Free for academic non-profit institutions. Other users need a Commercial license

Aliases for C1QTNF4 Gene

Aliases for C1QTNF4 Gene

  • C1q And Tumor Necrosis Factor Related Protein 4 2 3 5
  • Complement-C1q Tumor Necrosis Factor-Related Protein 4 2 3
  • CTRP4 3 4
  • Complement C1q Tumor Necrosis Factor-Related Protein 4 3
  • ZACRP4 3

External Ids for C1QTNF4 Gene

Previous GeneCards Identifiers for C1QTNF4 Gene

  • GC11M049522
  • GC11M048488
  • GC11M047643
  • GC11M047575
  • GC11M047567
  • GC11M047611
  • GC11M047312
  • GC11M047838
  • GC11M047957
  • GC11M050805

Summaries for C1QTNF4 Gene

GeneCards Summary for C1QTNF4 Gene

C1QTNF4 (C1q And Tumor Necrosis Factor Related Protein 4) is a Protein Coding gene. GO annotations related to this gene include cytokine activity. An important paralog of this gene is C1QTNF8.

UniProtKB/Swiss-Prot for C1QTNF4 Gene

  • May act as a pro-inflammatory cytokine, that induces the activation of NF-kappa-B signaling pathway and up-regulates IL6 production.

No data available for Entrez Gene Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for C1QTNF4 Gene

Genomics for C1QTNF4 Gene

Regulatory Elements for C1QTNF4 Gene

Enhancers for C1QTNF4 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
- Elite enhancer/Elite enhancer-gene association

Enhancers around C1QTNF4 on UCSC Golden Path with GeneCards custom track

Genomic Location for C1QTNF4 Gene

47,589,664 bp from pter
47,594,659 bp from pter
4,996 bases
Minus strand

Genomic View for C1QTNF4 Gene

Genes around C1QTNF4 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
C1QTNF4 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for C1QTNF4 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for C1QTNF4 Gene

Proteins for C1QTNF4 Gene

  • Protein details for C1QTNF4 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Complement C1q tumor necrosis factor-related protein 4
    Protein Accession:
    Secondary Accessions:
    • Q8IV25

    Protein attributes for C1QTNF4 Gene

    329 amino acids
    Molecular mass:
    35256 Da
    Quaternary structure:
    No Data Available

neXtProt entry for C1QTNF4 Gene

Post-translational modifications for C1QTNF4 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for C1QTNF4 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • Abcam antibodies for CTRP4

No data available for DME Specific Peptides for C1QTNF4 Gene

Domains & Families for C1QTNF4 Gene

Protein Domains for C1QTNF4 Gene

Suggested Antigen Peptide Sequences for C1QTNF4 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Contains 2 C1q domains.
  • Contains 2 C1q domains.
genes like me logo Genes that share domains with C1QTNF4: view

No data available for Gene Families for C1QTNF4 Gene

Function for C1QTNF4 Gene

Molecular function for C1QTNF4 Gene

UniProtKB/Swiss-Prot Function:
May act as a pro-inflammatory cytokine, that induces the activation of NF-kappa-B signaling pathway and up-regulates IL6 production.
UniProtKB/Swiss-Prot Induction:
Up-regulated by IL6.

Gene Ontology (GO) - Molecular Function for C1QTNF4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005125 cytokine activity IEA --
genes like me logo Genes that share ontologies with C1QTNF4: view

Phenotypes for C1QTNF4 Gene

GenomeRNAi human phenotypes for C1QTNF4:
genes like me logo Genes that share phenotypes with C1QTNF4: view

Animal Model Products

  • Taconic Biosciences Mouse Models for C1QTNF4

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for C1QTNF4 Gene

Localization for C1QTNF4 Gene

Subcellular locations from UniProtKB/Swiss-Prot for C1QTNF4 Gene


Subcellular locations from

Jensen Localization Image for C1QTNF4 Gene COMPARTMENTS Subcellular localization image for C1QTNF4 gene
Compartment Confidence
extracellular 4
endoplasmic reticulum 1
mitochondrion 1

Gene Ontology (GO) - Cellular Components for C1QTNF4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005615 extracellular space IEA --
genes like me logo Genes that share ontologies with C1QTNF4: view

Pathways & Interactions for C1QTNF4 Gene

SuperPathways for C1QTNF4 Gene

No Data Available

Interacting Proteins for C1QTNF4 Gene

Selected Interacting proteins: Q9BXJ3-C1QT4_HUMAN for C1QTNF4 Gene via IID

Gene Ontology (GO) - Biological Process for C1QTNF4 Gene


No data available for Pathways by source and SIGNOR curated interactions for C1QTNF4 Gene

Drugs & Compounds for C1QTNF4 Gene

No Compound Related Data Available

Transcripts for C1QTNF4 Gene

mRNA/cDNA for C1QTNF4 Gene

Unigene Clusters for C1QTNF4 Gene

C1q and tumor necrosis factor related protein 4:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for C1QTNF4 Gene

No ASD Table

Relevant External Links for C1QTNF4 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for C1QTNF4 Gene

mRNA expression in normal human tissues for C1QTNF4 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for C1QTNF4 Gene

This gene is overexpressed in Brain - Nucleus accumbens (basal ganglia) (x7.4), Brain - Putamen (basal ganglia) (x6.7), and Brain - Caudate (basal ganglia) (x5.6).

Protein differential expression in normal tissues from HIPED for C1QTNF4 Gene

This gene is overexpressed in Serum (63.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for C1QTNF4 Gene

Protein tissue co-expression partners for C1QTNF4 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of C1QTNF4 Gene:


SOURCE GeneReport for Unigene cluster for C1QTNF4 Gene:


mRNA Expression by UniProt/SwissProt for C1QTNF4 Gene:

Tissue specificity: Widely expressed at low levels.
genes like me logo Genes that share expression patterns with C1QTNF4: view

Primer Products

Orthologs for C1QTNF4 Gene

This gene was present in the common ancestor of chordates.

Orthologs for C1QTNF4 Gene

Organism Taxonomy Gene Similarity Type Details
(Canis familiaris)
Mammalia C1QTNF4 34
  • 92.99 (n)
  • 94.59 (a)
C1QTNF4 35
  • 69 (a)
(Mus musculus)
Mammalia C1qtnf4 34
  • 90.52 (n)
  • 94.89 (a)
C1qtnf4 16
C1qtnf4 35
  • 95 (a)
(Pan troglodytes)
Mammalia C1QTNF4 34
  • 99.19 (n)
  • 99.09 (a)
C1QTNF4 35
  • 99 (a)
(Rattus norvegicus)
Mammalia C1qtnf4 34
  • 87.65 (n)
  • 91.05 (a)
(Bos Taurus)
Mammalia MGC137014 35
  • 24 (a)
(Monodelphis domestica)
Mammalia -- 35
  • 23 (a)
(Ornithorhynchus anatinus)
Mammalia C1QTNF4 35
  • 72 (a)
(Gallus gallus)
Aves C1QTNF4 34
  • 64.56 (n)
  • 64.33 (a)
C1QTNF4 35
  • 53 (a)
(Anolis carolinensis)
Reptilia C1QTNF4 35
  • 63 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia c1qtnf4 34
  • 64.02 (n)
  • 62.76 (a)
African clawed frog
(Xenopus laevis)
Amphibia Xl.26293 34
(Danio rerio)
Actinopterygii c1qtnf4 34
  • 66.15 (n)
  • 65 (a)
wufi33h02 34
c1qtnf4 35
  • 49 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 37 (a)
Species where no ortholog for C1QTNF4 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for C1QTNF4 Gene

Gene Tree for C1QTNF4 (if available)
Gene Tree for C1QTNF4 (if available)

Paralogs for C1QTNF4 Gene Pseudogenes for C1QTNF4 Gene

genes like me logo Genes that share paralogs with C1QTNF4: view

Variants for C1QTNF4 Gene

Sequence variations from dbSNP and Humsavar for C1QTNF4 Gene

SNP ID Clin Chr 11 pos Sequence Context AA Info Type
rs1568164 -- 47,592,972(+) TGTCC(C/T)TTGGT intron-variant
rs34021205 -- 47,593,282(+) CTTTT(-/T)GCAAA intron-variant
rs34749200 -- 47,595,200(+) GCTTC(A/G)AGCCC upstream-variant-2KB
rs10769279 -- 47,589,764(+) GCCTC(C/G)GGCCC utr-variant-3-prime
rs35315235 -- 47,594,913(+) GGAGT(-/CTGCAGGCATCAGAGGGGCAGC)CTGCG upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for C1QTNF4 Gene

Variant ID Type Subtype PubMed ID
esv3579504 CNV loss 25503493
nsv509405 CNV insertion 20534489
nsv825872 CNV gain 20364138
nsv825873 CNV gain 20364138
nsv832142 CNV loss 17160897

Variation tolerance for C1QTNF4 Gene

Gene Damage Index Score: 2.62; 45.34% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for C1QTNF4 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for C1QTNF4 Gene

Disorders for C1QTNF4 Gene

Relevant External Links for C1QTNF4

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for C1QTNF4 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for C1QTNF4 Gene

Publications for C1QTNF4 Gene

  1. Identification of C1qTNF-related protein 4 as a potential cytokine that stimulates the STAT3 and NF-kappaB pathways and promotes cell survival in human cancer cells. (PMID: 21658842) Li Q. … Wang L. (Cancer Lett. 2011) 3 4 65
  2. Quantitative phosphoproteome analysis using a dendrimer conjugation chemistry and tandem mass spectrometry. (PMID: 16094384) Tao W.A. … Aebersold R. (Nat. Methods 2005) 2 3 65
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 65
  4. C1q/TNF-related protein 4 (CTRP4) is a unique secreted protein with two tandem C1q domains that functions in the hypothalamus to modulate food intake and body weight. (PMID: 24366864) Byerly M.S. … Wong G.W. (J. Biol. Chem. 2014) 3 65
  5. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg R.L. … Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002) 3 65

Products for C1QTNF4 Gene

Sources for C1QTNF4 Gene
