Free for academic non-profit institutions. Other users need a Commercial license

Aliases for C16orf82 Gene

Aliases for C16orf82 Gene

  • Chromosome 16 Open Reading Frame 82 2 3 5
  • Protein TNT 3
  • TNT 3

External Ids for C16orf82 Gene

Previous GeneCards Identifiers for C16orf82 Gene

  • GC16P026986
  • GC16P025167

Summaries for C16orf82 Gene

GeneCards Summary for C16orf82 Gene

C16orf82 (Chromosome 16 Open Reading Frame 82) is a Protein Coding gene.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for C16orf82 Gene

Genomics for C16orf82 Gene

Regulatory Elements for C16orf82 Gene

Enhancers for C16orf82 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH16F027371 1.6 FANTOM5 Ensembl ENCODE 3.2 +307.3 307294 4.4 HDGF PKNOX1 WRNIP1 ARID4B ZNF48 CBX5 ZNF143 FOS NFYC MIER2 IL21R C16orf82 IL4R PIR58561
GH16F027067 0.2 ENCODE 0.8 +0.7 688 0.2 C16orf82 LOC105371154
GH16F027081 0.2 ENCODE 0.4 +14.4 14408 0.2 BCOR SMARCA5 CTCF TEAD4 ZMYM3 ZEB2 RAD21 MCM7 HDAC2 ZNF512 LOC105371154 C16orf82
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around C16orf82 on UCSC Golden Path with GeneCards custom track

Genomic Location for C16orf82 Gene

27,066,707 bp from pter
27,069,166 bp from pter
2,460 bases
Plus strand

Genomic View for C16orf82 Gene

Genes around C16orf82 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
C16orf82 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for C16orf82 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for C16orf82 Gene

Proteins for C16orf82 Gene

  • Protein details for C16orf82 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein TNT
    Protein Accession:
    Secondary Accessions:
    • B9EGC2
    • Q8NEF0

    Protein attributes for C16orf82 Gene

    217 amino acids
    Molecular mass:
    23111 Da
    Quaternary structure:
    No Data Available

neXtProt entry for C16orf82 Gene

Post-translational modifications for C16orf82 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for C16orf82 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for C16orf82 Gene

Domains & Families for C16orf82 Gene

Protein Domains for C16orf82 Gene


Suggested Antigen Peptide Sequences for C16orf82 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with C16orf82: view

No data available for Gene Families and UniProtKB/Swiss-Prot for C16orf82 Gene

Function for C16orf82 Gene

Animal Model Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for C16orf82 Gene

Localization for C16orf82 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for C16orf82 Gene

Pathways & Interactions for C16orf82 Gene

SuperPathways for C16orf82 Gene

No Data Available

Interacting Proteins for C16orf82 Gene

Gene Ontology (GO) - Biological Process for C16orf82 Gene


No data available for Pathways by source and SIGNOR curated interactions for C16orf82 Gene

Transcripts for C16orf82 Gene

mRNA/cDNA for C16orf82 Gene

Unigene Clusters for C16orf82 Gene

Chromosome 16 open reading frame 82:
Representative Sequences:

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for C16orf82 Gene

No ASD Table

Relevant External Links for C16orf82 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for C16orf82 Gene

mRNA expression in normal human tissues for C16orf82 Gene

mRNA differential expression in normal tissues according to GTEx for C16orf82 Gene

This gene is overexpressed in Testis (x52.5).

NURSA nuclear receptor signaling pathways regulating expression of C16orf82 Gene:


SOURCE GeneReport for Unigene cluster for C16orf82 Gene:


mRNA Expression by UniProt/SwissProt for C16orf82 Gene:

Tissue specificity: Preferentially expressed in teratocarcinoma rather than in normal testis.
genes like me logo Genes that share expression patterns with C16orf82: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression and Protein tissue co-expression partners for C16orf82 Gene

Orthologs for C16orf82 Gene

This gene was present in the common ancestor of mammals.

Orthologs for C16orf82 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia C16H16orf82 34
  • 98.7 (n)
(Bos Taurus)
Mammalia C25H16orf82 34
  • 71.74 (n)
(Canis familiaris)
Mammalia C6H16orf82 34
  • 66.67 (n)
Species where no ortholog for C16orf82 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • mouse (Mus musculus)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for C16orf82 Gene

Gene Tree for C16orf82 (if available)
Gene Tree for C16orf82 (if available)

Paralogs for C16orf82 Gene

No data available for Paralogs for C16orf82 Gene

Variants for C16orf82 Gene

Sequence variations from dbSNP and Humsavar for C16orf82 Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
rs111543944 -- 27,067,679(+) CAAGA(C/T)GGGCG utr-variant-3-prime
rs112061367 -- 27,068,350(+) AACCA(C/T)GGTTG utr-variant-3-prime
rs112126375 -- 27,065,362(+) TGAGA(A/C)CAGCC upstream-variant-2KB
rs11268410 -- 27,065,061(+) AGGCA(-/AGCCGATGACCTGGGGTCAGG)AGTTC upstream-variant-2KB
rs112929399 -- 27,065,488(+) TCCAG(C/G)CTGGG upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for C16orf82 Gene

Variant ID Type Subtype PubMed ID
dgv499e214 CNV gain 21293372
dgv500e214 CNV loss 21293372
esv2678609 CNV deletion 23128226
esv3638313 CNV loss 21293372
esv3892820 CNV gain 25118596

Relevant External Links for C16orf82 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for C16orf82 Gene

Disorders for C16orf82 Gene

Relevant External Links for C16orf82

Genetic Association Database (GAD)
Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for C16orf82 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for C16orf82 Gene

Publications for C16orf82 Gene

  1. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
  2. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg R.L. … Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002) 2 3 64
  3. Parasites, proteomics and performance: effects of gregarine gut parasites on dragonfly flight muscle composition and function. (PMID: 18055619) Schilder R.J. … Marden J.H. (J. Exp. Biol. 2007) 22 64
  4. The sequence and analysis of duplication-rich human chromosome 16. (PMID: 15616553) Martin J. … Pennacchio L.A. (Nature 2004) 4 64

Products for C16orf82 Gene

Sources for C16orf82 Gene

Loading form....