Free for academic non-profit institutions. Other users need a Commercial license

Aliases for C1QTNF1 Gene

Aliases for C1QTNF1 Gene

  • C1q And Tumor Necrosis Factor Related Protein 1 2 3 5
  • G Protein Coupled Receptor Interacting Protein 2 3
  • G Protein-Coupled Receptor-Interacting Protein 3 4
  • CTRP1 3 4
  • GIP 3 4
  • ZSIG37 3

External Ids for C1QTNF1 Gene

Previous GeneCards Identifiers for C1QTNF1 Gene

  • GC17U990301
  • GC17M080159
  • GC17P077481
  • GC17P077627
  • GC17P077617
  • GC17P074531
  • GC17P077020
  • GC17P072443

Summaries for C1QTNF1 Gene

GeneCards Summary for C1QTNF1 Gene

C1QTNF1 (C1q And Tumor Necrosis Factor Related Protein 1) is a Protein Coding gene. Among its related pathways are Signaling by GPCR and Transport to the Golgi and subsequent modification. GO annotations related to this gene include collagen binding. An important paralog of this gene is COL8A1.

Gene Wiki entry for C1QTNF1 Gene

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for C1QTNF1 Gene

Genomics for C1QTNF1 Gene

Regulatory Elements for C1QTNF1 Gene

Promoters for C1QTNF1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around C1QTNF1 on UCSC Golden Path with GeneCards custom track

Transcription factor binding sites by QIAGEN in the C1QTNF1 gene promoter:

Genomic Location for C1QTNF1 Gene

Chromosome:
17
Start:
79,022,814 bp from pter
End:
79,049,788 bp from pter
Size:
26,975 bases
Orientation:
Plus strand

Genomic View for C1QTNF1 Gene

Genes around C1QTNF1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
C1QTNF1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for C1QTNF1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for C1QTNF1 Gene

Proteins for C1QTNF1 Gene

  • Protein details for C1QTNF1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9BXJ1-C1QT1_HUMAN
    Recommended name:
    Complement C1q tumor necrosis factor-related protein 1
    Protein Accession:
    Q9BXJ1
    Secondary Accessions:
    • Q6ZMH6
    • Q96NF2
    • Q9GZR4

    Protein attributes for C1QTNF1 Gene

    Size:
    281 amino acids
    Molecular mass:
    31743 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=AAG44303.1; Type=Erroneous initiation; Evidence={ECO:0000305}; Sequence=CAC20425.1; Type=Erroneous initiation; Evidence={ECO:0000305};

    Alternative splice isoforms for C1QTNF1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for C1QTNF1 Gene

Proteomics data for C1QTNF1 Gene at MOPED

Post-translational modifications for C1QTNF1 Gene

  • Glycosylation at Asn 93
  • Modification sites at PhosphoSitePlus

Antibody Products

No data available for DME Specific Peptides for C1QTNF1 Gene

Domains & Families for C1QTNF1 Gene

Suggested Antigen Peptide Sequences for C1QTNF1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q9BXJ1

UniProtKB/Swiss-Prot:

C1QT1_HUMAN :
  • Contains 1 C1q domain.
Domain:
  • Contains 1 C1q domain.
  • Contains 1 collagen-like domain.
genes like me logo Genes that share domains with C1QTNF1: view

No data available for Gene Families for C1QTNF1 Gene

Function for C1QTNF1 Gene

genes like me logo Genes that share phenotypes with C1QTNF1: view

Animal Model Products

  • Taconic Biosciences Mouse Models for C1QTNF1

CRISPR Products

miRNA for C1QTNF1 Gene

miRTarBase miRNAs that target C1QTNF1

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for C1QTNF1 Gene

Localization for C1QTNF1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for C1QTNF1 Gene

Secreted.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for C1QTNF1 Gene COMPARTMENTS Subcellular localization image for C1QTNF1 gene
Compartment Confidence
extracellular 5
plasma membrane 5
cytosol 4
lysosome 1
vacuole 1

Gene Ontology (GO) - Cellular Components for C1QTNF1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region IEA --
GO:0005887 integral component of plasma membrane IDA 12409230
genes like me logo Genes that share ontologies with C1QTNF1: view

Pathways & Interactions for C1QTNF1 Gene

genes like me logo Genes that share pathways with C1QTNF1: view

Pathways by source for C1QTNF1 Gene

Gene Ontology (GO) - Biological Process for C1QTNF1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0010544 negative regulation of platelet activation IDA 16195328
GO:0010906 regulation of glucose metabolic process IEA --
GO:0051260 protein homooligomerization IEA --
GO:0051897 positive regulation of protein kinase B signaling IEA --
GO:0070208 protein heterotrimerization IEA --
genes like me logo Genes that share ontologies with C1QTNF1: view

No data available for SIGNOR curated interactions for C1QTNF1 Gene

Drugs & Compounds for C1QTNF1 Gene

No Compound Related Data Available

Transcripts for C1QTNF1 Gene

Unigene Clusters for C1QTNF1 Gene

C1q and tumor necrosis factor related protein 1:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for C1QTNF1 Gene

ExUns: 1 ^ 2a · 2b · 2c ^ 3a · 3b ^ 4a · 4b ^ 5 ^ 6a · 6b · 6c ^ 7 ^ 8 ^ 9a · 9b · 9c · 9d · 9e · 9f · 9g
SP1: - - -
SP2: - - - - - - - - - -
SP3: - -
SP4: - - - - - - -
SP5: - - - - -
SP6: -
SP7: - - - -
SP8: - - - - - - - - -
SP9: - - - - - - -
SP10:

Relevant External Links for C1QTNF1 Gene

GeneLoc Exon Structure for
C1QTNF1
ECgene alternative splicing isoforms for
C1QTNF1

Expression for C1QTNF1 Gene

mRNA expression in normal human tissues for C1QTNF1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for C1QTNF1 Gene

This gene is overexpressed in Artery - Coronary (x6.2), Artery - Tibial (x5.5), Heart - Atrial Appendage (x4.7), and Artery - Aorta (x4.0).

Protein differential expression in normal tissues from HIPED for C1QTNF1 Gene

This gene is overexpressed in Milk (57.1) and Placenta (11.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for C1QTNF1 Gene



SOURCE GeneReport for Unigene cluster for C1QTNF1 Gene Hs.201398

genes like me logo Genes that share expression patterns with C1QTNF1: view

Protein tissue co-expression partners for C1QTNF1 Gene

Primer Products

In Situ Assay Products

No data available for mRNA Expression by UniProt/SwissProt for C1QTNF1 Gene

Orthologs for C1QTNF1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for C1QTNF1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia C1QTNF1 35
  • 90.74 (n)
  • 88.15 (a)
C1QTNF1 36
  • 94 (a)
OneToOne
cow
(Bos Taurus)
Mammalia C1QTNF1 36
  • 85 (a)
OneToOne
C1QTNF1 35
  • 86.26 (n)
  • 85.3 (a)
dog
(Canis familiaris)
Mammalia C1QTNF1 35
  • 86.81 (n)
  • 85.22 (a)
C1QTNF1 36
  • 89 (a)
OneToOne
mouse
(Mus musculus)
Mammalia C1qtnf1 16
C1qtnf1 35
  • 81.97 (n)
  • 77.58 (a)
C1qtnf1 36
  • 78 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia C1QTNF1 36
  • 68 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia C1QTNF1 36
  • 81 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia C1qtnf1 35
  • 82.8 (n)
  • 79 (a)
chicken
(Gallus gallus)
Aves C1QTNF1 35
  • 77.17 (n)
  • 75.63 (a)
-- 36
  • 54 (a)
ManyToMany
lizard
(Anolis carolinensis)
Reptilia C1QTNF1 36
  • 65 (a)
OneToOne
zebrafish
(Danio rerio)
Actinopterygii c1qtnf1 36
  • 61 (a)
OneToMany
c1qtnf1 36
  • 61 (a)
OneToMany
LOC100538079 35
  • 71.77 (n)
  • 74.64 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 36
  • 15 (a)
OneToMany
Species with no ortholog for C1QTNF1:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for C1QTNF1 Gene

ENSEMBL:
Gene Tree for C1QTNF1 (if available)
TreeFam:
Gene Tree for C1QTNF1 (if available)

Paralogs for C1QTNF1 Gene

(4) SIMAP similar genes for C1QTNF1 Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with C1QTNF1: view

Variants for C1QTNF1 Gene

Sequence variations from dbSNP and Humsavar for C1QTNF1 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
rs35035542 - 79,047,964(+) GCTGC(A/C/G)AGAGC nc-transcript-variant, reference, missense
rs3833103 -- 79,048,136(-) TCAGC(-/CTGGTGCTGAGCCCTGGGGTCAGC/CTGGTGCTGAGCCCTGGTGTCAGC/CTTGTGCTGAGCCCTGGGGTCAGC)ACAGC nc-transcript-variant, utr-variant-3-prime
rs7213410 -- 79,034,495(+) GGGCC(C/T)GGGCA intron-variant, utr-variant-5-prime
rs7211410 -- 79,048,466(+) AGTAA(A/C)CCGTG nc-transcript-variant, utr-variant-3-prime
rs7342916 -- 79,050,045(+) GGACT(C/T)GTGAG downstream-variant-500B

Structural Variations from Database of Genomic Variants (DGV) for C1QTNF1 Gene

Variant ID Type Subtype PubMed ID
nsv908900 CNV Loss 21882294
dgv3284n71 CNV Loss 21882294
nsv523650 CNV Loss 19592680
nsv908903 CNV Loss 21882294
nsv470610 CNV Loss 18288195
nsv908905 CNV Gain 21882294
dgv3285n71 CNV Loss 21882294
nsv521186 CNV Loss 19592680
nsv470611 CNV Gain 18288195
nsv833556 CNV Loss 17160897
nsv2156 CNV Loss 18451855

Variation tolerance for C1QTNF1 Gene

Residual Variation Intolerance Score: 40.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.03; 21.20% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for C1QTNF1 Gene

HapMap Linkage Disequilibrium report
C1QTNF1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for C1QTNF1 Gene

Disorders for C1QTNF1 Gene

Relevant External Links for C1QTNF1

Genetic Association Database (GAD)
C1QTNF1
Human Genome Epidemiology (HuGE) Navigator
C1QTNF1
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
C1QTNF1

No disorders were found for C1QTNF1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for C1QTNF1 Gene

Publications for C1QTNF1 Gene

  1. Association between the SERPING1 gene and age-related macular degeneration: a two-stage case-control study. (PMID: 18842294) Ennis S. … Lotery A. (Lancet 2008) 3 48 67
  2. GIP, a G-protein-coupled receptor interacting protein. (PMID: 12409230) Innamorati G. … Birnbaumer M. (Regul. Pept. 2002) 2 3
  3. Plasma levels of C1q/TNF-related protein 1 and interleukin 6 in patients with acute coronary syndrome or stable angina pectoris. (PMID: 25635749) Tang J.N. … Zhang J.Y. (Am. J. Med. Sci. 2015) 3
  4. A proteome-scale map of the human interactome network. (PMID: 25416956) Rolland T. … Vidal M. (Cell 2014) 3
  5. Elevated circulating levels of CTRP1, a novel adipokine, in diabetic patients. (PMID: 24965225) Xin Y. … Zhang D. (Endocr. J. 2014) 3

Products for C1QTNF1 Gene

Sources for C1QTNF1 Gene

Back to Top

Content