Free for academic non-profit institutions. Other users need a Commercial license

Aliases for C16orf95 Gene

Aliases for C16orf95 Gene

  • Chromosome 16 Open Reading Frame 95 2 3 5

External Ids for C16orf95 Gene

Previous GeneCards Identifiers for C16orf95 Gene

  • GC16M087340

Summaries for C16orf95 Gene

GeneCards Summary for C16orf95 Gene

C16orf95 (Chromosome 16 Open Reading Frame 95) is a Protein Coding gene. An important paralog of this gene is ENSG00000131152.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for C16orf95 Gene

Genomics for C16orf95 Gene

Regulatory Elements for C16orf95 Gene

Enhancers for C16orf95 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
- Elite enhancer/Elite enhancer-gene association

Enhancers around C16orf95 on UCSC Golden Path with GeneCards custom track

Promoters for C16orf95 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around C16orf95 on UCSC Golden Path with GeneCards custom track

Genomic Location for C16orf95 Gene

87,083,562 bp from pter
87,317,420 bp from pter
233,859 bases
Minus strand

Genomic View for C16orf95 Gene

Genes around C16orf95 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
C16orf95 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for C16orf95 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for C16orf95 Gene

Proteins for C16orf95 Gene

  • Protein details for C16orf95 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Uncharacterized protein C16orf95
    Protein Accession:

    Protein attributes for C16orf95 Gene

    158 amino acids
    Molecular mass:
    16793 Da
    Quaternary structure:
    No Data Available

neXtProt entry for C16orf95 Gene

Post-translational modifications for C16orf95 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for C16orf95 Gene

No data available for DME Specific Peptides for C16orf95 Gene

Domains & Families for C16orf95 Gene

Protein Domains for C16orf95 Gene


Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with C16orf95: view

No data available for Gene Families , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for C16orf95 Gene

Function for C16orf95 Gene

Animal Model Products

Clone Products

Flow Cytometry Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for C16orf95 Gene

Localization for C16orf95 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for C16orf95 Gene

Pathways & Interactions for C16orf95 Gene

SuperPathways for C16orf95 Gene

No Data Available

Interacting Proteins for C16orf95 Gene

Gene Ontology (GO) - Biological Process for C16orf95 Gene


No data available for Pathways by source and SIGNOR curated interactions for C16orf95 Gene

Drugs & Compounds for C16orf95 Gene

No Compound Related Data Available

Transcripts for C16orf95 Gene

mRNA/cDNA for C16orf95 Gene

(3) REFSEQ mRNAs :
(3) Additional mRNA sequences :
(7) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for C16orf95 Gene

Chromosome 16 open reading frame 95:
Representative Sequences:

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for C16orf95 Gene

No ASD Table

Relevant External Links for C16orf95 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for C16orf95 Gene

mRNA expression in normal human tissues for C16orf95 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for C16orf95 Gene

This gene is overexpressed in Testis (x27.4).

Protein differential expression in normal tissues from HIPED for C16orf95 Gene

This gene is overexpressed in Lung (40.7), Fetal heart (17.2), and Urinary Bladder (11.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for C16orf95 Gene

Protein tissue co-expression partners for C16orf95 Gene

NURSA nuclear receptor signaling pathways regulating expression of C16orf95 Gene:


SOURCE GeneReport for Unigene cluster for C16orf95 Gene:

genes like me logo Genes that share expression patterns with C16orf95: view

No data available for mRNA Expression by UniProt/SwissProt for C16orf95 Gene

Orthologs for C16orf95 Gene

This gene was present in the common ancestor of mammals.

Orthologs for C16orf95 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia LOC100140115 34
  • 77.03 (n)
  • 62.2 (a)
C16orf95 35
  • 48 (a)
(Canis familiaris)
Mammalia LOC609239 34
  • 78.13 (n)
  • 66.14 (a)
C16orf95 35
  • 53 (a)
(Mus musculus)
Mammalia 1700018B08Rik 34
  • 70.68 (n)
  • 58.65 (a)
1700018B08Rik 16
1700018B08Rik 35
  • 42 (a)
(Rattus norvegicus)
Mammalia LOC687560 34
  • 70.21 (n)
  • 55.32 (a)
Species where no ortholog for C16orf95 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • chimpanzee (Pan troglodytes)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for C16orf95 Gene

Gene Tree for C16orf95 (if available)
Gene Tree for C16orf95 (if available)

Paralogs for C16orf95 Gene

Paralogs for C16orf95 Gene

genes like me logo Genes that share paralogs with C16orf95: view

Variants for C16orf95 Gene

Sequence variations from dbSNP and Humsavar for C16orf95 Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
rs3214566 -- 87,305,511(+) CCCCA(-/CGAGGCCCCCACCGCCCCCA)GGCTG intron-variant
rs4448950 -- 87,304,291(+) GGTGT(A/G)GGCCA intron-variant
rs9925425 -- 87,312,341(+) aggca(G/T)gtgga intron-variant
rs4636919 -- 87,303,337(+) TGCTG(A/G)CTTTG intron-variant
rs9928813 -- 87,304,400(+) TGCCC(A/G)GCCTT intron-variant

Structural Variations from Database of Genomic Variants (DGV) for C16orf95 Gene

Variant ID Type Subtype PubMed ID
dgv552e214 CNV loss 21293372
esv3582428 CNV loss 25503493
esv3639509 CNV gain 21293372
esv3639510 CNV gain 21293372
nsv1062525 CNV gain 25217958
nsv510694 CNV deletion 20534489
nsv833320 CNV gain 17160897

Variation tolerance for C16orf95 Gene

Gene Damage Index Score: 7.56; 82.44% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for C16orf95 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for C16orf95 Gene

Disorders for C16orf95 Gene

Relevant External Links for C16orf95

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for C16orf95 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for C16orf95 Gene

Publications for C16orf95 Gene

  1. A human interactome in three quantitative dimensions organized by stoichiometries and abundances. (PMID: 26496610) Hein M.Y. … Mann M. (Cell 2015) 3 65
  2. Fine expression profiling of full-length transcripts using a size- unbiased cDNA library prepared with the vector-capping method. (PMID: 18487259) Oshikawa M. … Kato S. (DNA Res. 2008) 3 65
  3. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PMID: 16344560) Kimura K. … Sugano S. (Genome Res. 2006) 3 65
  4. The LIFEdb database in 2006. (PMID: 16381901) Mehrle A. … Wiemann S. (Nucleic Acids Res. 2006) 3 65
  5. From ORFeome to biology: a functional genomics pipeline. (PMID: 15489336) Wiemann S. … Poustka A. (Genome Res. 2004) 3 65

Products for C16orf95 Gene

Sources for C16orf95 Gene
