Free for academic non-profit institutions. Other users need a Commercial license

Aliases for BTN2A1 Gene

Aliases for BTN2A1 Gene

  • Butyrophilin Subfamily 2 Member A1 2 3 5
  • BT2.1 3 4
  • BTF1 3 4
  • Butyrophilin, Subfamily 2, Member A1 2
  • BK14H9.1 3
  • DJ3E1.1 3
  • BTN2.1 3

External Ids for BTN2A1 Gene

Previous GeneCards Identifiers for BTN2A1 Gene

  • GC06P026515
  • GC06P026566
  • GC06P026458
  • GC06P026400

Summaries for BTN2A1 Gene

Entrez Gene Summary for BTN2A1 Gene

  • This gene encodes a member of the immunoglobulin superfamily. The gene is located in a cluster of butyrophilin-like genes in the juxta-telomeric region of the major histocompatibility complex on chromosome 6. A pseudogene of this gene has been identified in this cluster. The encoded protein is an integral plasma membrane protein involved in lipid, fatty-acid, and sterol metabolism. Alterations in this gene may be associated with several disease states including metabolic syndrome. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]

GeneCards Summary for BTN2A1 Gene

BTN2A1 (Butyrophilin Subfamily 2 Member A1) is a Protein Coding gene. Among its related pathways are Immune System and Class I MHC mediated antigen processing and presentation. An important paralog of this gene is BTN2A2.

No data available for UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for BTN2A1 Gene

Genomics for BTN2A1 Gene

Regulatory Elements for BTN2A1 Gene

Enhancers for BTN2A1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH06F026489 0.5 ENCODE 27.4 +32.4 32359 1.8 SMARCA5 ZKSCAN8 PBX2 KDM1A NFE2 BTN2A1 BTN3A2 RNU6-502P HCG11 BTN2A2 HMGN4 HIST1H4H HIST1H2AH BTN1A1 LOC285819
GH06F026456 0.6 ENCODE 27.3 +0.2 190 2.4 HDGF PKNOX1 ATF1 MLX ARNT CREB3L1 ARID4B SIN3A YBX1 DMAP1 BTN2A1 BTN3A1 BTN2A3P HMGN4 PIR45294
GH06F026531 1.7 FANTOM5 Ensembl ENCODE 23.6 +75.3 75288 2.4 ARNT MLX ZFP64 ARID4B SIN3A DMAP1 ZNF2 YY1 SLC30A9 ZNF766 HMGN4 BTN2A1 BTN3A2 ABT1 BTN1A1 GC06M026538 TRR-ACG1-2 TRT-AGT2-1
GH06F026445 0.9 ENCODE 18 -11.8 -11827 1.3 HDGF PKNOX1 TBL1XR1 EBF1 ZBTB40 RELA EED ETV6 CREM CHD2 BTN2A2 BTN2A1 BTN3A1 BTN1A1 HIST1H2APS4 HIST1H3G LOC102724851 GC06M026555 BTN3A3
GH06F026455 0.5 Ensembl 17.5 -2.6 -2604 0.2 HLF ZNF24 NFE2 MNT ZBTB17 BTN2A1 BTN1A1 BTN2A2 BTN3A2 HMGN4 GC06M026555
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around BTN2A1 on UCSC Golden Path with GeneCards custom track

Promoters for BTN2A1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00001214099 496 1601 HDGF PKNOX1 ATF1 ARNT MLX CREB3L1 ARID4B SIN3A YBX1 DMAP1

Genomic Location for BTN2A1 Gene

Chromosome:
6
Start:
26,457,904 bp from pter
End:
26,476,621 bp from pter
Size:
18,718 bases
Orientation:
Plus strand

Genomic View for BTN2A1 Gene

Genes around BTN2A1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
BTN2A1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for BTN2A1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for BTN2A1 Gene

Proteins for BTN2A1 Gene

  • Protein details for BTN2A1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q7KYR7-BT2A1_HUMAN
    Recommended name:
    Butyrophilin subfamily 2 member A1
    Protein Accession:
    Q7KYR7
    Secondary Accessions:
    • B4DLP9
    • E9PGR4
    • O00475
    • P78408
    • Q59EN4
    • Q7KYQ7
    • Q7Z386
    • Q96AV7
    • Q9NU62

    Protein attributes for BTN2A1 Gene

    Size:
    527 amino acids
    Molecular mass:
    59633 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=BAD93014.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305}; Sequence=CAB71221.2; Type=Erroneous gene model prediction; Evidence={ECO:0000305};

    Alternative splice isoforms for BTN2A1 Gene

neXtProt entry for BTN2A1 Gene

Post-translational modifications for BTN2A1 Gene

  • Ubiquitination at Lys 280
  • Glycosylation at Asn 46, Asn 114, and Asn 120
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for BTN2A1 Gene

Domains & Families for BTN2A1 Gene

Graphical View of Domain Structure for InterPro Entry

Q7KYR7

UniProtKB/Swiss-Prot:

BT2A1_HUMAN :
  • Contains 1 B30.2/SPRY domain.
  • Belongs to the immunoglobulin superfamily. BTN/MOG family.
Domain:
  • Contains 1 B30.2/SPRY domain.
  • Contains 1 Ig-like V-type (immunoglobulin-like) domain.
Family:
  • Belongs to the immunoglobulin superfamily. BTN/MOG family.
genes like me logo Genes that share domains with BTN2A1: view

Function for BTN2A1 Gene

Molecular function for BTN2A1 Gene

GENATLAS Biochemistry:
butyrophilin subfamily 2,member A1,B box family of proteins,involved in cell proliferation and development

Gene Ontology (GO) - Molecular Function for BTN2A1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
genes like me logo Genes that share ontologies with BTN2A1: view

Phenotypes for BTN2A1 Gene

genes like me logo Genes that share phenotypes with BTN2A1: view

Animal Model Products

miRNA for BTN2A1 Gene

miRTarBase miRNAs that target BTN2A1

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for BTN2A1 Gene

Localization for BTN2A1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for BTN2A1 Gene

Membrane; Single-pass type I membrane protein.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for BTN2A1 Gene COMPARTMENTS Subcellular localization image for BTN2A1 gene
Compartment Confidence
extracellular 5
plasma membrane 5
endoplasmic reticulum 2

Gene Ontology (GO) - Cellular Components for BTN2A1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005887 integral component of plasma membrane TAS 9382921
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
GO:0070062 extracellular exosome IDA 23376485
genes like me logo Genes that share ontologies with BTN2A1: view

Pathways & Interactions for BTN2A1 Gene

genes like me logo Genes that share pathways with BTN2A1: view

Pathways by source for BTN2A1 Gene

2 Reactome pathways for BTN2A1 Gene

Interacting Proteins for BTN2A1 Gene

STRING Interaction Network Preview (showing 5 interactants - click image to see 7)
http://string-db.org/version_10/api/image/networkList?limit=0&targetmode=proteins&caller_identity=gene_cards&network_flavor=evidence&identifiers=9606.ENSP00000312158%0d%0a9606.ENSP00000266556%0d%0a9606.ENSP00000344818%0d%0a9606.ENSP00000364650%0d%0a9606.ENSP00000364467%0d%0a9606.ENSP00000377370%0d%0a
Selected Interacting proteins: ENSP00000312158 Q7KYR7-BT2A1_HUMAN for BTN2A1 Gene via STRING IID

Gene Ontology (GO) - Biological Process for BTN2A1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006629 lipid metabolic process TAS 9382921
genes like me logo Genes that share ontologies with BTN2A1: view

No data available for SIGNOR curated interactions for BTN2A1 Gene

Transcripts for BTN2A1 Gene

Unigene Clusters for BTN2A1 Gene

Butyrophilin, subfamily 2, member A1:
Representative Sequences:

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for BTN2A1 Gene

ExUns: 1a · 1b ^ 2 ^ 3a · 3b · 3c ^ 4 ^ 5 ^ 6a · 6b
SP1:
SP2: -
SP3: -
SP4:

Relevant External Links for BTN2A1 Gene

GeneLoc Exon Structure for
BTN2A1
ECgene alternative splicing isoforms for
BTN2A1

Expression for BTN2A1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for BTN2A1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for BTN2A1 Gene

This gene is overexpressed in Breast (46.3) and Cerebrospinal fluid (7.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for BTN2A1 Gene



Protein tissue co-expression partners for BTN2A1 Gene

NURSA nuclear receptor signaling pathways regulating expression of BTN2A1 Gene:

BTN2A1

SOURCE GeneReport for Unigene cluster for BTN2A1 Gene:

Hs.159028

mRNA Expression by UniProt/SwissProt for BTN2A1 Gene:

Q7KYR7-BT2A1_HUMAN
Tissue specificity: Highly expressed in brain, bone marrow, small intestine, muscle, spleen and pancreas. Moderate expression was seen in lung, liver and kidney.
genes like me logo Genes that share expression patterns with BTN2A1: view

Primer Products

No data available for mRNA differential expression in normal tissues for BTN2A1 Gene

Orthologs for BTN2A1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for BTN2A1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia BTN2A1 34
  • 99.11 (n)
-- 35
  • 37 (a)
ManyToMany
dog
(Canis familiaris)
Mammalia -- 35
  • 70 (a)
OneToMany
mouse
(Mus musculus)
Mammalia Btn2a2 35
  • 64 (a)
OneToMany
cow
(Bos Taurus)
Mammalia -- 35
  • 57 (a)
OneToMany
oppossum
(Monodelphis domestica)
Mammalia -- 35
  • 53 (a)
OneToMany
platypus
(Ornithorhynchus anatinus)
Mammalia -- 35
  • 40 (a)
OneToMany
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100485231 34
  • 48.92 (n)
Species where no ortholog for BTN2A1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for BTN2A1 Gene

ENSEMBL:
Gene Tree for BTN2A1 (if available)
TreeFam:
Gene Tree for BTN2A1 (if available)

Paralogs for BTN2A1 Gene

Paralogs for BTN2A1 Gene

(12) SIMAP similar genes for BTN2A1 Gene using alignment to 4 proteins:

Pseudogenes.org Pseudogenes for BTN2A1 Gene

genes like me logo Genes that share paralogs with BTN2A1: view

Variants for BTN2A1 Gene

Sequence variations from dbSNP and Humsavar for BTN2A1 Gene

SNP ID Clin Chr 06 pos Sequence Context AA Info Type
rs10484441 -- 26,474,514(+) GATAG(C/G)AATAT intron-variant
rs10692365 -- 26,462,029(+) AAAAA(-/AT)TTTTT intron-variant
rs111371249 -- 26,457,078(+) GCCTC(C/T)AGACT upstream-variant-2KB
rs111758640 -- 26,471,667(+) GAAAG(A/G)AAGGA intron-variant
rs11267390 -- 26,459,942(+) TTTTC(-/CACAGGGAGATTCCACAGGGA)CACTC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for BTN2A1 Gene

Variant ID Type Subtype PubMed ID
dgv5927n100 CNV gain 25217958
dgv5928n100 CNV loss 25217958
esv2763996 CNV gain 21179565
esv3576106 CNV gain 25503493
nsv1017824 CNV gain+loss 25217958
nsv1023453 CNV gain 25217958
nsv1031938 CNV loss 25217958
nsv528172 CNV loss 19592680
nsv601185 CNV loss 21841781
nsv965689 CNV duplication 23825009

Variation tolerance for BTN2A1 Gene

Residual Variation Intolerance Score: 92.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.29; 76.48% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for BTN2A1 Gene

Human Gene Mutation Database (HGMD)
BTN2A1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
BTN2A1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for BTN2A1 Gene

Disorders for BTN2A1 Gene

Relevant External Links for BTN2A1

Genetic Association Database (GAD)
BTN2A1
Human Genome Epidemiology (HuGE) Navigator
BTN2A1
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
BTN2A1

No disorders were found for BTN2A1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for BTN2A1 Gene

Publications for BTN2A1 Gene

  1. Cloning, localization, and structure of new members of the butyrophilin gene family in the juxta-telomeric region of the major histocompatibility complex. (PMID: 9382921) Tazi-Ahnini R. … Pontarotti P. (Immunogenetics 1997) 2 3 4 64
  2. A 1.1-Mb transcript map of the hereditary hemochromatosis locus. (PMID: 9149941) Ruddy D.A. … Feder J.N. (Genome Res. 1997) 2 3 4 64
  3. The B7 homolog butyrophilin BTN2A1 is a novel ligand for DC-SIGN. (PMID: 17785817) Malcherek G. … Trowsdale J. (J. Immunol. 2007) 3 22 64
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4 64
  5. The DNA sequence and analysis of human chromosome 6. (PMID: 14574404) Mungall A.J. … Beck S. (Nature 2003) 3 4 64

Products for BTN2A1 Gene

Sources for BTN2A1 Gene

Content
Loading form....