Free for academic non-profit institutions. Other users need a Commercial license

Aliases for C12orf57 Gene

Aliases for C12orf57 Gene

  • Chromosome 12 Open Reading Frame 57 2 3 5
  • C10 3 4
  • Likely Ortholog Of Mouse Gene Rich Cluster, C10 3
  • Gene Rich Cluster C10 Gene 2
  • Protein C10 3
  • GRCC10 3

External Ids for C12orf57 Gene

Previous GeneCards Identifiers for C12orf57 Gene

  • GC12P006927
  • GC12P006929
  • GC12P006932
  • GC12P006934
  • GC12P006937
  • GC12P006939
  • GC12P007053
  • GC12P007057
  • GC12P007059
  • GC12P007062
  • GC12P007094
  • GC12P007117
  • GC12P007150
  • GC12P007022
  • GC12P007082
  • GC12P007224
  • GC12P007273
  • GC12P007319

Summaries for C12orf57 Gene

Entrez Gene Summary for C12orf57 Gene

  • This gene is ubiquitously expressed in human tissues. It is required for development of the human corpus callosum. Mutations in this gene are associated with Temtamy syndrome (TEMTYS). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]

GeneCards Summary for C12orf57 Gene

C12orf57 (Chromosome 12 Open Reading Frame 57) is a Protein Coding gene. Diseases associated with C12orf57 include Temtamy Syndrome and Colobomatous Microphthalmia.

UniProtKB/Swiss-Prot for C12orf57 Gene

  • In brain, may be required for corpus callusum development.

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for C12orf57 Gene

Genomics for C12orf57 Gene

Regulatory Elements for C12orf57 Gene

Enhancers for C12orf57 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH12G006880 0.9 ENCODE 33.2 -62.1 -62107 1.6 ZFP64 ARID4B DMAP1 ZNF202 REST ZNF623 ZNF518A ZNF292 MIER3 ZBTB21 SPSB2 ENSG00000219410 C12orf57 GNB3 PHB2 ENSG00000247853 ENO2 CDCA3 USP5 ATN1
GH12G006762 1.8 FANTOM5 ENCODE dbSUPER 10.8 -176.6 -176574 7.2 CREB3L1 MLX AGO1 ZFP64 FEZF1 YY1 ZNF143 ZNF263 SP3 NFYC ENSG00000219410 ENSG00000247853 NCAPD2 SPSB2 GDF3 TNFRSF1A C12orf57 C1RL-AS1 ENSG00000256967 PHB2
GH12G006546 1.8 FANTOM5 ENCODE dbSUPER 10.8 -391.1 -391063 10.3 CREB3L1 AGO1 DMAP1 FEZF1 YY1 SLC30A9 ZNF143 ZNF548 ZNF263 SP3 ENSG00000219410 ENSG00000247853 NCAPD2 TAPBPL NOP2 SCARNA12 VAMP1 SPSB2 SCARNA11 CHD4
GH12G006602 1.7 FANTOM5 ENCODE dbSUPER 10.8 -337.3 -337251 7.4 HDGF PKNOX1 FOXA2 ARNT ARID4B SIN3A FEZF1 DMAP1 ZNF2 YY1 ENSG00000219410 ENSG00000247853 NOP2 ACRBP ZNF384 LPAR5 SCARNA11 IFFO1 ING4 C12orf57
GH12G006459 1.6 Ensembl ENCODE dbSUPER 10.8 -480.8 -480835 6.3 HDGF PKNOX1 CREB3L1 AGO1 ZFP64 ARID4B SIN3A DMAP1 ZNF2 YY1 TAPBPL MRPL51 VAMP1 ENSG00000219410 ENSG00000247853 GNB3 ENO2 C12orf57 RPL13P5 ENSG00000255966
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around C12orf57 on UCSC Golden Path with GeneCards custom track

Promoters for C12orf57 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000266980 1322 1401 MLX CREB3L1 AGO1 ZFP64 DMAP1 YY1 ZNF143 ZNF548 ZNF263 SP3

Genomic Location for C12orf57 Gene

6,942,978 bp from pter
6,946,003 bp from pter
3,026 bases
Plus strand

Genomic View for C12orf57 Gene

Genes around C12orf57 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
C12orf57 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for C12orf57 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for C12orf57 Gene

Proteins for C12orf57 Gene

  • Protein details for C12orf57 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein C10
    Protein Accession:
    Secondary Accessions:
    • B2R4Q6

    Protein attributes for C12orf57 Gene

    126 amino acids
    Molecular mass:
    13178 Da
    Quaternary structure:
    No Data Available

neXtProt entry for C12orf57 Gene

Post-translational modifications for C12orf57 Gene

  • Ubiquitination at posLast=8080 and posLast=8686
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for C12orf57 Gene

Domains & Families for C12orf57 Gene

Protein Domains for C12orf57 Gene


Suggested Antigen Peptide Sequences for C12orf57 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the UPF0456 family.
  • Belongs to the UPF0456 family.
genes like me logo Genes that share domains with C12orf57: view

No data available for Gene Families for C12orf57 Gene

Function for C12orf57 Gene

Molecular function for C12orf57 Gene

UniProtKB/Swiss-Prot Function:
In brain, may be required for corpus callusum development.

Phenotypes for C12orf57 Gene

MGI mutant phenotypes for C12orf57:
inferred from 1 alleles
GenomeRNAi human phenotypes for C12orf57:
genes like me logo Genes that share phenotypes with C12orf57: view

Human Phenotype Ontology for C12orf57 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for C12orf57 Gene

MGI Knock Outs for C12orf57:

Animal Model Products

CRISPR Products

miRNA for C12orf57 Gene

miRTarBase miRNAs that target C12orf57

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Transcription Factor Targets and HOMER Transcription for C12orf57 Gene

Localization for C12orf57 Gene

Subcellular locations from UniProtKB/Swiss-Prot for C12orf57 Gene


Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for C12orf57 gene
Compartment Confidence
cytosol 2
extracellular 1
mitochondrion 1
nucleus 1
endoplasmic reticulum 1

Gene Ontology (GO) - Cellular Components for C12orf57 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
genes like me logo Genes that share ontologies with C12orf57: view

Pathways & Interactions for C12orf57 Gene

SuperPathways for C12orf57 Gene

No Data Available

Gene Ontology (GO) - Biological Process for C12orf57 Gene


No data available for Pathways by source and SIGNOR curated interactions for C12orf57 Gene

Drugs & Compounds for C12orf57 Gene

No Compound Related Data Available

Transcripts for C12orf57 Gene

mRNA/cDNA for C12orf57 Gene

(5) REFSEQ mRNAs :
(4) Additional mRNA sequences :
(3) Selected AceView cDNA sequences:
(7) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for C12orf57 Gene

Chromosome 12 open reading frame 57:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for C12orf57 Gene

ExUns: 1a · 1b ^ 2a · 2b · 2c · 2d ^ 3a · 3b
SP1: - -

Relevant External Links for C12orf57 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for C12orf57 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for C12orf57 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for C12orf57 Gene

This gene is overexpressed in Breast (15.1) and Bone (6.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for C12orf57 Gene

NURSA nuclear receptor signaling pathways regulating expression of C12orf57 Gene:


SOURCE GeneReport for Unigene cluster for C12orf57 Gene:


mRNA Expression by UniProt/SwissProt for C12orf57 Gene:

Tissue specificity: Ubiquitously expressed, with higher expression in lung and fetal brain.

Evidence on tissue expression from TISSUES for C12orf57 Gene

  • Nervous system(4.7)
  • Lung(4.5)
  • Muscle(2.7)
  • Blood(2.4)
  • Intestine(2.4)
  • Skin(2.3)
  • Heart(2.2)
  • Stomach(2.1)
  • Gall bladder(2)
  • Kidney(2)
  • Lymph node(2)
  • Thyroid gland(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for C12orf57 Gene

Germ Layers:
  • ectoderm
  • mesoderm
  • cardiovascular
  • integumentary
  • nervous
  • skeletal muscle
  • skeleton
Head and neck:
  • brain
  • cheek
  • chin
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • forehead
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • mouth
  • nose
  • outer ear
  • skull
  • tooth
  • aorta
  • pelvis
  • digit
  • femur
  • finger
  • foot
  • hand
  • hip
  • knee
  • lower limb
  • shin
  • thigh
  • tibia
  • toe
  • upper limb
  • blood
  • blood vessel
  • hair
  • peripheral nervous system
  • skin
genes like me logo Genes that share expression patterns with C12orf57: view

Primer Products

No data available for mRNA differential expression in normal tissues and Protein tissue co-expression partners for C12orf57 Gene

Orthologs for C12orf57 Gene

This gene was present in the common ancestor of animals.

Orthologs for C12orf57 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia C12orf57 35
  • 100 (a)
C12H12orf57 34
  • 98.68 (n)
(Canis familiaris)
Mammalia C12orf57 35
  • 97 (a)
C27H12orf57 34
  • 92.63 (n)
(Monodelphis domestica)
Mammalia -- 35
  • 94 (a)
-- 35
  • 89 (a)
(Bos Taurus)
Mammalia C5H12orf57 34 35
  • 89.97 (n)
(Mus musculus)
Mammalia Grcc10 35 16 34
  • 88.62 (n)
(Gallus gallus)
Aves C12ORF57 34 35
  • 80.38 (n)
(Anolis carolinensis)
Reptilia C12orf57 35
  • 75 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia c12orf57 34
  • 60.3 (n)
(Danio rerio)
Actinopterygii C20H12orf57 35
  • 72 (a)
grcc10 34
  • 70.4 (n)
wufc02g04 34
fruit fly
(Drosophila melanogaster)
Insecta CG15387 35
  • 31 (a)
Species where no ortholog for C12orf57 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for C12orf57 Gene

Gene Tree for C12orf57 (if available)
Gene Tree for C12orf57 (if available)

Paralogs for C12orf57 Gene Pseudogenes for C12orf57 Gene

genes like me logo Genes that share paralogs with C12orf57: view

No data available for Paralogs for C12orf57 Gene

Variants for C12orf57 Gene

Sequence variations from dbSNP and Humsavar for C12orf57 Gene

SNP ID Clin Chr 12 pos Sequence Context AA Info Type
rs587776955 Pathogenic, Temtamy syndrome (TEMTYS) [MIM:218340] 6,944,575(+) GATGC(A/T)GCAAT intron-variant, reference, missense
rs587776954 Pathogenic 6,944,122(+) GCCCT(A/G)TGGCG intron-variant, nc-transcript-variant, downstream-variant-500B, reference, missense, utr-variant-5-prime
rs587777698 Pathogenic 6,944,607(+) AGATC(C/T)AGCAG intron-variant, upstream-variant-2KB, reference, stop-gained
rs797045421 Likely benign 6,944,199(+) GGCAT(-/AGGCTGCTGGCCTGGGGTAGTCAAGGCAT)GGGCT intron-variant, downstream-variant-500B
rs864309627 Likely benign 6,944,655(+) AAGGT(-/GGGTCAGACGCGGGAAGGC)GGGTC intron-variant, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for C12orf57 Gene

Variant ID Type Subtype PubMed ID
dgv2324n54 CNV loss 21841781
esv5830 CNV gain 19470904
nsv1035811 CNV gain 25217958
nsv1047373 CNV gain 25217958
nsv509453 CNV insertion 20534489
nsv557262 CNV gain 21841781

Variation tolerance for C12orf57 Gene

Residual Variation Intolerance Score: 50.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.88; 18.28% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for C12orf57 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for C12orf57 Gene

Disorders for C12orf57 Gene

MalaCards: The human disease database

(4) MalaCards diseases for C12orf57 Gene - From: OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
temtamy syndrome
  • craniofacial dysmorphism with ocular coloboma absent corpus callosum and aortic dilatation
colobomatous microphthalmia
  • mac
seizure disorder
  • epilepsy
- elite association - COSMIC cancer census association via MalaCards


  • Temtamy syndrome (TEMTYS) [MIM:218340]: A mental retardation/multiple congenital anomaly syndrome characterized by variable craniofacial dysmorphism, ocular coloboma, seizures, and brain abnormalities, including abnormalities of the corpus callosum and thalamus. {ECO:0000269 PubMed:23453665, ECO:0000269 PubMed:23453666, ECO:0000269 PubMed:23633300}. Note=The disease is caused by mutations affecting the gene represented in this entry. A variant resulting in a GUG start codon may be able to produce some protein because of a consensus Kozak sequence, although less efficiently than the wild type. This would explain the phenotypic variability observed.

Relevant External Links for C12orf57

Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with C12orf57: view

No data available for Genatlas for C12orf57 Gene

Publications for C12orf57 Gene

  1. Mutations in c12orf57 cause a syndromic form of colobomatous microphthalmia. (PMID: 23453665) Zahrani F. … Alkuraya F.S. (Am. J. Hum. Genet. 2013) 2 3 4 64
  2. Whole-exome sequencing identifies mutated c12orf57 in recessive corpus callosum hypoplasia. (PMID: 23453666) Akizu N. … Gleeson J.G. (Am. J. Hum. Genet. 2013) 3 4 64
  3. A newly recognized autosomal recessive syndrome affecting neurologic function and vision. (PMID: 23633300) Salih M.A. … Bosley T.M. (Am. J. Med. Genet. A 2013) 3 4 64
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
  5. Comparative sequence analysis of a gene-rich cluster at human chromosome 12p13 and its syntenic region in mouse chromosome 6. (PMID: 9445485) Ansari-Lari M.A. … Gibbs R.A. (Genome Res. 1998) 2 3 64

Products for C12orf57 Gene

Sources for C12orf57 Gene

Loading form....