Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



C16orf3 Gene

protein-coding   GIFtS: 37
GCID: GC16M090095

Chromosome 16 Open Reading Frame 3

  Try our

disease database 

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Chromosome 16 Open Reading Frame 31 2
Uncharacterized Protein C16orf32
EID15

External Ids:    HGNC: 11971   Entrez Gene: 7502   Ensembl: ENSG000002218197   OMIM: 6051795   UniProtKB: O951773   

Export aliases for C16orf3 gene to outside databases

Previous GC identifers: GC16M081415 GC16M091082 GC16M089796 GC16M089837 GC16M088622 GC16M075786


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

GeneCards Summary for C16orf3 Gene:
C16orf3 (chromosome 16 open reading frame 3) is a protein-coding gene.


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence at NCBI GenBank:
NC_000016.9  NC_018927.2  NT_010498.16  
Regulatory elements:
   Regulatory transcription factor binding sites in the C16orf3 gene promoter:
         NF-1/L   NF-1   Pax-5   HOXA3   AP-1   LCR-F1   GATA-1   c-Ets-1   GATA-2   Evi-1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidC16orf3 promoter sequence
   Search Chromatin IP Primers for C16orf3

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat C16orf3


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 16q24.3   Ensembl cytogenetic band:  16q24.3   HGNC cytogenetic band: 16q24.3

C16orf3 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
C16orf3 gene location

GeneLoc information about chromosome 16         GeneLoc Exon Structure

GeneLoc location for GC16M090095:  view genomic region     (about GC identifiers)

Start:
90,095,316 bp from pter      End:
90,096,309 bp from pter
Size:
994 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., eBioscience, and/or antibodies-online,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., eBioscience, and/or antibodies-online, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, Cloud-Clone Corp, antibodies-online, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: CP003_HUMAN, O95177 (See protein sequence)
Recommended Name: Uncharacterized protein C16orf3  
Size: 125 amino acids; 12619 Da
Secondary accessions: O95176 Q52LX9

Explore the universe of human proteins at neXtProt for C16orf3: NX_O95177

Explore proteomics data for C16orf3 at MOPED


See C16orf3 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

REFSEQ proteins: NP_001205.3  
ENSEMBL proteins: 
 ENSP00000386218  

C16orf3 Human Recombinant Protein Products:

Browse Purified and Recombinant Proteins at EMD Millipore
Browse R&D Systems for human recombinant proteins
Browse recombinant and purified proteins available from Enzo Life Sciences
OriGene Purified Protein for C16orf3
OriGene Protein Over-expression Lysate for C16orf3
OriGene MassSpec for C16orf3
OriGene Custom Protein Services for C16orf3
GenScript Custom Purified and Recombinant Proteins Services for C16orf3
Novus Biologicals C16orf3 Lysate
Browse Sino Biological Recombinant Proteins
Browse Sino Biological Cell Lysates
Browse ProSpec Recombinant Proteins
Cloud-Clone Corp. Proteins for C16orf3

 
Search eBioscience for Proteins for C16orf3 

 
antibodies-online proteins for C16orf3 

 
Search antibodies-online for peptides for C16orf3

C16orf3 Antibody Products:

Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
Browse R&D Systems for Antibodies
Browse OriGene Antibodies
OriGene Custom Antibody Services for C16orf3
Novus Biologicals C16orf3 Antibody
Abcam antibodies for C16orf3
Cloud-Clone Corp. Antibodies for C16orf3
Search ThermoFisher Antibodies for C16orf3
Search antibodies-online for antibodies for C16orf3 

C16orf3 Assay Products:

Browse Kits and Assays available from EMD Millipore
OriGene Custom Assay Services for C16orf3
Browse R&D Systems for biochemical assays
GenScript Custom Assay Services for C16orf3
Browse Enzo Life Sciences for kits & assays
Cloud-Clone Corp. ELISAs for C16orf3
Cloud-Clone Corp. CLIAs for C16orf3
Search eBioscience for ELISAs for C16orf3 
antibodies-online kits for C16orf3 (2 products) 


(According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

TryGeneCards Plus

ProtoNet protein and cluster: O95177


(According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, genOway,
transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
About This Section

TryGeneCards Plus

Molecular Function:
     Genatlas biochemistry entry for C16orf3:
chromosome 16 open reading frame 3,nested in the second intron of GAS11 gene, in opposite orientation

     Gene Ontology (GO): 1 molecular function term:    About this table

GO IDQualified GO termEvidencePubMed IDs
GO:0003674molecular_function ND--
     
Find genes that share ontologies with C16orf3           About GenesLikeMe


Animal Models:
   genOway: Develop your customized and physiologically relevant rodent model for C16orf3

miRNA
Products:
    
Block miRNA regulation of human, mouse, rat C16orf3 using miScript Target Protectors
Search for qRT-PCR Assays for microRNAs that regulate C16orf3
SwitchGear 3'UTR luciferase reporter plasmidC16orf3 3' UTR sequence
Inhib. RNA
Products:
    
OriGene RNAi products in human, mouse, rat for C16orf3
Predesigned siRNA for gene silencing in human, mouse, rat C16orf3

Gene Editing
Products:
DNA2.0 Custom Protein Engineering Service for C16orf3

Clone
Products:
     
OriGene clones in human, mouse for C16orf3 (see all 4)
OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript: all cDNA clones in your preferred vector: C16orf3 (NM_001214)
Browse Sino Biological Human cDNA Clones
DNA2.0 Custom Codon Optimized Gene Synthesis Service for C16orf3
Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat C16orf3

Cell Line
Products:
     
GenScript Custom overexpressing Cell Line Services for C16orf3
Browse ESI BIO Cell Lines and PureStem Progenitors for C16orf3 
In Situ Assay
Products:
   

 
Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for C16orf3


(According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
About This Section

TryGeneCards Plus

Subcellular locations from COMPARTMENTS: 

CompartmentConfidence
extracellular2
cytosol1
nucleus1
plasma membrane1

Gene Ontology (GO): 1 cellular component term:    About this table

GO IDQualified GO termEvidencePubMed IDs
GO:0005575cellular_component ND--

Find genes that share ontologies with C16orf3           About GenesLikeMe


(SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
About This Section

TryGeneCards Plus



    Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for C16orf3
Interactions:

    Search GeneGlobe Interaction Network for C16orf3

Gene Ontology (GO): 1 biological process term:    About this table

GO IDQualified GO termEvidencePubMed IDs
GO:0008150biological_process ND--

Find genes that share ontologies with C16orf3           About GenesLikeMe



(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
About This Section

TryGeneCards Plus
Browse Small Molecules at EMD Millipore
   Browse drugs & compounds from Enzo Life Sciences
  Browse compounds at ApexBio 

Browse Tocris compounds for C16orf3 (CP003)



(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
About This Section

TryGeneCards Plus

REFSEQ mRNAs for C16orf3 gene: 
NM_001214.3  

Unigene Cluster for C16orf3:

Chromosome 16 open reading frame 3
Hs.633032  [show with all ESTs]
Unigene Representative Sequence: AF050081
1 Ensembl transcript including schematic representation, and UCSC links where relevant:
ENST00000408886(uc002fqk.1)
miRNA
Products:
     
Block miRNA regulation of human, mouse, rat C16orf3 using miScript Target Protectors
Search for qRT-PCR Assays for microRNAs that regulate C16orf3
SwitchGear 3'UTR luciferase reporter plasmidC16orf3 3' UTR sequence
Inhib. RNA
Products:
     
OriGene RNAi products in human, mouse, rat for C16orf3
Predesigned siRNA for gene silencing in human, mouse, rat C16orf3
Clone
Products:
     
OriGene clones in human, mouse for C16orf3 (see all 4)
OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript: all cDNA clones in your preferred vector: C16orf3 (NM_001214)
DNA2.0 Custom Codon Optimized Gene Synthesis Service for C16orf3
Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat C16orf3
Primer
Products:
    
OriGene qSTAR qPCR primer pairs in human, mouse for C16orf3
Pre-validated RT2 qPCR Primer Assay in human, mouse / rat C16orf3
  QuantiTect SYBR Green Assays in human, mouse, rat C16orf3
  QuantiFast Probe-based Assays in human, mouse, rat C16orf3

Additional mRNA sequence: 

AF050080.1 AF050081.1 BC093751.1 BC104849.1 

1 DOTS entry:

DT.40108502 

5 AceView cDNA sequences:

AF050080 NM_001214 AF050081 T79834 T87378 

GeneLoc Exon Structure


(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

TryGeneCards Plus

C16orf3 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS <intensity>2/3
CGAP TAG: --
C16orf3 Expression
About this image

C16orf3 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

C16orf3 Protein Expression

SOURCE GeneReport for Unigene cluster: Hs.633032
    Custom PCR Arrays for C16orf3
Primer
Products:
OriGene qSTAR qPCR primer pairs in human, mouse for C16orf3
Pre-validated RT2 qPCR Primer Assay in human, mouse / rat C16orf3
QuantiTect SYBR Green Assays in human, mouse, rat C16orf3
QuantiFast Probe-based Assays in human, mouse, rat C16orf3
In Situ
Assay Products:
 

 
Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for C16orf3

(Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

TryGeneCards Plus

This gene was present in the common ancestor of human and chimp.

Orthologs for C16orf3 gene from 1 species (see representative species )    About this table
Organism Taxonomic
classification
Gene Description Human
Similarity
Orthology
Type
Details
chimpanzee
(Pan troglodytes)
Mammalia C16orf36
chromosome 16 open reading frame 3
98(a)
1 ↔ 1
16(89766770-89767063)


ENSEMBL Gene Tree for C16orf3 (if available)
TreeFam Gene Tree for C16orf3 (if available)

(Paralogs according to 1HomoloGene,
2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
About This Section

TryGeneCards Plus
  --

(SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
About This Section

TryGeneCards Plus

Polymorphic Variants from UniProtKB/Swiss-Prot
CP003_HUMAN, O95177: There seems to be two alleles of this protein


4 SNPs for C16orf3    About this table                                 

Genomic DataTranscription Related DataAllele Frequencies
SNP IDValidClinical
significance
Chr 16 posSequence#AA
Chg
TypeMore#Allele
freq
PopTotal
sample
More
----------
rs742654721,2
C--90096053(+) TGCTC-/CTTCTTGT 1 -- cds10--------
rs37851831,2,4
----see VAR_0568432 mis40--------
rs112749451,2
----90095545(+) GGAGC-/CCTACGGGGCAG/CTAC
GGGGCAGCCTATGGGGCAGG
CTACG
2 ACPIGCPVG AAP*G cds10--------
rs768807551,2
----90096055(+) CTCCT-/CTTTGTTT 2 -- cds10--------

HapMap Linkage Disequilibrium report for C16orf3 (90095316 - 90096309 bp)

Structural Variations
     Database of Genomic Variants (DGV) Selected variations for C16orf3 (see all 11):    About this table    
Variant IDTypeSubtypePubMed ID
dgv3009n71CNV Loss21882294
nsv907445CNV Loss21882294
nsv907429CNV Loss21882294
dgv3017n71CNV Loss21882294
dgv3016n71CNV Loss21882294
dgv3015n71CNV Loss21882294
nsv482951CNV Loss15286789
nsv457626CNV Loss19166990
nsv471119CNV Loss18288195
nsv471120CNV Gain18288195

Site Specific Mutation Identification with PCR Assays
SeqTarget long-range PCR primers for resequencing C16orf3
DNA2.0 Custom Variant and Variant Library Synthesis for C16orf3

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

TryGeneCards Plus
OMIM gene information: 605179    OMIM disorders: --


Find genes that share disorders with C16orf3           About GenesLikeMe


Export disorders for C16orf3 gene to outside databases

(in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
About This Section

TryGeneCards Plus

PubMed articles for C16orf3 gene integrated from 10 sources:
(articles sorted by number of sources associating them with C16orf3)
    Utopia: connect your pdf to the dynamic
world of online information

  1. Characterization and screening for mutations of the growth arrest- specific 11 (GAS11) and C16orf3 genes at 16q24.3 in breast cancer. (PubMed id 9790751)1, 2, 3 Whitmore S.A.... Callen D.F. (Genomics 1998)
  2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)
  3. The sequence and analysis of duplication-rich human chromosome 16. (PubMed id 15616553)2 Martin J.... Pennacchio L.A. (Nature 2004)
  4. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

TryGeneCards Plus
 ANDOR
Aliases
Free Text  

  Query String
PubMed
OMIM
NCBI Bookshelf
  (Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

TryGeneCards Plus
Entrez Gene: 750 HGNC: 1197 AceView: C16orf3 Ensembl:ENSG00000221819 euGenes: HUgn750
ECgene: C16orf3 H-InvDB: C16orf3

(According to HUGE)
About This Section

TryGeneCards Plus
  --

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
About This Section

TryGeneCards Plus
NameDescription
PharmGKB entry for C16orf3 Pharmacogenomics, SNPs, Pathways

(Patent information from GeneIP,
Licensable technologies from WIS Yeda, Salk, Tufts,
IP news from LifeMap Sciences, Inc.)
About This Section

TryGeneCards Plus
Patent Information for C16orf3 gene:
Search GeneIP for patents involving C16orf3

GeneCards and IP:
Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, eBioscience, antibodies-online, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from genOway)
About This Section

TryGeneCards Plus

 
 EMD Millipore genomic analysis products

  
 Browse Antibodies   Browse Cell Culture Products  
 Browse ELISAs   Browse Flow Cytometry Kits  
 Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
 Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
 Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
 Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
 Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
 Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
 Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
 Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for C16orf3  
 Browse OriGene qPCR primer pairs and template standards   OriGene Protein Over-expression Lysate for C16orf3  
 OriGene MassSpec for C16orf3   OriGene clones in human, mouse for C16orf3  
 OriGene qSTAR qPCR primer pairs in human, mouse for C16orf3   OriGene Purified Protein for C16orf3  
 Browse OriGene ORF clones   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
 OriGene Custom Antibody Services for C16orf3   OriGene Custom Protein Services for C16orf3  

 
 
 Block miRNA regulation of human, mouse, rat C16orf3 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing C16orf3
 DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat C16orf3 Predesigned siRNA for gene silencing in human, mouse, rat C16orf3
 QuantiFast Probe-based Assays in human, mouse, rat C16orf3 QuantiTect SYBR Green Assays in human, mouse, rat C16orf3
 Custom PCR Arrays for C16orf3 Search Chromatin IP Primers for C16orf3
 Pre-validated RT2 qPCR Primer Assay in human, mouse / rat C16orf3  Search GeneGlobe Interaction Network for C16orf3
 Regulatory tfbs in C16orf3 promoter
 GenScript Custom Purified and Recombinant Proteins Services for C16orf3 GenScript cDNA clones with any tag delivered in your preferred vector for C16orf3
 GenScript Custom Assay Services for C16orf3 GenScript Custom overexpressing Cell Line Services for C16orf3
 CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
 Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
 Plasmid Preparation Custom Peptide Services
 Search for Antibodies & Assays

 Search Tocris compounds for C16orf3 (CP003)
 Browse Sino Biological Proteins
 Browse Sino Biological Cell Lysates
 Browse Sino Biological cDNA Clones
 4000+ Proteins
 Search Sino Biological for antibodies, proteins & pathways
 Protein Production Services
 Transfection Reagents
 Protein A/G/L resins
 Isotyping reagents
 Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

 Novus Tissue Slides
 C16orf3 antibodies
 C16orf3 lysates
 Antibodies for C16orf3
 See all of Abcam's Antibodies, Kits and Proteins for C16orf3
 Custom Antibody / Protein Production Service
 Bulk Purchasing
 Advantages of Rabbit Monoclonal antibodies
 Abcam protocols and scientific support
 Browse ProSpec Recombinant Proteins
 Proteins for C16orf3
 Antibodies for C16orf3
 ELISAs for C16orf3
 CLIAs for C16orf3



 Browse ESI BIO Cell Lines and PureStem Progenitors for C16orf3
 Gene Synthesis
 Protein Engineering
 Variant Library Synthesis
 Codon Optimization
 Protein Production and Purification
 Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for C16orf3
 SwitchGear 3'UTR luciferase reporter plasmids for C16orf3
 SwitchGear Promoter luciferase reporter plasmids for C16orf3
 Search ThermoFisher Antibodies for C16orf3
 Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat C16orf3
 Browse compounds at ApexBio
 Search Addgene for plasmids for C16orf3
  Search eBioscience for proteins for C16orf3
  Search eBioscience for elisas for C16orf3
  eBioscience FlowRNA Probe Sets
 genOway: Develop your customized and physiologically relevant rodent model for C16orf3
  Search antibodies-online for antibodies for C16orf3
 antibodies-online kits for C16orf3 (2 products)
  Search antibodies-online for peptides for C16orf3
 antibodies-online proteins for C16orf3
       
GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014 , 7 Oct 2014

View Random Gene

Category
(GIFtS: )
GIFtS Group
The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes      Disease genes      C16orf3 gene at Home site.
Version: 3.12.252 27 Nov 2014
hostname: 356977-web1.xennexinc.com index build: 128 solr: 1.4