Aliases for C12orf57 Gene
Aliases for C12orf57 Gene
External Ids for C12orf57 Gene
- HGNC: 29521
- Entrez Gene: 113246
- Ensembl: ENSG00000111678
- OMIM: 615140
- UniProtKB: Q99622
Previous GeneCards Identifiers for C12orf57 Gene
- GC12P006927
- GC12P006929
- GC12P006932
- GC12P006934
- GC12P006937
- GC12P006939
- GC12P007053
- GC12P007057
- GC12P007059
- GC12P007062
- GC12P007094
- GC12P007117
- GC12P007150
- GC12P007022
- GC12P007082
- GC12P007224
- GC12P007273
- GC12P007319
Summaries for C12orf57 Gene
-
This gene is ubiquitously expressed in human tissues. It is required for development of the human corpus callosum. Mutations in this gene are associated with Temtamy syndrome (TEMTYS). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
GeneCards Summary for C12orf57 Gene
C12orf57 (Chromosome 12 Open Reading Frame 57) is a Protein Coding gene. Diseases associated with C12orf57 include Temtamy Syndrome and Colobomatous Microphthalmia.
UniProtKB/Swiss-Prot for C12orf57 Gene
-
In brain, may be required for corpus callusum development.
No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for C12orf57 Gene
Genomics for C12orf57 Gene
Regulatory Elements for C12orf57 Gene
Enhancers for C12orf57 Gene
- Elite enhancer and/or Elite enhancer-gene association
Download GeneHancer data dump
Enhancers around C12orf57 on UCSC Golden Path with GeneCards custom track
- Transcription factor binding sites by QIAGEN in the C12orf57 gene promoter:
Regulatory Element Products
Genomic Location for C12orf57 Gene
- Chromosome:
- 12
- Start:
- 6,942,978 bp from pter
- End:
- 6,946,003 bp from pter
- Size:
- 3,026 bases
- Orientation:
- Plus strand
Genomic View for C12orf57 Gene
Genes around C12orf57 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 12p13.31 by Ensembl
- 12p13.31 by Entrez Gene
- 12p13.31 by HGNC
C12orf57 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for C12orf57 Gene
Proteins for C12orf57 Gene
-
Protein details for C12orf57 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q99622-C10_HUMAN
- Recommended name:
- Protein C10
- Protein Accession:
- Q99622
- B2R4Q6
Protein attributes for C12orf57 Gene
- Size:
- 126 amino acids
- Molecular mass:
- 13178 Da
- Quaternary structure:
- No Data Available
Protein Expression for C12orf57 Gene
Post-translational modifications for C12orf57 Gene
Other Protein References for C12orf57 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- Novus Biologicals Antibodies for C12orf57
-
Abcam antibodies for C12orf57
- Invitrogen Antibodies for C12orf57
- antibodies-online Antibodies for C12orf57: See all 23
- Search GeneTex for Antibodies for C12orf57
Protein Products
-
OriGene Purified Proteins for C12orf57
- Search Origene for MassSpec and Protein Over-expression Lysates for C12orf57
- Origene Custom Protein Services for C12orf57
- antibodies-online Proteins for C12orf57: See all 22
- Search antibodies-online for peptides
- Search GeneTex for Proteins for C12orf57
-
Abcam proteins for C12orf57
Assay Products
No data available for DME Specific Peptides for C12orf57 Gene
Domains & Families for C12orf57 Gene
Suggested Antigen Peptide Sequences for C12orf57 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
Q99622- Family:
-
- Belongs to the UPF0456 family.
No data available for Gene Families for C12orf57 Gene
Function for C12orf57 Gene
Molecular function for C12orf57 Gene
- UniProtKB/Swiss-Prot Function:
- In brain, may be required for corpus callusum development.
Phenotypes for C12orf57 Gene
- MGI mutant phenotypes for C12orf57:
- inferred from 1 alleles
- GenomeRNAi human phenotypes for C12orf57:
Animal Models for C12orf57 Gene
- MGI Knock Outs for C12orf57:
-
- Grcc10 tm1.1(KOMP)Vlcg
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for C12orf57
-
-
ViGene Biosciences lentiviral particle packaged cDNA for C12orf57 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for C12orf57 gene
- Search ViGene Biosciences for C12orf57
CRISPR Products
-
OriGene CRISPR knockouts for C12orf57
-
Santa Cruz Biotechnology (SCBT) CRISPR for C12orf57
- GenScript: Design CRISPR guide RNA sequences for C12orf57
miRNA for C12orf57 Gene
- miRTarBase miRNAs that target C12orf57
miRNA Products
- Search ViGene Biosciences for C12orf57
Inhibitory RNA Products
- Origene RNAi, siRNA, and shRNA products in human, mouse, rat for C12orf57
- Browse OriGene Inhibitory RNA Products For C12orf57
-
ViGene Biosciences ready-to-package AAV shRNAs for C12orf57 gene
Clone Products
- Sino Biological Human cDNA Clone for C12orf57
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for C12orf57
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for C12orf57
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Cell Line Products
-
Horizon Cell Lines for C12orf57
-
ViGene Biosciences adenoviral particle packaged cDNA for C12orf57 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for C12orf57 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for C12orf57 gene
Flow Cytometry Products
No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Transcription Factor Targets and HOMER Transcription for C12orf57 Gene
Localization for C12orf57 Gene
Subcellular locations from UniProtKB/Swiss-Prot for C12orf57 Gene
- Cytoplasm.
| Compartment | Confidence |
|---|---|
| cytosol | 2 |
| extracellular | 1 |
| mitochondrion | 1 |
| nucleus | 1 |
| endoplasmic reticulum | 1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005737 | cytoplasm | IEA | -- |
Pathways & Interactions for C12orf57 Gene
No Data Available
No data available for Pathways by source and SIGNOR curated interactions for C12orf57 Gene
Transcripts for C12orf57 Gene
mRNA/cDNA for C12orf57 Gene
- (5) REFSEQ mRNAs :
- (4) Additional mRNA sequences :
- (3) Selected AceView cDNA sequences:
- (7) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for C12orf57 Gene
CRISPR Products
-
OriGene CRISPR knockouts for C12orf57
-
Santa Cruz Biotechnology (SCBT) CRISPR for C12orf57
- GenScript: Design CRISPR guide RNA sequences for C12orf57
miRNA Products
- Search ViGene Biosciences for C12orf57
Inhibitory RNA Products
- Origene RNAi, siRNA, and shRNA products in human, mouse, rat for C12orf57
- Browse OriGene Inhibitory RNA Products For C12orf57
-
ViGene Biosciences ready-to-package AAV shRNAs for C12orf57 gene
Clone Products
- Sino Biological Human cDNA Clone for C12orf57
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for C12orf57
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for C12orf57
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Flow Cytometry Products
| ExUns: | 1a | · | 1b | ^ | 2a | · | 2b | · | 2c | · | 2d | ^ | 3a | · | 3b |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | - | |||||||||||||
| SP2: | |||||||||||||||
| SP3: |
Expression for C12orf57 Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
- Brain (Nervous System)
- Intestine (Gastrointestinal Tract)
- Bone (Muscoskeletal System)
-
Uterus (Reproductive System)
-
Colon (Gastrointestinal Tract)
-
Prostate (Endocrine System)
-
Placenta (Extraembryonic Tissues)
-
Spleen (Hematopoietic System)
-
Thyroid (Endocrine System)
-
Gall Bladder (Hepatobiliary System)
-
Lung (Respiratory System)
-
Kidney (Urinary System)
-
Testis (Reproductive System)
-
Adrenal Gland (Endocrine System)
-
Esophagus (Gastrointestinal Tract)
-
Stomach (Gastrointestinal Tract)
-
Liver (Hepatobiliary System)
-
Pancreas (Endocrine System)
-
Ovary (Reproductive System)
-
Adipose (Muscoskeletal System)
This gene is overexpressed in Breast (15.1) and Bone (6.7).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for C12orf57 Gene
NURSA nuclear receptor signaling pathways regulating expression of C12orf57 Gene:
C12orf57SOURCE GeneReport for Unigene cluster for C12orf57 Gene:
Hs.405913mRNA Expression by UniProt/SwissProt for C12orf57 Gene:
Q99622-C10_HUMAN
Tissue specificity:
Ubiquitously expressed, with higher expression in lung and fetal brain.
Evidence on tissue expression from TISSUES for C12orf57 Gene
- Nervous system(4.7)
- Lung(4.5)
- Muscle(2.7)
- Blood(2.4)
- Intestine(2.4)
- Skin(2.3)
- Heart(2.2)
- Stomach(2.1)
- Gall bladder(2)
- Kidney(2)
- Lymph node(2)
- Thyroid gland(2)
Phenotype-based relationships between genes and organs from Gene ORGANizer for C12orf57 Gene
Germ Layers:
- ectoderm
- mesoderm
Systems:
- cardiovascular
- integumentary
- nervous
- skeletal muscle
- skeleton
Organs:
Head and neck:
- brain
- cheek
- chin
- cranial nerve
- ear
- eye
- eyelid
- face
- forehead
- head
- jaw
- lip
- mandible
- maxilla
- mouth
- nose
- outer ear
- skull
- tooth
Thorax:
- aorta
Pelvis:
- pelvis
Limb:
- digit
- femur
- finger
- foot
- hand
- hip
- knee
- lower limb
- shin
- thigh
- tibia
- toe
- upper limb
General:
- blood
- blood vessel
- hair
- peripheral nervous system
- skin
Primer Products
-
OriGene qPCR primer pairs for C12orf57
-
OriGene qPCR primer pairs and template standards for C12orf57
No data available for mRNA differential expression in normal tissues and Protein tissue co-expression partners for C12orf57 Gene
Orthologs for C12orf57 Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | C12orf57 35 |
|
OneToOne | |
| C12H12orf57 34 |
|
||||
| dog (Canis familiaris) |
Mammalia | C12orf57 35 |
|
OneToOne | |
| C27H12orf57 34 |
|
||||
| oppossum (Monodelphis domestica) |
Mammalia | -- 35 |
|
OneToMany | |
| -- 35 |
|
OneToMany | |||
| cow (Bos Taurus) |
Mammalia | C5H12orf57 34 35 |
|
||
| mouse (Mus musculus) |
Mammalia | Grcc10 34 16 35 |
|
||
| chicken (Gallus gallus) |
Aves | C12ORF57 34 35 |
|
||
| lizard (Anolis carolinensis) |
Reptilia | C12orf57 35 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | c12orf57 34 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | C20H12orf57 35 |
|
OneToOne | |
| grcc10 34 |
|
||||
| wufc02g04 34 |
|
||||
| fruit fly (Drosophila melanogaster) |
Insecta | CG15387 35 |
|
OneToOne |
- Species where no ortholog for C12orf57 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- platypus (Ornithorhynchus anatinus)
- rainbow trout (Oncorhynchus mykiss)
- rat (Rattus norvegicus)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Paralogs for C12orf57 Gene
Pseudogenes.org Pseudogenes for C12orf57 Gene
No data available for Paralogs for C12orf57 Gene
Variants for C12orf57 Gene
| SNP ID | Clin | Chr 12 pos | Sequence Context | AA Info | Type |
|---|---|---|---|---|---|
| rs587776955 | Pathogenic, Temtamy syndrome (TEMTYS) [MIM:218340] | 6,944,575(+) | GATGC(A/T)GCAAT | intron-variant, reference, missense | |
| rs587776954 | Pathogenic | 6,944,122(+) | GCCCT(A/G)TGGCG | intron-variant, nc-transcript-variant, downstream-variant-500B, reference, missense, utr-variant-5-prime | |
| rs587777698 | Pathogenic | 6,944,607(+) | AGATC(C/T)AGCAG | intron-variant, upstream-variant-2KB, reference, stop-gained | |
| rs797045421 | Likely benign | 6,944,199(+) | GGCAT(-/AGGCTGCTGGCCTGGGGTAGTCAAGGCAT)GGGCT | intron-variant, downstream-variant-500B | |
| rs864309627 | Likely benign | 6,944,655(+) | AAGGT(-/GGGTCAGACGCGGGAAGGC)GGGTC | intron-variant, upstream-variant-2KB |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| dgv2324n54 | CNV | loss | 21841781 |
| esv5830 | CNV | gain | 19470904 |
| nsv1035811 | CNV | gain | 25217958 |
| nsv1047373 | CNV | gain | 25217958 |
| nsv509453 | CNV | insertion | 20534489 |
| nsv557262 | CNV | gain | 21841781 |
Residual Variation Intolerance Score:
50.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
0.88;
18.28% of all genes are more intolerant (likely to be disease-causing)
Relevant External Links for C12orf57 Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for C12orf57 Gene
Disorders for C12orf57 Gene
(4) MalaCards diseases for C12orf57 Gene - From: OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| temtamy syndrome |
|
|
| colobomatous microphthalmia |
|
|
| lagophthalmos |
|
|
| seizure disorder |
|
|
Search C12orf57 in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
C10_HUMAN- Temtamy syndrome (TEMTYS) [MIM:218340]: A mental retardation/multiple congenital anomaly syndrome characterized by variable craniofacial dysmorphism, ocular coloboma, seizures, and brain abnormalities, including abnormalities of the corpus callosum and thalamus. {ECO:0000269 PubMed:23453665, ECO:0000269 PubMed:23453666, ECO:0000269 PubMed:23633300}. Note=The disease is caused by mutations affecting the gene represented in this entry. A variant resulting in a GUG start codon may be able to produce some protein because of a consensus Kozak sequence, although less efficiently than the wild type. This would explain the phenotypic variability observed.
Relevant External Links for C12orf57
No data available for Genatlas for C12orf57 Gene
Publications for C12orf57 Gene
- Mutations in c12orf57 cause a syndromic form of colobomatous microphthalmia. (PMID: 23453665) Zahrani F. … Alkuraya F.S. (Am. J. Hum. Genet. 2013) 2 3 4 64
- Whole-exome sequencing identifies mutated c12orf57 in recessive corpus callosum hypoplasia. (PMID: 23453666) Akizu N. … Gleeson J.G. (Am. J. Hum. Genet. 2013) 3 4 64
- A newly recognized autosomal recessive syndrome affecting neurologic function and vision. (PMID: 23633300) Salih M.A. … Bosley T.M. (Am. J. Med. Genet. A 2013) 3 4 64
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
- Comparative sequence analysis of a gene-rich cluster at human chromosome 12p13 and its syntenic region in mouse chromosome 6. (PMID: 9445485) Ansari-Lari M.A. … Gibbs R.A. (Genome Res. 1998) 2 3 64
Products for C12orf57 Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Browse OriGene Antibodies
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for C12orf57
- Search Origene for MassSpec and Protein Over-expression Lysates for C12orf57
- Origene Custom Protein Services for C12orf57
- Origene shRNA, siRNA, and RNAi products in human, mouse, rat for C12orf57
- Browse OriGene Inhibitory RNA Products For C12orf57
- OriGene qPCR primer pairs and template standards for C12orf57
- OriGene qPCR primer pairs for C12orf57
- OriGene CRISPR knockouts for C12orf57
- OriGene ORF clones in human for C12orf57
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For C12orf57
- GenScript: Next-day shipping cDNA ORF clone for C12orf57 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for C12orf57
- GenScript Custom Assay Services for C12orf57
- GenScript Custom overexpressing Cell Line Services for C12orf57
- GenScript: Design CRISPR guide RNA sequences for C12orf57
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for C12orf57
- Sino Biological Human cDNA Clone for C12orf57
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Proteins
- Sino Biological Antibodies
- Sino Biological ELISA Kits and Pair Sets
- Sino Biological Cell Lysates
- Sino Biological qPCR Primers
- Sino Biological CRO Services for Proteins, Antibodies and Genes
- Sino Biological Transfection Reagents
- Novus Biologicals Antibodies for C12orf57
- Novus Biologicals proteins and lysates for C12orf57
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Abcam antibodies for C12orf57
- Abcam proteins for C12orf57
- Search for Assays for C12orf57 at Abcam
- Find your target
- Search knockout validated antibodies
- Browse monoclonal antibodies
- antibodies-online Antibodies for C12orf57: See all 23
- Search antibodies-online for kits
- antibodies-online Proteins for C12orf57: See all 22
- Search antibodies-online for peptides
- Search GeneTex for Antibodies for C12orf57
- Search GeneTex for Proteins for C12orf57
- ViGene Biosciences adenoviral particle packaged cDNA for C12orf57 gene
- ViGene Biosciences lentiviral particle packaged cDNA for C12orf57 gene
- ViGene Biosciences ready-to-package AAV shRNAs for C12orf57 gene
- Search ViGene Biosciences for C12orf57
- Horizon Cell Lines for C12orf57
- Cyagen custom Knockout/knockin (KOKI) mouse models for C12orf57
- VectorBuilder custom plasmid, inducible vectors for C12orf57
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for C12orf57
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Sources for C12orf57 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) RNAdb
- (29) ASD
- (30) ECgene
- (31) GeneAnnot
- (32) CGAP SAGE
- (33) SOURCE
- (34) HomoloGene
- (35) PanEnsembl
- (36) euGenes
- (37) SGD
- (38) FlyBase
- (39) WormBase
- (40) Pseudogene
- (41) DGV
- (42) dbSNP
- (43) GenAtlas
- (44) GeneTests
- (45) HGMD
- (46) GAD
- (47) LSDB
- (48) BGMUT
- (49) HuGE
- (50) eBioscience
- (51) Atlas
- (52) Cell Signaling Technology
- (53) GenBank
- (54) H-invDB
- (55) HORDE
- (56) HUGE
- (57) IMGT
- (58) Leiden
- (59) MILLIPORE
- (60) miRBase
- (61) DME
- (62) NCBI
- (63) OriGene
- (64) PubMed
- (65) R&D Systems
- (66) TGDB
- (67) Tocris
- (68) Abcam
- (69) Novus
- (70) ProSpec
- (71) Sino Biological
- (72) GenScript
- (73) Qiagen
- (74) Cloud-Clone Corp.
- (75) Enzo Life Sciences
- (76) OCA
- (77) Proteopedia
- (78) MOPED
- (79) SPIRE
- (80) neXtProt
- (81) Reactome
- (82) GeneGo (Thomson Reuters)
- (83) fRNAdb
- (84) DISEASES
- (85) SIMAP
- (86) GenomeRNAi
- (87) LifeMap
- (88) miRTarBase
- (89) MalaCards
- (90) Invitrogen
- (91) BitterDB
- (92) Vector BioLabs
- (93) ESI-BIO
- (94) RefSeq
- (95) BioSystems
- (96) MaxQB
- (97) IUPHAR
- (98) BioGPS
- (99) Illumina
- (100) COMPARTMENTS
- (101) HOMER
- (102) PaxDb
- (103) ApexBio
- (104) Addgene
- (105) antibodies-online
- (106) CYP
- (107) NONCODE
- (108) SwitchGear Genomics
- (109) TreeFam
- (110) PathCards
- (111) GeneReviews
- (112) GeneTex
- (113) Taconic Biosciences
- (114) GTEx
- (115) ProteomicsDB
- (116) SCBT
- (117) DGIdb
- (118) ClinicalTrials
- (119) FDA Approved Drugs
- (120) RVIS
- (121) SIGNOR
- (122) diseasecard
- (123) NIH Rare Diseases
- (124) Orphanet
- (125) UMLS
- (126) GTR
- (127) Disease Ontology
- (128) Genetics Home Reference
- (129) MeSH
- (130) MedlinePlus
- (131) CDC
- (132) NINDS
- (133) NCBI Bookshelf
- (134) ClinVar
- (135) Gene Damage Index
- (136) ViGene Biosciences
- (137) HPO
- (138) UDN
- (139) VISTA
- (140) FANTOM5
- (141) ENCODE
- (142) ProSci
- (143) Horizon
- (144) NURSA
- (145) IID
- (146) Cyagen
- (147) VectorBuilder
- (148) SNPedia
- (149) BRCA Exchange
- (150) St John's Lab
- (151) CIViC
- (152) ProteoGenix
- (153) dbSUPER
- (154) TISSUES
- (155) Gene ORGANizer