing


Phenotypes:
     2 GenomeRNAi human phenotypes for C1orf94:
 Decreased number of cells in m  Increased G2M DNA content 

Animal Models:
   inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for C1orf94
   inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for C1orf94

   genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for C1orf94
   genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for C1orf94

miRNA
Products:
    
Block miRNA regulation of human, mouse, rat C1orf94 using miScript Target Protectors
Selected qRT-PCR Assays for microRNAs that regulate C1orf94 (see all 10):
hsa-miR-3163 hsa-miR-200c* hsa-miR-487a hsa-miR-765 hsa-miR-431 hsa-miR-550a* hsa-miR-154* hsa-miR-1253
SwitchGear 3'UTR luciferase reporter plasmidC1orf94 3' UTR sequence
Inhib. RNA
Products:
    
OriGene RNAi products in human, mouse, rat for C1orf94
Predesigned siRNA for gene silencing in human, mouse, rat C1orf94

Gene Editing
Products:
DNA2.0 Custom Protein Engineering Service for C1orf94

Clone
Products:
     
OriGene clones in human, mouse for C1orf94 (see all 12)
OriGene ORF clones in mouse, rat for C1orf94
OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript: all cDNA clones in your preferred vector (see all 2): C1orf94 (NM_001134734)
Browse Sino Biological Human cDNA Clones
DNA2.0 Custom Codon Optimized Gene Synthesis Service for C1orf94
Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat C1orf94

Cell Line
Products:
     
GenScript Custom overexpressing Cell Line Services for C1orf94
Browse ESI BIO Cell Lines and PureStem Progenitors for C1orf94 
In Situ Assay
Products:
   

 
Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for C1orf94


(According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
About This Section

TryGeneCards Plus

Subcellular locations from COMPARTMENTS: 

CompartmentConfidence
cytosol1
endoplasmic reticulum1
mitochondrion1
nucleus1

(SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
About This Section

TryGeneCards Plus



    Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for C1orf94
Interactions:

    Search GeneGlobe Interaction Network for C1orf94

Selected Interacting proteins for C1orf94 (Q6P1W51, 2, 3) via UniProtKB, MINT, STRING, and/or I2D (see all 13)
InteractantInteraction Details
GeneCardExternal ID(s)
ATXN1P542531, 2, 3EBI-946029,EBI-930964 MINT-2855229 MINT-2877750 I2D: score=3 
UBQLN4Q9NRR52, 3MINT-2877731 I2D: score=3 
MAPK1IP1LQ8NDC03I2D: score=4 
RBPMSQ930623I2D: score=4 
USO1O607633I2D: score=4 
About this table

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
About This Section

TryGeneCards Plus
Browse Small Molecules at EMD Millipore
   Browse drugs & compounds from Enzo Life Sciences
  Browse compounds at ApexBio 

Browse Tocris compounds for C1orf94 (CA094)



(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
About This Section

TryGeneCards Plus

REFSEQ mRNAs for C1orf94 gene (2 alternative transcripts): 
NM_001134734.1  NM_032884.4  

Unigene Cluster for C1orf94:

Chromosome 1 open reading frame 94
Hs.194610  [show with all ESTs]
Unigene Representative Sequence: NM_001134734
2 Ensembl transcripts including schematic representations, and UCSC links where relevant:
ENST00000373374(uc001bxs.4) ENST00000488417(uc001bxt.3)
miRNA
Products:
     
Block miRNA regulation of human, mouse, rat C1orf94 using miScript Target Protectors
Selected qRT-PCR Assays for microRNAs that regulate C1orf94 (see all 10):
hsa-miR-3163 hsa-miR-200c* hsa-miR-487a hsa-miR-765 hsa-miR-431 hsa-miR-550a* hsa-miR-154* hsa-miR-1253
SwitchGear 3'UTR luciferase reporter plasmidC1orf94 3' UTR sequence
Inhib. RNA
Products:
     
OriGene RNAi products in human, mouse, rat for C1orf94
Predesigned siRNA for gene silencing in human, mouse, rat C1orf94
Clone
Products:
     
OriGene clones in human, mouse for C1orf94 (see all 12)
OriGene ORF clones in mouse, rat for C1orf94
OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript: all cDNA clones in your preferred vector (see all 2): C1orf94 (NM_001134734)
DNA2.0 Custom Codon Optimized Gene Synthesis Service for C1orf94
Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat C1orf94
Primer
Products:
    
OriGene qPCR primer pairs and template standards for C1orf94
OriGene qSTAR qPCR primer pairs in human, mouse for C1orf94
Pre-validated RT2 qPCR Primer Assay in human, mouse, rat C1orf94
  QuantiTect SYBR Green Assays in human, mouse, rat C1orf94
  QuantiFast Probe-based Assays in human, mouse, rat C1orf94

Additional mRNA sequence: 

AK123355.1 BC007637.1 BC064845.1 

2 DOTS entries:

DT.100738170  DT.307696 

21 AceView cDNA sequences:

AA725646 AI798078 AW117410 BE300123 CD359022 BC007637 AA758238 AA994338 
BX097703 AK123355 BC064845 NM_032884 CD558080 AA953860 BE296587 BF979270 
AA907373 BI831186 AW241777 BF979801 AA913614 

GeneLoc Exon Structure


(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

TryGeneCards Plus

C1orf94 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS <intensity>2/3
CGAP TAG: AGTGATTTTT
C1orf94 Expression
About this image


C1orf94 expression in embryonic tissues and stem cells    About this table
Data from LifeMap, the Embryonic Development and Stem Cells Database
 selected tissues (see all 2) fully expand
 
 Inner Cell Mass (Early Embryonic Tissues)    fully expand to see all 2 entries
         Human embryonic stem cells (family)
 
 Testis (Reproductive System)
C1orf94 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

C1orf94 Protein Expression

SOURCE GeneReport for Unigene cluster: Hs.194610
    Custom PCR Arrays for C1orf94
Primer
Products:
OriGene qPCR primer pairs and template standards for C1orf94
OriGene qSTAR qPCR primer pairs in human, mouse for C1orf94
Pre-validated RT2 qPCR Primer Assay in human, mouse, rat C1orf94
QuantiTect SYBR Green Assays in human, mouse, rat C1orf94
QuantiFast Probe-based Assays in human, mouse, rat C1orf94
In Situ
Assay Products:
 

 
Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for C1orf94

(Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

TryGeneCards Plus

This gene was present in the common ancestor of chordates.

Orthologs for C1orf94 gene from Selected species (see all 9)    About this table
Organism Taxonomic
classification
Gene Description Human
Similarity
Orthology
Type
Details
mouse
(Mus musculus)
Mammalia CK1379561 , 5 cDNA sequence CK1379561, 5 80.33(n)1
73.02(a)1
  4 (61.65 cM)5
6351691  NM_001134733.11  NP_001128205.11 
 1279275925 
chicken
(Gallus gallus)
Aves C1ORF941 chromosome 23 open reading frame, human C1orf94 58.62(n)
45.14(a)
  419639  XM_417787.4  XP_417787.3 
lizard
(Anolis carolinensis)
Reptilia C1orf946
chromosome 1 open reading frame 94
39(a)
1 ↔ 1
GL343589.1(336532-342186)


ENSEMBL Gene Tree for C1orf94 (if available)
TreeFam Gene Tree for C1orf94 (if available)

(Paralogs according to 1HomoloGene,
2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
About This Section

TryGeneCards Plus
  --

(SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
About This Section

TryGeneCards Plus

Selected SNPs for C1orf94 (see all 1142)    About this table    
Genomic DataTranscription Related DataAllele Frequencies
SNP IDValidClinical
significance
Chr 1 posSequence#AA
Chg
TypeMore#Allele
freq
PopTotal
sample
More
----------
rs61431881,2
C--32751861(+) gagag-/AGAGAGAGAGAGAGAG/
AGAGAGAGAGAGAGAGTGAG
CAAAT
1 -- int1 trp31NA 2
rs587941321,2
C--32789695(+) TGTGT-/GTGTGT/
GTGTGTGTGT
CTTAC
4 -- int1 cds11NA 2
rs1401290521,2
--34633455(+) ATTTGC/GTCTGG 1 -- int10--------
rs1178653631,2
F--34633564(+) ATGAAT/CATACA 1 -- int11Minor allele frequency- C:0.01EA 120
rs1832997631,2
--34633829(+) AGCCAC/TGATCA 1 -- int10--------
rs1420975801,2
C--34634011(+) GAGGAA/GGATGG 1 -- int10--------
rs795579001,2
C,F--34634037(+) AGCAAT/AGGGAG 1 -- int11Minor allele frequency- A:0.02NA 120
rs121218381,2
C--34634086(+) ATGGCA/GAGGAG 1 -- int10--------
rs1930065131,2
--34634133(+) TGTATC/TAATTT 1 -- int10--------
rs1459734411,2
C--34634147(+) AGGACC/TGCTGC 1 -- int10--------

HapMap Linkage Disequilibrium report for C1orf94 (34632484 - 34684732 bp)

Structural Variations
     Database of Genomic Variants (DGV) 5 variations for C1orf94:    About this table    
Variant IDTypeSubtypePubMed ID
esv270278CNV Insertion20981092
nsv834657CNV Gain17160897
nsv834646CNV Gain17160897
nsv470709CNV Gain18288195
nsv834669CNV Gain17160897

Site Specific Mutation Identification with PCR Assays
SeqTarget long-range PCR primers for resequencing C1orf94
DNA2.0 Custom Variant and Variant Library Synthesis for C1orf94

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

TryGeneCards Plus
3 diseases for C1orf94:    
About MalaCards
ataxia    neuroblastoma    endotheliitis


C1orf94 for disorders           About GeneDecksing

Genetic Association Database (GAD): C1orf94

Export disorders for C1orf94 gene to outside databases

(in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
About This Section

TryGeneCards Plus

PubMed articles for C1orf94 gene, integrated from 10 sources (see all 16):
(articles sorted by number of sources associating them with C1orf94)
    Utopia: connect your pdf to the dynamic
world of online information

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (Nat. Genet. 2004)
  2. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1, 3 Strausberg R.L....Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002)
  3. Genome-wide association analysis of genetic generalized epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32. (PubMed id 22949513)1  ....Sander T. (Hum. Mol. Genet. 2012)
  4. Protein interactions of the transcription factor Hoxa1. (PubMed id 23088713)1 Lambert B....Rezsohazy R. (BMC Dev. Biol. 2012)
  5. Chromosome 6p22 locus associated with clinically aggressive neuroblastoma. (PubMed id 18463370)4 Maris J.M....Hakonarson H. (N. Engl. J. Med. 2008)
  6. A genome-wide association study for blood lipid phenotypes in the Framingham Heart Study. (PubMed id 17903299)4 Kathiresan S....Cupples L.A. (BMC Med. Genet. 2007)
  7. Genome-wide association to body mass index and waist circumference: the Framingham Heart Study 100K project. (PubMed id 17903300)4 Fox C.S....Atwood L.D. (BMC Med. Genet. 2007)
  8. hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. (PubMed id 17207965)1 Lamesch P.... Vidal M. (Genomics 2007)
  9. Genome-wide association of echocardiographic dimensions, brachial artery endothelial function and treadmill exercise responses in the Framingham Heart Study. (PubMed id 17903301)4 Vasan R.S....Benjamin E.J. (BMC Med. Genet. 2007)
  10. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PubMed id 16344560)1 Kimura K.... Sugano S. (Genome Res. 2006)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

TryGeneCards Plus
 ANDOR
Aliases
Free Text  

  Query String
PubMed
OMIM
NCBI Bookshelf
  (Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

TryGeneCards Plus
Entrez Gene: 84970 HGNC: 28250 AceView: MGC15882 Ensembl:ENSG00000142698 euGenes: HUgn84970
ECgene: C1orf94 H-InvDB: C1orf94

(According to HUGE)
About This Section

TryGeneCards Plus
  --

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
About This Section

TryGeneCards Plus
NameDescription
PharmGKB entry for C1orf94 Pharmacogenomics, SNPs, Pathways

(Patent information from GeneIP,
Licensable technologies from WIS Yeda, Salk, Tufts,
IP news from LifeMap Sciences, Inc.)
About This Section

TryGeneCards Plus
Patent Information for C1orf94 gene:
Search GeneIP for patents involving C1orf94

GeneCards and IP:
Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
About This Section

TryGeneCards Plus

 
 EMD Millipore genomic analysis products

  
 Browse Antibodies   Browse Cell Culture Products  
 Browse ELISAs   Browse Flow Cytometry Kits  
 Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
 Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
 Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
 Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
 Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
 Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
 Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
 Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for C1orf94  
 OriGene qPCR primer pairs and template standards for C1orf94   OriGene Protein Over-expression Lysate for C1orf94  
 OriGene MassSpec something-or-other for C1orf94   OriGene clones in human, mouse for C1orf94  
 OriGene qSTAR qPCR primer pairs in human, mouse for C1orf94   OriGene Purified Protein for C1orf94  
 OriGene ORF clones in mouse, rat for C1orf94   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
 OriGene Custom Antibody Services for C1orf94   OriGene Custom Protein Services for C1orf94  

 
 
 Block miRNA regulation of human, mouse, rat C1orf94 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing C1orf94
 DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat C1orf94 Predesigned siRNA for gene silencing in human, mouse, rat C1orf94
 QuantiFast Probe-based Assays in human, mouse, rat C1orf94 QuantiTect SYBR Green Assays in human, mouse, rat C1orf94
 Custom PCR Arrays for C1orf94 Search Chromatin IP Primers for C1orf94
 Pre-validated RT2 qPCR Primer Assay in human, mouse, rat C1orf94  Search GeneGlobe Interaction Network for C1orf94
 Search Regulatory tfbs for C1orf94
 GenScript Custom Purified and Recombinant Proteins Services for C1orf94 GenScript cDNA clones with any tag delivered in your preferred vector for C1orf94
 GenScript Custom Assay Services for C1orf94 GenScript Custom overexpressing Cell Line Services for C1orf94
 CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
 Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
 Plasmid Preparation Custom Peptide Services
 Search for Antibodies & Assays

 Search Tocris compounds for C1orf94 (CA094)
 Browse Sino Biological Proteins
 Browse Sino Biological Cell Lysates
 Browse Sino Biological cDNA Clones
 4000+ Proteins
 Search Sino Biological for antibodies, proteins & pathways
 Protein Production Services
 Transfection Reagents
 Protein A/G/L resins
 Isotyping reagents
 Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

 Novus Tissue Slides
 C1orf94 antibodies
 C1orf94 lysates
 Antibodies for C1orf94
 See all of Abcam's Antibodies, Kits and Proteins for C1orf94
 Custom Antibody / Protein Production Service
 Bulk Purchasing
 Advantages of Rabbit Monoclonal antibodies
 Abcam protocols and scientific support
 Browse ProSpec Recombinant Proteins
 Proteins for C1orf94
 Antibodies for C1orf94
 ELISAs for C1orf94
 CLIAs for C1orf94



 Browse ESI BIO Cell Lines and PureStem Progenitors for C1orf94
 Gene Synthesis
 Protein Engineering
 Variant Library Synthesis
 Codon Optimization
 Protein Production and Purification
 Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for C1orf94
 SwitchGear 3'UTR luciferase reporter plasmids for C1orf94
 Browse SwitchGear Promoter luciferase reporter plasmids for C1orf94
 ThermoFisher Antibodies for C1orf94
 Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat C1orf94
 inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for C1orf94
 inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for C1orf94
 LSBio Antibodies in human, mouse, rat for C1orf94
Customized transgenic rodents for:
 Humanization
 Biomarker expression
 Off-target effect monitoring
 Translational medicine
 Tissue-specific gene expresssion
 Time-controlled gene expresssion
 Browse compounds at ApexBio
       
GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

View Random Gene

Category
(GIFtS: )
GIFtS Group
The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes      Disease genes      C1orf94 gene at Home site.
Version: 3.12.142 28 July 2014
hostname: 356980-web2.xennexinc.com index build: 126 solr: 1.4